Method Article

A Quantitative Detection Method for MicroRNAs in the Kidney of an Ischemic Kidney Injury Mouse Model

DOI:

10.3791/61378

September 11th, 2020

In This Article

Summary

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

This article presents a protocol for detecting microRNA expression in the kidneys of an acute kidney injury mouse model using quantitative real-time reverse-transcription polymerase chain reaction. This protocol emphasizes an ischemic kidney injury mouse model and the careful extraction of microRNA samples.

Abstract

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

MicroRNAs (miRNAs) are involved in various disease states and are effective biomarkers for the early diagnosis of diseases and treatment in mice. However, standard protocols for the purification of miRNAs and detection of their expression in the kidneys of acute kidney injury (AKI) mice have not been well established. This study developed an effective and simple protocol to purify and quantify miRNAs in the kidneys of an AKI mouse model induced by renal ischemia-reperfusion using quantitative real-time reverse-transcription polymerase chain reaction (qRT-PCR). This protocol comprises five steps: 1) induction of AKI by renal ischemia-reperfusion, 2) harvesting of kidneys, 3) purification of total RNA, including miRNAs, from kidneys, 4) cDNA synthesis by reverse transcription of miRNA, and 5) qRT-PCR to detect miRNA expression. Using this protocol, the renal ischemia-reperfusion injury model can be generated with mild to severe forms of AKI. Additionally, if the procedure is followed properly, a consistent AKI model with minimal individual differences can be obtained. This qRT-PCR assay shows a very wide dynamic range and enables the discrimination of mature miRNAs, which can be accurately quantified with high specificity. This protocol can be used to study the miRNA expression profile in AKI kidneys.

Introduction

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Ischemia-reperfusion injury (IRI) of the kidney represents one of the major risk factors for Acute kidney injury (AKI) development1. AKI plays a significant role in patient prognosis, but specific therapies and early diagnostic biomarkers have not been established.

MicroRNAs (miRNAs) are short, non-coding RNAs with approximately 18–25 bases. miRNAs are stable in body fluids, and their sequences are highly conserved among animals2. MiRNAs regulate the expression of multiple proteins through thousands of targets, thereby influencing diverse signaling pathways2,3,4,5,6,7,8. In recent years, it has been reported that miRNAs are involved in various disease states and are effective biomarkers for the early diagnosis of several diseases.

The overall goal of this protocol is to successfully purify and detect miRNAs in the kidneys of an AKI mouse model induced by IRI. This IRI model is a widely used model of AKI and renal fibrosis. The advantages of the IRI model include being able to visually confirm whether ischemia-reperfusion has been achieved and determine the exact time of AKI onset. However, a clamp duration that is long enough to cause broad tubular damage is associated with a high mortality rate, whereas a short clamp duration does not cause tubular damage, which results in a large variation in tubular damage progression in this experimental model. Compared with the bilateral clamping model, the right nephrectomy tissue harvested in the unilateral renal IRI model acts as a control and ensures renal failure.

The kidney sample is mashed using a glass homogenizer, wherein, proteins and nucleic acids are separated, and DNA and RNA are separated9. Total RNA, including miRNA, is purified from the kidney sample using a silica-membrane-based spin column9. Subsequently, cDNA synthesis (reverse transcription) is performed from total RNA using poly(A) polymerase and oligo-dT primers10. Finally, the miRNA expression is determined by qRT-PCR using an intercalating dye10. qRT-PCR can more accurately quantify gene expression compared with PCR of amplification volumes at endpoints. qRT-PCR measures high concentrations and is characterized by a wide dynamic range, which allows accurate quantification that depends on the number of cycles. Previous studies reported that simple processes could be used to effectively purify and detect miRNAs in tissues8,9,10. The methods described in this protocol for cDNA synthesis (reverse transcription) and the detection of miRNA expression by qRT-PCR using an intercalating dye have been reported to show high accuracy and sensitivity10.

Additionally, this protocol is simple and achieves consistent results between laboratories. Therefore, this protocol is useful in studies that require highly accurate and sensitive miRNA detection in mouse AKI kidneys.

Access restricted. Please log in or start a trial to view this content.

Protocol

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

All animal experimental protocols were approved by the animal ethics committee of Jichi Medical University and performed in accordance with the Use and Care of Experimental Animals guidelines from the Jichi Medical University Guide for Laboratory Animals.

1. IRI model

NOTE: Carefully monitor for hypothermia, intestinal moisturization, and depth of anesthesia throughout the procedure.

  1. Prepare the following items: a 50 mL centrifuge tube containing cotton drenched in isoflurane, a heated surgical pad, a Petri dish with phosphate-buffered saline (PBS), sterile surgical blade, and sterile forceps. Maintain the PBS at 37 °C.
    NOTE: This IRI model was generated using male C57BL/6 mice (9 weeks; 20–25 g) housed in a room with controlled temperature, humidity, and a 12 h light-dark cycle.
  2. Anesthetize the animal using isoflurane: induction concentration 3%–5%, maintenance concentration 2%–3%, and concentration during clamping 1%–1.5%. To prevent ocular dryness during anesthesia, apply ophthalmic ointment to the eyes. Confirm the depth of anesthesia by the loss of reflexes. Inhalation anesthesia has the advantage that the time can be adjusted. The procedure might take a significant amount of time because of the exfoliation of the tissue surrounding the kidney. However, the disadvantage of inhalation anesthesia is that the body temperature tends to fall. Maintain anesthesia at a depth sufficient to prevent a response to toe pinch during clamping, while avoiding unnecessarily deep anesthesia.
  3. Mount the anesthetized mouse on a heated surgical pad on its back, remove the hair surrounding the incision area, and disinfect the abdominal skin of the mouse with chlorhexidine-based scrub and 70% ethanol. Administer buprenorphine subcutaneously at a dose of 0.1 mg/kg, 30 min prior to the surgery.
  4. Make a midline incision in the abdominal skin, muscle, and peritoneal membrane using a surgical blade and forceps.
  5. Using a cotton swab moistened with PBS, gently push the bowel toward the left side of the extra-abdominal cavity, exposing the right kidney and ureter. The long procedure time is likely to cause postoperative intestinal injury. Thus, it is better to operate without removing the intestines from the abdominal cavity when a visual field can be obtained. Avoid drying out the intestines. Dry swabs or gauze can cause intestinal damage.
  6. Lift the right ureter with angled forceps. Ligate the right ureter twice using 4/0 silk-braided sutures. Cut between the sutures, leaving the suture that is closer to the kidney longer.
  7. Carefully hold the remaining suture without pulling too much, and bluntly dissect the connective tissue and fat along the kidney. Exteriorizing the kidney and conducting the procedure extracorporeally reduces the risk of physical damage to the liver.
    1. Identify a blood vessel, other than the suprarenal artery and vein, that supplies blood to the right kidney, and then ligate or clip it. When the right kidney is sufficiently detached, ligate the right renal artery and vein using a 4/0 silk-braided suture. Instead of suturing, use a hemostatic clip.
    2. Using a cotton swab moistened with PBS, gently push the intestine towards the right side of the extra-abdominal cavity to expose the left kidney, and then cover the intestine with a moistened drape to prevent it from drying out. Dissect the connective tissue and fat around the left kidney.
  8. Identify a blood vessel, other than the suprarenal artery and vein, that supplies blood to the left kidney, and then ligate or clip it. Clamp the renal artery and renal vein to induce left kidney ischemia. Position the hemostatic clip approximately 1 cm from the kidney to avoid damage to the renal parenchyma. Successful ischemia can be visually confirmed by a gradual uniform darkening of the kidney.
  9. Return the intestines to the abdominal cavity, taking care to avoid intestinal twisting; temporarily close the abdominal skin and drape to maintain a moist environment. Maintain anesthesia at a depth sufficient to prevent a response to toe pinch during clamping, while avoiding unnecessarily deep anesthesia. The clamping time is 25–45 min. A longer clamping time induces more severe renal damage but also increases long-term mortality. Adjust by analyzing the pathology results.
  10. Remove the clamp after the period of ischemia has concluded. Ensure that blood flow reperfusion and kidney color improve. Confirm that the bowel is not twisted before closing the abdominal skin. Instill PBS intraperitoneally as a volume supplement before the abdomen is closed in two layers. Close the abdominal skin using 4-0 nylon sutures. For longer renal removal periods, the possibility of intestinal adhesions may be reduced by separately closing the abdominal wall and peritoneum.
  11. To minimize the risk of post-operative infection, apply an antiseptic (e.g., iodine/alcohol solution) to the surgical area. Administer buprenorphine subcutaneously at a dose of 0.1 mg/kg until needed.

2. Kidney sample collection

NOTE: This video has a 45 min clamping time, collecting the kidneys 24 h later.

  1. Anesthetize the animal with 5% isoflurane and confirm the depth of anesthesia by the loss of reflexes.
  2. Make a midline incision in the abdominal skin, muscle, and peritoneal membrane using scissors and forceps. Collect the blood from the inferior vena cava punctured by a 27 G needle.
  3. Make a midline incision in the chest wall and insert a 23 G needle into the left ventricle. Confirm backflow. Make an incision in the liver and inject 20 mL of PBS. As the blood drains, the liver changes color from red to pink, confirming that sufficient blood has been drained.
  4. Remove the left kidney using forceps and scissors and wash it with PBS in a Petri dish. Remove the renal fascia using forceps, being careful not to dry out the kidney.
  5. Cut the kidney in half and use one half for histopathology and the other half for the next step. Avoid the renal pelvis, and harvest 30 mg of the kidney. Store this at −80 °C before use.

3. Purifying miRNAs from kidney samples

NOTE: Here, kidney samples weighing 30 mg are homogenized using a glass homogenizer and a biopolymer-shredding system in a microcentrifuge spin column. Subsequently, miRNA from the kidney sample is isolated using a silica-membrane-based spin column.

  1. Prepare the following items: 1.5 or 2.0 mL microcentrifuge tubes, 100% ethanol, chloroform, a glass homogenizer, ice, a biopolymer-shredding system in a microcentrifuge spin column9, silica-membrane-based spin columns9, phenol/guanidine-based lysis reagent, wash buffer containing guanidine and ethanol (wash buffer 1), and wash buffer containing ethanol (wash buffer 2).
  2. Place a 30 mg kidney sample into a glass homogenizer and add 700 µL of phenol/guanidine-based lysis reagent. Perform this step on ice because the tissue is denatured by heat.
  3. Homogenize the kidney sample by slowly pressing the pestle onto the sample by twisting it. Repeat this process several dozen times on ice until the kidney sample has completely dissolved into the phenol/guanidine-based lysis reagent. When miRNA is not obtained in subsequent measurements, this is likely because of insufficient dissolving.
  4. For further homogenization, transfer the homogenized lysate to the biopolymer-shredding system in a microcentrifuge spin column placed in a 2.0 mL collection tube. Centrifuge this at 14,000 × g for 3 min at room temperature.
  5. Transfer the homogenized lysate to a new microcentrifuge tube.
  6. Add 140 µL of chloroform to the homogenized lysate and cap the tube securely. Mix the tube by inversion for 15 s.
  7. Incubate the samples for 2–3 min at room temperature. Then, centrifuge them at 12,000 × g for 15 min at 4 °C.
  8. Transfer the supernatant (normally 300 µL) to a new microcentrifuge tube without disturbing the precipitate and add 1.5 volumes (normally 450 µL) of 100% ethanol. Mix the sample by vortexing for 5 s.
  9. Pipette up to 700 µL of the sample into a silica-membrane-based spin column placed in a 2.0 mL collection tube. Close the column cap, and centrifuge at 15,000 × g for 15 s. Following centrifugation, discard the flow-through in the collection tube.
  10. Add 700 µL of wash buffer 1 to the silica-membrane-based spin column to thoroughly wash the sample. Close the cap of the column, and centrifuge it at 15,000 × g for 15 s. Following centrifugation, discard the flow-through in the collection tube.
  11. Add 500 µL of wash buffer 2 to the silica-membrane-based spin column to remove any traces of salt. Close the cap of the column, and centrifuge at 15,000 × g for 15 s. Following centrifugation, discard the flow-through in the collection tube.
    1. Repeat step 3.11.
  12. Centrifuge the silica-membrane-based spin column again at 15,000 × g for 1 min. Following centrifugation, discard the flow-through in the collection tube.
  13. Place the silica-membrane-based spin column in a new 1.5 mL collection tube. Transfer 25 µL of RNase-free water into the column, and close the column cap. Leave the sample at room temperature for 5 min, and then centrifuge it at 15,000 × g for 1 min.
  14. Transfer the 25 µL eluate containing miRNAs to a new microcentrifuge tube. Because miRNA is degraded by repeated dissolution, it is recommended to dispense the sample into 2 or 3 tubes. Store these at −80 °C before use.

4. Reverse transcription of miRNA

NOTE: Here, 1.0 µg of isolated RNA is reverse-transcribed using reverse transcriptase, poly(A) polymerase, and oligo-dT primers.

  1. Prepare the following items: 1.5 mL microcentrifuge tubes; 8-well strip tubes; RNase-free water; ice; a 10x Nucleic Acid Mix containing deoxynucleotides, ribonucleotide triphosphates, and oligo-dT primers; a poly(A) polymerase and reverse transcriptase mix; and activating buffer, including Mg2+, deoxyribonucleotides, oligo-dT primers, and random primers10.
  2. Prepare a master mix solution containing 2.0 µL of 10x Nucleic Acid Mix, 2.0 µL of poly(A) polymerase and reverse transcriptase mix, and 4.0 µL of 5x activating buffer, including Mg2+, deoxyribonucleotides, oligo-dT primers, and random primers, for a total of 8.0 µL per tube.
  3. Dispense 8.0 µL of the master mix solution into each tube.
  4. Add 1.0 µg of isolated miRNAs purified from the kidney sample to each tube.
  5. Add RNase-free water to each tube to a total of 20 µL. Mix thoroughly by pipetting, and centrifuge at 1,500 x g for 15 s.
  6. Incubate the samples for 60 min at 37 °C, followed immediately by incubation for 5 min at 95 °C. This step can be performed in a thermal cycler.
  7. Transfer the cDNA to a new microcentrifuge tube and dilute 10 times (1:10) with RNase-free water.
  8. Store the diluted cDNA short term on ice and long term at −80 °C before use.

5. qRT-PCR of miRNA

NOTE: qRT-PCR of miRNA is performed using an intercalating dye. Here, primers for U6 small nuclear 2 (RNA-2), miRNA-17-5p, miRNA-18a-5p, miRNA-21a-5p, miRNA-132-3p, miRNA-212-3p, miRNA-223-3p, and miRNA-574-5p were used.

  1. Prepare the following items: 1.5 mL microcentrifuge tubes, 96-well reaction plates for qRT-PCR, adhesive film for the 96-well reaction plate, miRNA-specific primers, PCR Master Mix comprising Taq DNA polymerase, PCR buffer, deoxynucleotides, and universal primers10, and a real-time PCR Instrument.
  2. Prepare a master mix containing 12.5 µL of 2x PCR Master Mix, 2.5 µL of each miRNA primer (5 µM) dissolved in nuclease-free water, and 1.25 µL of 10x universal primers for each well.
  3. Dispense 22.5 µL of the master mix into each well of the 96-well plate.
  4. Add 2.5 µL of template cDNA to each well.
  5. Seal the plate with the adhesive film for the 96-well reaction plate. Then, centrifuge the plate at 1,000 × g for 30 s.
  6. Using the real-time PCR instrument and software, run the PCR cycling program as follows.
    1. Place the plate in the real-time PCR instrument. Assign a name to the sample and target miRNA in each well using the Real-Time PCR software.
    2. Input the following PCR cycling conditions in the real-time PCR software according to the instructions: preincubation at 95 °C for 15 min, followed by 40 cycles of denaturation at 94 °C for 15 s, annealing at 55 °C for 30 s, and extension at 70 °C for 30 s.
  7. Analyze the qRT-PCR data using the software of the real-time PCR instrument. Check for non-specific reactions. Analyze the Dissociation curve or the Melt curve to confirm that amplification other than the intended one has not occurred.
    1. Normalize the expression level of target miRNAs to RNU-6 as an endogenous control. Calculate the relative expression level of target miRNAs using the 2−ΔΔCT method11.

Access restricted. Please log in or start a trial to view this content.

Results

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Here, the miRNA expression profile in AKI mice was investigated. The miRNA expression profile has been investigated in various organs and tissues in mice. MiRNAs are important post-transcriptional regulators and are now being extensively studied in the characterization of a variety of diseases, including AKI. MiRNAs have the potential to help elucidate pathological conditions and be applied to the treatment of AKI12. The major causes of AKI are IRI, nephrotoxic insult, and sepsis. IRI of the kidne...

Access restricted. Please log in or start a trial to view this content.

Discussion

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Using the protocol presented in this manuscript, miRNAs from the kidney of IRI mice were successfully purified and detected using qRT-PCR. Critical points of the IRI-inducing procedure in the protocol include careful monitoring of body temperature and anesthesia concentrations, which are known to affect AKI20. The strength of this protocol is that it allows visual confirmation of whether ischemia-reperfusion has been achieved. However, there are some limitations to this IRI model. Prolonging the c...

Access restricted. Please log in or start a trial to view this content.

Disclosures

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The authors declare that they have no conflicts of interest.

Acknowledgements

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

We thank Nam Nguyen, PhD for editing a draft of this manuscript.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
Bent Tip Tapered Tweezers without HookNatsume SeisakushoMA-47
Buffer RLTQiagen79216wash buffer 1
Buffer RWTQiagen1067933wash buffer 2
C57B6 miceSLCnot assign
forcep with TeethNatsume SeisakushoMA-49
forcep without TeethNatsume SeisakushoMA-48-1
Hemostatic clipsNatsume SeisakushoKN−353
MicroAmp Optical 96 well reaction plate for qRT-PCRThermo Fisher Scientific431681396-well reaction plate
MicroAmp Optical Adhesive FilmThermo Fisher Scientific4311971adhesive film for 96-well reaction plate
miRNA-132-3p primerQiagenMS000034585'UAACAGUCUACAGCCAUGGUCG
miRNA-17-5p primerQiagenMS000292745'CAAAGUGCUUACAGUGCAGGUAG
miRNA-18a-5p primerQiagenMS000315145'UAAGGUGCAUCUAGUGCAGAUAG
miRNA-212-3p primerQiagenMS000038155'UAACAGUCUCCAGUCACGGCC
miRNA-21a-5p primerQiagenMS000090795'UAGCUUAUCAGACUGAUGUUGA
miRNA-223-3p primerQiagenMS000038715'UGUCAGUUUGUCAAAUACCCCA
miRNA-574-5p primerQiagenMS000436175'UGAGUGUGUGUGUGUGAGUGUGU
miRNeasy Mini kitQiagen217004silica-membrane based spin column
miScript II RT kitQiagen218161
miScript SYBR Green PCR kitQiagen218073
QIA shredderQiagen79654biopolymer-shredding system in a micro centrifuge spin-column
QIAzol Lysis ReagentQiagen79306phenol/guanidine-based lysis reagent
QuantStudio 12K Flex Flex Real-Time PCR systemThermo Fisher Scientific4472380real-time PCR instrument
QuantStudio 12K Flex Software version 1.2.1.Thermo Fisher Scientific4472380real-time PCR instrument software
RNU6-2 primerQiagenMS00033740not disclosed
surgical scissorsNatsume SeisakushoB-2
Vascular clip applierVITALITEC1621420

References

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,
  1. Kelly, K. J. Acute renal failure: much more than a kidney disease. Seminas in Nephrology. 26 (2), 105-113 (2006).
  2. Saikumar, J., Ramachandran, K., Vaidya, V. S. Noninvasive micromarkers. Clinical Chemistry. 60 (9), 1158-1173 (2014).
  3. Beermann, J., Piccoli, M. T., Viereck, J., Thum, T. Non-coding RNAs in Development and Disease: Background, Mechanisms, and Therapeutic Approaches. Physiological Reviews. 96 (4), 1297-1325 (2016).
  4. Yang, G., et al. Discovery and validation of extracellular/circulating microRNAs during idiopathic pulmonary fibrosis disease progression. Gene. 562 (1), 138-144 (2015).
  5. Zhang, T., et al. Circulating miR-126 is a potential biomarker to predict the onset of type 2 diabetes mellitus in susceptible individuals. Biochemical and Biophysical Research Communications. 463 (1-2), 60-63 (2015).
  6. Zhong, X., et al. miR-21 is a key therapeutic target for renal injury in a mouse model of type 2 diabetes. Diabetologia. 56 (3), 663-674 (2013).
  7. Wang, J., et al. Downregulation of urinary cell-free microRNA-214 as a diagnostic and prognostic biomarker in bladder cancer. Journal of Surgical Oncology. 111 (8), 992-999 (2015).
  8. Morishita, Y., et al. MicroRNA expression profiling in peritoneal fibrosis. Translational Research: The Journal of Laboratory and Clinial Medicine. 169, 47-66 (2016).
  9. Morse, S. M., Shaw, G., Larner, S. F. Concurrent mRNA and protein extraction from the same experimental sample using a commercially available column-based RNA preparation kit. BioTechniques. 40 (1), 54-58 (2006).
  10. Mestdagh, P., et al. Evaluation of quantitative miRNA expression platforms in the microRNA quality control (miRQC) study. Nature Methods. 11 (8), 809-815 (2014).
  11. Bustin, S. A., et al. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clinical Chemistry. 55 (4), 611-622 (2009).
  12. Jonas, S., Izaurralde, E. Towards a molecular understanding of microRNA-mediated gene silencing. Nature Reviews. Genetics. 16 (7), 421-433 (2015).
  13. Ichii, O., Horino, T. MicroRNAs associated with the development of kidney diseases in humans and animals. Journal of Toxicologic Pathology. 31 (1), 23-34 (2018).
  14. Ma, L., et al. Changes of miRNA-17-5p, miRNA-21 and miRNA-106a level during rat kidney ischemia-reperfusion injury. Zhonghua Yi Xue Za Zhi. 95 (19), 1488-1492 (2015).
  15. Saikumar, J., et al. Expression, circulation, and excretion profile of microRNA-21, -155, and -18a following acute kidney injury. Toxicological Sciences: an Official Journal of the Society of Toxicology. 129 (2), 256-267 (2012).
  16. Li, Y. F., et al. MicroRNA-21 in the pathogenesis of acute kidney injury. Protein & Cell. 4 (11), 813-819 (2013).
  17. Zhou, J., Chen, H., Fan, Y. Systematic analysis of the expression profile of non-coding RNAs involved in ischemia/reperfusion-induced acute kidney injury in mice using RNA sequencing. Oncotarget. 8 (59), 100196-100215 (2017).
  18. Liu, Y., et al. MicroRNA expression profile by next-generation sequencing in a novel rat model of contrast-induced acute kidney injury. Annals of Translational Medicine. 7 (8), 178(2019).
  19. Colbert, J. F., et al. A model-specific role of microRNA-223 as a mediator of kidney injury during experimental sepsis. American Journal of Physiology. Renal Physiology. 313 (2), 553-559 (2017).
  20. Delbridge, M. S., Shrestha, B. M., Raftery, A. T., El Nahas, A. M., Haylor, J. L. The effect of body temperature in a rat model of renal ischemia-reperfusion injury. Transplantation Proceedings. 39 (10), 2983-2985 (2007).
  21. Dallas, P. B., et al. Gene expression levels assessed by oligonucleotide microarray analysis and quantitative real-time RT-PCR -- how well do they correlate. BMC Genomics. 6, 59(2005).
  22. Rockett, J. C., Hellmann, G. M. Confirming microarray data--is it really necessary. Genomics. 83 (4), 541-549 (2004).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Tags

MicroRNA PurificationqRT PCR DetectionAcute Kidney InjuryRNA IsolationcDNA SynthesisQuantitative PCRKidney Ischemia ModelBiomarker DetectionMicroRNA Quantification

Related Articles