We show the automation of human induced pluripotent stem cell (hiPSC) cultures and neuronal differentiations compatible with automated imaging and analysis.
Method Article
* These authors contributed equally
We show the automation of human induced pluripotent stem cell (hiPSC) cultures and neuronal differentiations compatible with automated imaging and analysis.
Manual culture and differentiation protocols for human induced pluripotent stem cells (hiPSC) are difficult to standardize, show high variability and are prone to spontaneous differentiation into unwanted cell types. The methods are labor-intensive and are not easily amenable to large-scale experiments. To overcome these limitations, we developed an automated cell culture system coupled to a high-throughput imaging system and implemented protocols for maintaining multiple hiPSC lines in parallel and neuronal differentiation. We describe the automation of a short-term differentiation protocol using Neurogenin-2 (NGN2) over-expression to produce hiPSC-derived cortical neurons within 6‒8 days, and the implementation of a long-term differentiation protocol to generate hiPSC-derived midbrain dopaminergic (mDA) neurons within 65 days. Also, we applied the NGN2 approach to a small molecule-derived neural precursor cells (smNPC) transduced with GFP lentivirus and established a live-cell automated neurite outgrowth assay. We present an automated system with protocols suitable for routine hiPSC culture and differentiation into cortical and dopaminergic neurons. Our platform is suitable for long term hands-free culture and high-content/high-throughput hiPSC-based compound, RNAi and CRISPR/Cas9 screenings to identify novel disease mechanisms and drug targets.
Human induced pluripotent stem cells (hiPSC) are self-renewing and can differentiate in almost any adult cell type. These characteristics make hiPSC a useful tool for disease modeling in basic research and drug discovery1. Human iPSC retains the donor genetic background which allows deriving disease-relevant cell types that are most affected/involved in the disease course, for example, different neuronal subtypes for neurodegenerative diseases2,3. Also, hiPSC overcomes some of the limitations of animal and cellular over-expression models by modeling diseases in a human context and physiological protein expression levels, and have proven to be a valuable asset in modeling diseases ranging from monogenic, complex and epigenetic disorders as well as late-onset diseases4.
Despite these benefits and opportunities, several limitations of hiPSC still need to be addressed. Current hiPSC culture and differentiation protocols are not cost-effective, difficult to standardize and are labor-intensive. Manual culture steps can result in high variability in the yields and phenotypes due to differences in growth and spontaneous differentiation of hiPSC. Therefore, experimenter-dependent variation needs to be reduced by implementing more standardized handling techniques and simplifying protocols which can be achieved using automation5. The establishment of automated hiPSC culture and differentiation protocols will set common standards for both academic and industrial research projects, and allow the generation of biologically relevant disease models and more reproducible results.
Previous work has attempted automation of hiPSC cultures6,7,8 but their protocols have been restricted to specific cell culture plate formats dependent on the system and lacking adaptability to different assay formats. Such systems are useful in the bulking of cells but may not be suitable for automated differentiation into desired cell types, disease phenotyping, and screening purposes. Additionally, a large-scale automated platform for fibroblast derivation, hiPSC generation and differentiation has been described9 but on a scale that can only be achieved by high-throughput laboratories dedicated to the production of lines which seems attractive but can be unaffordable for many academic laboratories.
We developed a fully automated cell culture system based on a liquid handling station in a High-Efficiency Particulate Air (HEPA)-filtered environment in conjunction with a large-capacity CO2 incubator, a brightfield imaging cytometer and a robotic arm for plate transport. These components provide the basis for stable and reproducible hiPSC culture and differentiation. We complemented the system with an automated -20 °C storage system for compound or virus storage and a high-speed spinning disk confocal live-cell imager. Custom-made protocols were generated allowing automated cell seeding, media changes, confluency checks, cell expansion and assay plate generation with sample treatment and plate imaging, making the system compatible with high-content/high-throughput screenings. The automated cell culture and imaging system are operated using the controlling software and the custom-made graphical user interface (GUI). The GUI allows users to import CSV files containing cell line-specific parameters needed for method execution. Additionally, the GUI enables to schedule numerous experiments in any sequence using the built-in calendar view thus allowing full control of the time when each method starts.
Our automated cell culture system uses standardized pipetting speeds, passaging times, confluency thresholds, seeding densities, and medium volumes with the flexibility to culture cells in a variety of plate formats (96-, 48-, 24-, 12-, 6- or 1-well plate format). We adapted a recently published short-term differentiation protocol for converting hiPSC into neurons that can yield TUBB3 positive neurons in 6 days10,11. We also established the automated differentiation and imaging of small molecule neural precursor cells (smNPC) into neurons constitutively expressing GFP under EF1a promoter12 and iPSC into midbrain dopaminergic (mDA) neurons, adapting a previously published dual-SMAD inhibition protocol13 that yields mDA neurons within 65 days.
1. Basic procedures for automating cell cultures and imaging
2. Automation protocols
3. Automated maintenance and expansion of hiPSC
4. Automated differentiation
5. Automated differentiation of hiPSC into midbrain dopaminergic (mDA) neurons
6. Immunostaining, automated high-throughput image acquisition and analysis
7. Quantitative real-time polymerase chain reaction (qRT-PCR)
Our automated cell culture and imaging system was designed to minimize human intervention allowing us to standardize the cultivation of hiPSC and differentiation into different cell types such as cortical or midbrain dopaminergic (mDA) neurons. A schematic overview of our automated cell culture system with integrated imaging devices is depicted in Figure 1. The initial introduction of cell cultures to this automated cell culture system can either be done by automatically seeding cells from a 50 mL tube or by using the “Loading Of Culture Plates” or “Loading Of Assay Plates” method for import of culture or assay plates. A central component of our system is the liquid handling station where all liquid transfer steps such as media changes or subcultivations are carried out. The custom-made deck layout of the liquid handler is represented in Figure 2. The liquid handling station is equipped with four positions. Up to four plates can be transferred from the incubator to the deck, allowing parallel media changes. Since in the subcultivation method, both the parent and daughter culture plates have to be accommodated on the deck, the maximum number of culture plates processed in parallel is limited to two. An important feature of the liquid handling station is the possibility to tilt the plates during media change for complete removal of cell culture supernatant. Also, the liquid handling station is equipped with shakers for favoring enzymatic dissociation of cells during the execution of the subcultivation protocol. Our automated culture system is also equipped with two imaging systems: a brightfield imaging cytometer for performing cell counting and confluency checks and, therefore, monitoring the cell growth over time, and a dual spinning disk confocal microscope for rapid, high content and high-resolution imaging of cells.
The hiPSC cultures are monitored daily for growth at the brightfield imaging cytometer and analyzed for percentage of confluency. The brightfield image in the left panel and in the right panel a green mask from the analysis of the brightfield image obtained with the cytometer (Figure 3A). A homogeneous hiPSC growth is observed over the time, as shown by the confluence percentages of two hiPSC lines (n = 4 plates) grown in parallel and subjected to confluency checks from day 1 to day 6 (Figure 3B). Upon reaching the set threshold, the hiPSC are passaged. The cell lines were cultured manually (m) or by the automation (a) system and observed for maintenance of typical stem cell morphology for at least two passages, representative brightfield images (Figure 4A). The hiPSC cultured manually (not shown) or in the automated system exhibited the typical stem cell marker OCT4 (red) and SSEA4 (green), as shown in the immunofluorescence assay (Figure 4B). The expression of the pluripotency markers OCT4, NANOG and REX1 were also assessed at mRNA level by qRT-PCR (Figure 4C). Relative quantifications were performed with samples collected from one cell line grown manually (m) and in the automated culture system (a) in duplicates (replicates 1 and 2). The expression levels of all three pluripotency markers in the replicates cultivated in the automated culture system are similar to marker expression after manual culture. On day 8 (D8), the expression of pluripotency markers was absent in cortical neurons differentiated (Diff) from hiPSC.
One important application of the automated culture system is the differentiation of hiPSC into different cell types including neurons. Here we show the differentiation of hiPSC into neurons using the NGN2 strategy, which produces a pure cortical neuron culture in a very short time (approximately 6 days). Neurons differentiated in the automated culture system (a) presented similar morphology and neuronal network organization as the neurons cultivated manually (m) (Figure 5A). Automated differentiated cortical neurons were positive for TUBB3 (neuron-specific Class III β-tubulin, red) and BRN2 (upper cortical layer marker, green) (Figure 5B), comparable to manually differentiated neurons (data not shown). The expression of neuronal markers including the microtubule-associated protein 2 (MAP2), the neural cell adhesion molecule (NCAM1) and Synapsin-1 (SYN1), as well as the cortical neuron markers BRN2 and CUX1 (upper cortical layer) were enriched in neurons at day 8 (D8) of differentiation (Figure 5C). Very low or no expression of these markers was observed in hiPSC. Relative quantifications were performed with samples collected from one cell line grown manually (m) and in the automated culture system (a) in duplicates (replicates 1 and 2). The expression levels in replicates show similar variations between manually and automated differentiations.
The integrated imaging capability of the automated culture system allows hands-free data collection for the health of cultures thus enabling long-term automated acquisition of phenotypic readouts. Using the NGN2 approach to a small molecule derived neural precursor (smNPC) line transduced with GFP lentivirus, we established a live-cell automated neurite outgrowth assay in which neurite length was measured over 11 days of differentiation without any manual intervention. The neurite complexity increased over time, as demonstrated by the area occupied with neurites on day 1, 3 and 11, GFP expression and masked images from analysis (Figure 6A, B). The increase in neurite length from day 1 to 11 of differentiation was quantified and showed a similar development across different wells. For the sake of simplicity, data from only 3 columns with 6 wells each from a 96-well plate is depicted in the representative graph although all inner 60 wells were analyzed (Figure 6C).
Another application of the automated culture system shown here is the differentiation of hiPSC into mDA neurons. The differentiation is based on media changes following a pre-established protocol and was performed on the automated culture system from days 0 to 65. Automated media changes did not cause cell detachment or any other visually detectable changes in the differentiation. At the end of the differentiation, on day 65, mDA neurons show cellular organization and morphology (spheric soma, long and spiny dendrites) comparable to manual differentiation (Figure 7A, B). At the mRNA level, mDA neurons differentiated in the automated culture system show the expression of neuronal and mDA markers, MAP2 and TH (tyrosine hydroxylase), respectively (Figure 7C). Both differentiations generated substantial amounts of TH and MAP2 positive neurons (Figure 7D).

Figure 1: Schematic overview of the automated cell culture and imaging platform.
The system was designed with a polycarbonate housing and two HEPA hoods (A and B) equipped with four UV lamps ensuring a sterile environment for cell culture applications. Cell culture plates are loaded on shelves in front of the robotic arm which can be accessed via the front door (C). The plates are loaded into the CO2 incubator (D) with a capacity of 456 plates. A brightfield cell cytometer (E) is used for confluency checks and cell counting during subcultivation routines. The liquid handling station is below one of the HEPA hoods (B). The deck layout of the liquid handler is described in Figure 2. The pipetting arm of the liquid handling station carries a 96 channel pipetting head, eight 1 mL pipetting channels and four 5 mL pipetting channels. In the case of the 1 mL pipetting channels, tips or needles can be used for liquid transfers. For screening purposes, cells seeded in assay plates can be treated with samples stored at -20 °C in the automated -20 °C storage system (F) after thawing these samples in a second incubator (G). High throughput imaging is performed in the automated confocal microscope (H) offering to acquire images in confocal mode using two spinning discs or in epifluorescence mode. A live-cell chamber integrated into the microscope allows performing long-term imaging of cultured cells. Please click here to view a larger version of this figure.

Figure 2: The deck layout of the liquid handling station.
Tip positions are indicated by “50 µL” for 50 µL tips, by “standard” for 300 µL tips, by “high” for 1 mL tips and by “5 mL” for 5 mL tips. Deck components: (A) Four heated shaker positions (max speed: 2500 rpm) which can be used for any culture plate or assay plate format. The shaker positions are equipped with clampable grippers which are also used for plate alignment following transports to the deck. Furthermore, the shaker positions function as a lid parking position for plates during liquid transfer steps. For representative purposes, all shaker positions are occupied by 96 well assay plates. (B) Four tilt modules for processing four plates of any format simultaneously are positioned on the top. The lowest position marks the waste collection chamber for culture and assay plates and the 96 channel pipetting head. For representative purposes, all tilt modules are occupied by 96-well assay plates. (C) On the top position, the 384-well plate for cell counting is located. Below are two positions for plates that are occupied by 96-well plates for representative purposes and a rack for four 50 mL and four 15 mL tubes. The lowest position is occupied by 5 mL tips. (D) Three media lines with positions for media reservoirs. The media lines possess liquid level sensors that allow to automatically fill the media reservoir with up to 250 mL of media. (E) Two liquid waste modules with active drain are based on the top, below a temperature-controlled module with a position for one container (white) and a 5 mL tip rack are located. (F) Five positions for 1 mL tips. (G) Two temperature-controlled modules are positioned at the bottom and a position for parking one of their lids on the top. (H) Positions for two 50 µL nested tip racks (NTR) in the top followed by two positions for single-channel and 96-channel pick up of 300 µL tips and a 5 mL tip rack at the bottom. (I) A stacker for 384-well counting plates at the top followed by three 300 µL NTR and a 5 mL tip rack at the bottom. (J) Storage and wash station for three sets of eight reusable metal 1 mL needles. (K) Waste position for 1 mL and 5 mL pipetting channels and empty NTR (grey) as well as a gripper block for 1 and 5 mL channels (white) used for on-deck transport steps. Please click here to view a larger version of this figure.

Figure 3: Automated confluency check of hiPSC.
(A) Representative brightfield (BF) images of hiPSC taken by the cell cytometer (left) and after automated confluency analysis (right) indicating the proportional area occupied by cells in green; (B) Confluency percentages recorded from two hiPSC lines (iPS #1 and #2) from day 1 to 6 of culture, n = 4 1-well plates per cell line. Please click here to view a larger version of this figure.

Figure 4: Passaging of hiPSC.
(A) BF image of one hiPSC line grown manually (left) and using the automated culture system (right). Images were taken 6 days after the second passaging; (B) Representative images of hiPSC stained for the pluripotency markers OCT4 and SSEA4, and counterstained with Hoechst 33342 (Nuclei); (C) Results of qRT-PCR for the pluripotency markers OCT4, NANOG and REX1 in one hiPSC line cultivated in duplicates (1 and 2) manually (m) and in the automated culture system (a), and the respective hiPSC-derived cortical neurons (Diff) at day 8 (D8) of differentiation. The data is represented as the relative quantity (RQ) using iPS_a_1 as the reference sample. Error bars represent standard deviation (SD) from 3 technical replicates of qRT-PCR reaction. GAPDH, RPL13A1 and RPLPO were used as housekeeping genes. Scale bar: 100 µm. Please click here to view a larger version of this figure.

Figure 5: Human iPSC-derived cortical neurons.
(A) Brightfield images of day 6, manually (m) and automated (a) differentiated cortical neurons showing similar neuronal networks; (B) Representative images of cells stained for TUBB3 (pan neuronal), BRN2 (cortical neurons) and Hoechst 33342 (nuclei) on day 8 of differentiation; (C) Results of qRT-PCR for marker genes of cortical neurons (MAP2, BRN2, CUX2, NCAM1 and SYN1) enriched in day 8 (D8) of differentiation. The data is represented as the relative quantity (RQ) using iPS_a_1 as the reference sample. Error bars represent the SD from 3 technical replicates of qRT-PCR reaction. GAPDH, RPL13A1 and RPLPO were used as housekeeping genes. Scale bar: 50 µm. Please click here to view a larger version of this figure.

Figure 6: A high-throughput assay for neurite outgrowth.
(A) Representative images of GFP expressing cells on days 1, 3 and 11 of differentiation; (B) Representative binary images of neurites on days 1, 3 and 11 of differentiation. The neurite outgrowth was quantified using the high content image analysis software 1 and is represented as neurite length; (B) The graphic displays the increase in neurite length in NPC-derived NGN2 neurons and formation of a dense network. Three 96-well plates with cells in the inner 60 wells are imaged. For simplicity, only three columns of wells per 96-well plate are shown as an example with n = 6 wells per column. An average of 1308 cells were analyzed per well. Error bars represent the standard error of the mean (S.E.M.). Scale bar = 50 µm. Please click here to view a larger version of this figure.

Figure 7: Human iPSC-derived mDA neurons.
Midbrain DA neurons differentiated manually (m) and in the automated (a) culture system. (A, B) Representative fluorescent images of mDA neurons stained for tyrosine hydroxylase (TH, mDA neuron marker; green), MAP2 (neuronal marker; red) and Hoechst 33342 (nuclei; blue); (C) Representative qRT-PCR results for marker genes of mDA neurons differentiated manually and in the automated culture system. TH and MAP2 expression levels are represented as relative quantity (RQ) normalized to housekeeping genes (OAZ1 and GAPDH); (D) Percentages of TH and MAP2 positive neurons generated by manual and automated differentiation. Error bars represent the SD of two independent differentiations performed with two distinct iPSC lines (#1 and #2). Scale bar = 50 µm. Please click here to view a larger version of this figure.
| Cell type | Purpose | Protocol step | Cell density | Plate format | Cell number/well |
| NGN2 differentiation | |||||
| iPSC | NGN2 stable line generation | S.2.3. | 30,000 cells/cm2 | 12-well | 1,17,000 |
| iPSC | NGN2 neuron differentiation | 3.1.3. | 30,000 cells/cm2 | 1-well | 25,20,000 |
| iPSC | NGN2 neuron differentiation | 3.1.3. | 30,000 cells/cm2 | 96-well | 9,600 |
| smNPC generation | |||||
| smNPC | Replating day 12 and 16 | S5.9. and S5.11. | 70,000 cells/cm2 | 6-well | 6,72,000 |
| smNPC | Replating from passage 5 | 5.11. | 50,000 cells/cm2 | 6-well | 4,80,000 |
| smNPC | smNPC to NGN2 neurons | 3.2.2 | 50,000 cells/cm2 | 96-well | 16,000 |
| mDA differentiation | |||||
| iPSC | mDA neuron differentiation | 4.1.2. | 200,000 cells/cm2 | 1-well | 1,68,00,000 |
| DA neurons | Day 25 replating | 4.3.2. | 400,000 cells/cm2 | 1-well | 3,36,00,000 |
| DA neurons | Day 25 replating | 4.5.2. | 100,000 cells/cm2 | 96-well | 32,000 |
| Coating | Purpose | Protocol step | Concentration/ Dilution | Plate format | Details of coating |
| iPS culture | |||||
| Extracellular matrix | iPSC, NGN2 line, mDA neurons | 1.5.7. and S2.3. | 1 aliquot*; 25 mL DMEM/F-12 | 1-/12-well | 8/0.5 mL/well; 1 h at RT |
| NGN2 differentiation | |||||
| Poly-L-Ornithine | NGN2 neuron differentiation | 3.1.3. and 3.2.2. | 0.1 mg/mL; PBS | 1-/96-well | 8/0.1 mL/well; 12 h at 37°C; 3x PBS wash |
| Laminin | NGN2 neuron differentiation | 3.1.3. and 3.2.2. | 5 μg/mL; PBS | 1-/96-well | 8/0.1 mL/well; 4 h at 37°C |
| smNPC generation | |||||
| Extracellular matrix | smNPC generation and culture | S5.6., S5.9., S5.11. | 1 aliquot*; 25 mL DMEM/F-12 | 6-well | 1 mL; 2 h at RT |
| mDA differentiation | |||||
| Extracellular matrix | mDA differentiation | 4.1.2. | 1 aliquot*; 25 mL DMEM/F-12 | 1-well | 12 mL; 12 h at 37°C |
| Poly-L-Ornithine | mDA differentiation | 4.3.2. and 4.5.2. | 0.1 mg/mL; PBS | 1-/96-well | 12/0.1 mL/well; 12 h at 37°C; 3x PBS wash |
| Laminin | mDA differentiation | 4.3.2. and 4.5.2. | 10 μg/mL; PBS | 1-/96-well | 12/0.1 mL/well; 12 h at 37°C |
| Fibronectin | mDA differentiation | 4.3.2. and 4.5.2. | 2 μg/mL; PBS | 1-/96-well | 12/0.1 mL/well; 12 h at 37°C |
| *A extracellular matrix aliquot is defined as the dilution factor (in µL) present in the Certificate of Analysis of this product. | |||||
Table 1: Seeding cell density and coating respective to the plate format.
| Day | Reagent | ||
| Day 0 - 1 | 100 nM LDN193189, 10 µM SB431542 | ||
| Day 1 - 3 | 100 nM LDN193189, 10 µM SB431542, 1 mM SHH, 2 mM Purmorphamine, 100ng/mL FGF-8b | ||
| Day 3 - 5 | 100 nM LDN193189, 10 µM SB431542, 1 mM SHH, 2 mM Purmorphamine, 100ng/mL FGF-8b, 3 µM CHIR99021 | ||
| Day 5 - 7 | 100 nM LDN193189, 1 mM SHH, 2 mM Purmorphamine, 100ng/mLFGF-8b, 3 µM CHIR99021 | ||
| Day 7 - 9 | 100 nM LDN193189, 1 mM SHH, 3 µM CHIR99021 | ||
| Day 9 - 11 | 100 nM LDN193189, 1 mM SHH, 3 µM CHIR99021 | ||
| Day 11 - 13 | 3 µM CHIR99021, 20 ng/mL BDNF, 0.2 mM L-ascorbic acid (AA1), 20 ng/mL GDNF, 1 mM db-cAMP, 1 ng/mL TGFß3, 10 µM DAPT | ||
| Day 13 - 65 | 20 ng/mL BDNF, 0.2 mM L-ascorbic acid (AA1), 20 ng/mL GDNF, 1 mM db-cAMP, 1 ng/mL TGFß3, 10 µM DAPT | ||
Table 2: Small molecule addition for dopaminergic neuron differentiation.
| Day | KSR medium | N2 medium | Differentiation medium |
| Day 0 - 1 | 100% | 0 | 0 |
| Day 1 - 3 | 100% | 0 | 0 |
| Day 3 - 5 | 100% | 0 | 0 |
| Day 5 - 7 | 75% | 25% | 0 |
| Day 7 - 9 | 50% | 50% | 0 |
| Day 9 - 11 | 25% | 75% | 0 |
| Day 11 - 13 | 0 | 0 | 100% |
| Day 13 - 65 | 0 | 0 | 100% |
Table 3: Media gradient for dopaminergic neuron differentiation.
Supplementary File 1. Please click here to download this file.
We introduce an automated cell culture system with integrated imaging capabilities for the standardization of hiPSC culture and neuronal differentiation. Due to minimal user intervention, experimental variation is low ensuring reproducibility of cellular phenotypes during differentiation. The calendar-based scheduler supports the organization and parallelization of experiments and allows a high degree of flexibility at which time the experiments are carried out. Existing methods can be easily adapted and the spectrum of available methods can be increased. Additionally, a large number of assay plate formats can be used adding to the flexibility of this system. The minimal system consisting of a CO2 incubator, a robotic arm, a brightfield cell cytometer, and a liquid handling station forms the basic unit needed for hiPSC culture and differentiation, with affordable costs to academic research laboratories. The combination of the automated cell culture system with an automated -20 °C storage system for storage of compounds, RNAi libraries or CRISPR/Cas9 libraries, and the integration of a high-content/high-throughput microscope enable the execution of phenotypic screenings.
In the current study, the automated cell culture system used disposable tips and the culture media was refilled manually into the reservoir, thus limiting the use of the liquid handling station for media changes and other culture processes especially overnight. To circumvent this limitation, the methods can be adjusted to needle usage instead of disposable tips and, after installing tube connections between media lines and media bags stored in a fridge, media reservoirs can be automatically refilled with fresh media pre-warmed by heater elements. This would reduce user interferences caused by manual refilling of tips, culture media and reservoir exchanges.
Our automated cell culture system offers several advantages. One is the barcode tracking system. The plates loaded in the system are identified by a unique barcode which is read and saved by the system allowing tracking of samples during and after method execution. Another advantage is the possibility to create user specific projects. Here, culture plates loaded in the system can be assigned to a specific project and grouped in batches. The structuring in batches simplifies the execution of the same procedure to all plates of a certain batch since no individual plates need to be selected. Additionally, a liquid class editor allows to adjust the pipetting speed and height as well as the aspiration and dispensing parameters for each liquid transfer step. Every process is documented in log files allowing to retrace which tasks have been performed for a given culture or assay plate.
Neurons and other cell types derived from human induced pluripotent stem cells (hiPSC) are useful in vitro tools for studying the mechanisms of neurodegenerative diseases in specific patient populations (e.g. dopaminergic neurons for Parkinson’s disease) offering the possibility for personalized drug screenings. Culturing hiPSC is very time intensive and demands trained people to execute complex differentiation protocols, usually limited to low scale production. We adapted the feeder-free culture of hiPSC to an automated culture and implemented two neuronal differentiation protocols, a rapid cortical neuron differentiation protocol based on NGN2 over-expression under a tet-on promoter10,11, and a long-term small molecule-based protocol for generation of midbrain dopaminergic (mDA) neurons13. The straightforward transfer and reproducibility of manual culture and differentiation protocols makes the automated culture system very useful. Human iPSC cultured in the automated cell culture system showed consistent stem cell morphology and expressed important pluripotency markers, reproducible between independent experiments. In addition, the automation of the hiPSC culture protocol favored the culture and expansion of a larger number of cell lines in parallel. Automated confluency checks scheduled to be performed overnight saved time leaving the system free during the day for downstream process steps carried out when the user was in the laboratory (e.g., harvesting of cells or manual replating for differentiations). On reaching the user-defined confluence threshold, cells are passaged and replated into extracellular matrix-coated plates available on the stacker of the automated cell culture system. Each passage round takes about 70 min and generates four 1-well plates from one parent plate, which translates to a capacity of 20 passages in a day.
The automation of the NGN2 differentiation protocol was done successfully and allowed the generation of a homogeneous population of neuronal cells across different passages and comparable to manual differentiations. Moreover, the experimental costs for large-scale screening studies involving multiple cell lines or screening experiments with thousands of test conditions/compounds would be reduced due to rapid differentiations. Cost-effective and high-throughput readouts including live-cell neurite outgrowth measurements can be easily developed, implemented and used as phenotypic readouts for disease modeling, as shown previously14,15,16. Thus, we further adapted the NGN2 protocol using small molecule derived neural precursor (smNPC) cells that constitutively over-express GFP. The smNPC cells offer further advantages including reduced costs with culture media (one third of the cost with iPSC culture) and time required to scale up experiments. The cell yields from smNPC are 7 to 10 times higher than that obtained with iPSC. The differentiating neurons were successfully monitored and imaged for several days using a fully automated imaging process without the need of manual antibody stainings or chemical labeling, saving costs and time required for manual procedures including the imaging by itself. The current imaging of inner 60 wells of a 96-well plate takes around 16 min per plate when 25 fields per well are imaged, which means that the data for an imaging-based screening for 1000 compounds, could be acquired and analyzed in a day. In the future, this readout could be used in compound screening studies for the rescue of neurite outgrowth defects.
Further, we also demonstrate the transfer of a manual differentiation protocol for generating midbrain dopaminergic (mDA) neurons from iPSC. This small molecule-based differentiation protocol takes 65 days and is labor intensive because of the multiple replating steps and frequent media changes, mostly every 2 days, which limits the production of mDA neurons to few iPSC lines at the same time. The automated mDA differentiation protocol has the great advantage of scaling up the differentiation to dozens of iPSC lines. Up to 30 cell lines could be differentiated in parallel. Since the differentiation is mostly based on media changes, almost the whole differentiation process can be conducted without human interference. Using the calendar-based scheduler of the automated system, we could plan the media changes according to the differentiation steps. One limitation of working with such a large number of cell lines and culture plates was the impossibility to perform overnight media changes. The main reason is the fact that our system is set up for using disposable tips and manual refilling of culture media requiring an user in the laboratory to execute this manual step. To facilitate the media change process, plates loaded in the system were assigned to a project and grouped in batches. The batch size was then adapted to the number of disposable tips and volume of culture media available. As discussed above, this limitation can be easily overcome by implementation of reusable/washable needles and automated refilling of media. Automated passaging/replating of cells, as shown for iPSC, is one of the conveniences offered by our automated cell culture system. We have tested the automated replating of mDA neurons on day 25 of differentiation. However, the dissociation of mDA neurons requires longer (40 min) incubation with the dissociation enzyme than iPSC (8 min) extending the automated replating process to more than 1 h per cell lines. As a consequence, the automated replating of 30 cell lines in the same day became impossible. Speeding up other steps during automated replating (transport of plates, pipetting) and adapting the system to the use of needles and media line that makes an overnight work possible would resolve this limitation. Despite the drawbacks, we could successfully transfer the manual protocol to an automated differentiation of mDA neurons producing cultures with substantial amounts of MAP2 (neuron) and TH (mDA neurons) positive cells.
Differentiating dozens of iPSC cell lines in parallel is of great interest in projects that investigate the molecular mechanisms of neurodegenerative diseases, including Parkinson’s disease. However, to complete tasks faster with fewer errors and at reduced costs is a big challenge. Due to the automation of the protocols presented here (iPSC, smNPC and mDA neuron), we could speed up, reduce the costs and increase reproducibility in our projects. The development of projects like FOUNDIN-PD (https://www.foundinpd.org/wp/) involving hundreds of patient cell lines shows need for automated culture and differentiation protocols. Our future perspectives include the transfer of manual 3 dimensional (3D) cell culture models to the automated system. Minor adaptations in the plate definition settings and the use of adaptors will allow the use of commercial or custom-made plates and microfluidic chambers required for the 3D cultures. Moreover, the implementation of an automated label-free imaging model will allow us to track the neuronal growth in real time and translate changes in neurite outgrowth, neuron organization and cell death into better understanding of the disease mechanisms.
We have nothing to disclose.
The authors gratefully acknowledge the patients and their families who contributed biomaterial for this study. Cells lines used in the study were from NINDS collection with Rutgers (ND41865 as iPS#1) and the lab of Dr. Tilo Kunath (iPS#2). This work is supported in part by the NOMIS Foundation (PH), RiMod-FTD, an EU Joint Programme - Neurodegenerative Disease Research (JPND) (PH); The DZNE I2A initiative (AD); PD-Strat, an ERA-Net ERACoSysMed funded project (PH) and the Foundational Data Initiative for Parkinson's Disease (FOUNDIN-PD) (PH, EB). FOUNDIN-PD is part of The Michael J. Fox Foundation’s PATH to PD program. The authors thank Steven Finkbeiner and Melanie Cobb (Gladstone Institutes) for contributing to the establishment of the manual mDA neuron differentiation protocol and Mahomi Suzuki (Yokogawa Electric Corporation) for assistance in neurite outgrowth analysis setup.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| Antibodies | Distributor | Catalog Number | Dilution |
| iPSC pluripotency marker | |||
| Mouse anti-SSEA4 | Abcam | ab16287 | 1 to 33 |
| Rabbit anti-Oct3/4 | Abcam | ab19857 | 1 to 200 |
| NGN2 neuron markers | |||
| Mouse anti- TUBB3 | R & D | MAB1195 | 1 to 500 |
| Rabbit anti-BRN2 | NEB | 12137 | 1 to 1,000 |
| mDA neuron markers | |||
| Chicken anti-TH | Pel-Freez Biologicals | 12137 | 1 to 750 |
| Mouse anti-MAP2 | Santa Cruz | sc-74421 | 1 to 750 |
| Secondary antibodies | |||
| Goat anti-chicken IgY, Alexa Fluor 488 | Invitrogen | A11039 | 1 to 2,000 |
| Goat anti-mouse IgG, Alexa Fluor 488 | Invitrogen | A11029 | 1 to 2,000 |
| Goat anti-mouse IgG, Alexa Fluor 594 | Invitrogen | A11032 | 1 to 2,000 |
| Goat anti-rabbit IgG, Alexa Fluor 488 | Invitrogen | A11008 | 1 to 2,000 |
| Goat anti-rabbit IgG, Alexa Fluor 488 | Invitrogen | A11008 | 1 to 2,000 |
| Goat anti-rabbit IgG, Alexa Fluor 594 | Invitrogen | A11012 | 1 to 2,000 |
| Nuclei counterstaining | |||
| Hoechest 33342 | Invitrogen | H3570 | 1 to 8,000 |
| Instruments | Distributor | Catalog Number | Description/Application |
| Agilent TapeStation system | Agilent technologies | 4200 | Automated electrophoresis for DNA and RNA samples |
| Automated -20 °C storage system | Hamilton Storage Technologies | Sample Access Manager (SAM -20C, 3200 series) | Storage of reagents |
| Barcode reader | Honeywell | Barcode Reader Orbit | Barcode scanner |
| Brightfield cell cytomat | Nexcelom | Celigo | Confluence check and cell counting |
| CellVoyager 7000 | Yokogawa | CellVoyager 7000 | Automated confocal microscope |
| Cytomat for cell cultures | Thermo Fisher Scientific | Cytomat 24 C, CU | 12 stackers pitch 28 mm, 12 stackers pitch 23 mm (total of 456 plates) |
| Cytomat for thawing samples | Thermo Fisher Scientific | Cytomat 2-LIN, 60 DU (Drying Unit) | 2 stackers pitch 28 mm (total of 42 plates) |
| HEPA filters | Hamilton Robotics | Hood Flow Star UV | Modified by Hamilton Robotics |
| Liquid handling station | Hamilton Robotics | Microlab Star | Channels: 8x 1-ml, 4x 5 ml and 96 Channel MPH |
| Media reservoir | Hamilton Robotics | 188211APE | Media/reagents reservoir |
| Pure water system | Veolia Water | ELGA PURELAB Classic | Provides pure water for needle wash station |
| QuantStudio 12K Flex Real-Time PCR System | Thermo Fisher Scientific | QSTUDIO12KOA | Real-time PCR machine |
| Robotic arm | Hamilton Robotics | Rackrunner | Transport of plates |
| Turn table | Hamilton Robotics | Turn Table | Adjust plate orientiation |
| Uninterruptible power supply | APC | Smart UPS RT Unit, 10000 VA Power supply | Backup power supply |
| VIAFLO-pipettes | Integra | 4500 | Electronic pipette |
| ViiA 7 Real-Time PCR System | Applied Biosystems | 4453545 | Real-time PCR machine |
| Materials | Distributor | Catalog Number | Notes |
| 1-well culture plate (84 cm2) | Thermo Fischer Scientific | 165218 | Nunc OmniTray |
| 6-well culture plates (9.6 cm2) | Greiner Bio-One | 657160 | TC treated with lid |
| 12-well culture plate (3.9 cm2) | Greiner Bio-One | 665180 | TC treated with lid |
| 96-well culture plate (0.32 cm2) | Perkin Elmer | 6005558 | CellCarrier-96 Black plate |
| Tips, 50-µL | Hamilton Robotics | 235987 | 50-uL tips |
| Tips, 300-µL | Hamilton Robotics | 235985 | 300-µL tips |
| Tips, 1000-µL | Hamilton Robotics | 235939 | 1000-µL tips |
| Tips, 5-mL | Hamilton Robotics | 184022 | 5-mL tips |
| Tubes, 15-mL | Greiner Bio-One | 188271 | 15-mL tubes |
| Tubes, 50-mL | Greiner Bio-One | 227261 | 50-mL tubes |
| Nalgene cryogenic 2.0 mL vials | Sigma Aldrich | V5007 | Cryovials |
| Plasmids | Distributor | Catalog Number | Notes |
| pLV_hEF1a_rtTA3 | Addgene | 61472 | Kind gift from Ron Weiss |
| pLV_TRET_hNgn2_UBC_Puro | Addgene | 61474 | Kind gift from Ron Weiss |
| pLVX-EF1a-AcGFP1-N1 lentivirus | Takara Bio | 631983 | |
| Primers | Sequence (forward) | Sequence (reverse) | Source |
| iPSC pluripotency | |||
| OCT4 (ID 4505967a1) | CTTGAATCCCGAATGGAAAGGG | GTGTATATCCCAGGGTGATCCTC | PrimerBank |
| NANOG (ID 153945815c3) | CCCCAGCCTTTACTCTTCCTA | CCAGGTTGAATTGTTCCAGGTC | PrimerBank |
| REX1 (ID 89179322c1) | AGAAACGGGCAAAGACAAGAC | GCTGACAGGTTCTATTTCCGC | PrimerBank |
| NGN2 neurons | |||
| MAP2 (ID 87578393c1) | CTCAGCACCGCTAACAGAGG | CATTGGCGCTTCGGACAAG | PrimerBank |
| BRN2 (ID 380254475c1) | CGGCGGATCAAACTGGGATTT | TTGCGCTGCGATCTTGTCTAT | PrimerBank |
| CUX2 (ID 291045458c2) | CGAGACCTCCACACTTCGTG | TGTTTTTCCGCCTCATTTCTCTG | PrimerBank |
| NCAM1 (ID 336285437c3) | TGTCCGATTCATAGTCCTGTCC | CTCACAGCGATAAGTGCCCTC | PrimerBank |
| SYNAPSIN1 (ID 91984783c3) | TGCTCAGCAGTACAACGTACC | GACACTTGCGATGTCCTGGAA | PrimerBank |
| mDA neurons | |||
| TH | CGGGCTTCTCGGACCAGGTGTA | CTCCTCGGCGGTGTACTCCACA | NCBI primer-BLAST |
| MAP2 | GGATCAACGGAGAGCTGAC | TCAGGACTGCTACAGCCTCA | NCBI primer-BLAST |
| Housekeeping genes | |||
| GAPDH | GAAATCCCATCACCATCTTCCAGG | GAGCCCCAGCCTTCTCCATG | NCBI primer-BLAST |
| OAZ1 | AGCAAGGACAGCTTTGCAGTT | ATGAAGACATGGTCGGCTCG | NCBI primer-BLAST |
| RPLPO | CCTCATATCCGGGGGAATGTG | GCAGCAGCTGGCACCTTATTG | NCBI primer-BLAST |
| RPL13A | GCCTACAAGAAAGTTTGCCTATC | TGGCTTTCTCTTTCCTCTTCTC | NCBI primer-BLAST |
| Media and Reagents | Distributor | Catalog Number | Use concentration |
| Coating matrix | |||
| Extracellular matrix (Matrigel) | Corning | 354277 | 10 μg/mL |
| Fibronectin | Corning | 356008 | 2 μg/mL |
| Laminin | Sigma | L2020 | 5 - 10 μg/mL |
| Poly-L-Ornithine (PLO) | Sigma | P3655 | 0.1 mg/mL |
| Culture media | |||
| iPSC culture medium (Essential 8 Flex medium) | Gibco | A2858501 | |
| NGN2 neurons - NGN2 medium | |||
| 2-mercaptoethanol | Gibco | 21985023 | 0.909 mL (50 µM) |
| B27 supplement | Gibco | 12587010 | 10 mL (1%) |
| DMEM/F-12, GlutaMAX | Gibco | 31331093 | 484.75 mL |
| GlutaMAX | Gibco | 35050038 | 5 mL ( 2 mM) |
| Insulin | Sigma | I9278 | 0.25 mL (2.5 µg/mL) |
| MEM Non-Essential Amino Acids | Gibco | 11140050 | 5 mL (0.5%) |
| N2 supplement | Gibco | 17502048 | 5 mL (0.5%) |
| Neurobasal medium | Gibco | 21103049 | 485 mL |
| mDA neurons - SRM medium | |||
| 2-mercaptoethanol | Gibco | 21985023 | 0.5 mL (55 µM) |
| GlutaMAX | Gibco | 35050038 | 5 mL (2 mM) |
| Knockout DMEM/F-12 | Gibco | 12660012 | 409.5 mL |
| Knockout serum replacement (serum replacement) | Gibco | 10828028 | 75 mL (15%) |
| MEM Non-Essential Amino Acids | Gibco | 11140050 | 5 mL (1%) |
| Penicillin-Streptomycin | Gibco | 15140122 | 5 mL (1%) |
| mDA neurons - N2 medium | |||
| B27 supplement | Gibco | 12587010 | 10 mL (2%) |
| GlutaMAX | Gibco | 35050038 | 5 mL (2 mM) |
| N2 supplement | Gibco | 17502048 | 5 mL (1%) |
| Neurobasal medium | Gibco | 21103049 | 475 mL |
| Penicillin-Streptomycin | Gibco | 15140122 | 5 mL(1%) |
| mDA neurons - Differentiation medium | |||
| B27 supplement | Gibco | 12587010 | 10 mL (2%) |
| Neurobasal medium | Gibco | 21103049 | 485 mL |
| Penicillin-Streptomycin | Gibco | 15140122 | 5 mL (1%) |
| NGN2 neurons - Supplements | |||
| Brain-Derived Neurotrophic Factor (BDNF) | Peprotech | 450-02 | 10 ng/mL |
| CHIR99021 (CHIR) | R&D | 4423/10 | 2 μM |
| Doxycyline (dox) | Sigma | D9891 | 2.5 μg/mL |
| Glial-Derived Neurotrophic Factor (GDNF) | Peprotech | 450-10 | 10 ng/mL |
| L-ascorbic acid 2-phosphate magnesium (AA2) | Sigma | A8960 | 64 mg/L |
| Neurotrophic factor-3 (NT-3) | Peprotech | 450-10 | 10 ng/mL |
| Purmorphamine (PMA) | Cayman | 10009634 | 0.5 μM |
| Puromycin | Sigma | P8833-10MG | 0.5 μg/mL |
| Thiazovivin | Merk Millipore | 420220-10MG | 2 μM |
| mDA neurons - Supplements | |||
| Brain-Derived Neurotrophic Factor (BDNF) | Peprotech | 450-02 | 20 ng/mL |
| CHIR99021 (CHIR) | R&D | 4423/10 | 3 μM |
| DAPT | Cayman | 13197 | 10 µM |
| Dibutyryl-cAMP (db-cAMP) | Sigma | D0627 | 1 mM |
| Fibroblast Growth Factor 8B (FGF-8b) | Peprotech | 100-25 | 100 ng/mL |
| Glial-Derived Neurotrophic Factor (GDNF) | Peprotech | 450-10 | 20 ng/mL |
| L-ascorbic acid (AA1) | Sigma | A4403 | 0.2 mM |
| LDN193189 (LDN) | Cayman | 11802 | 100 nM |
| Purmorphamine (Purm) | Cayman | 10009634 | 2 μM |
| Sonic Hedgehog/Shh (C24II) N-Terminus (SHH) | R&D | 1845-SH | 100 ng/mL |
| SB431542 (SB) | Cayman | 13031 | 10 μM |
| Transforming Growth Factor type ß3 (TGFß3) | R&D | 243-B3 | 1 ng/mL |
| Y-27632 | Cayman | 10005583 | 10 µM |
| Dissociation reagents | |||
| Single cell dissociation reagent (StemPro Accutase) | Gibco | A1110501 | 1x |
| UltraPure 0.5M EDTA, pH 8.0 | Gibco | 11575020 | 0.5 mM |
| RNA isolation and cDNA kit | |||
| RNA isolation kit | Qiagen | 74106 | Rneasy MiniKit |
| RNA lysis buffer | Thermo Fisher Scientific | 15596018 | Trizol lysis buffer (RNA lysis buffer) |
| Reverse transcriptase (kit) | Thermo Fisher Scientific | 18080-085 | SuperScript III Reverse Transcriptase |
| Software | Company | Catalog Number | Description/Application |
| Cell Culture Framework (CCF) (Graphical user interface, GUI) | Hamilton Robotics | Custom-made | User interface for the automated system |
| CellPathFinder software (image analysis software 1) | Yokogawa | CellPathfinder HCS Software | Image analysis tool |
| CellVoyager Measurement System | Yokogawa | Included with CellVoyager 7000 | Microscope controlling software |
| Columbus software (image analysis software 2) | Perkin Elmer | Columbus | Image analysis tool |
| Cloud based qPCR app | Thermo Fisher Scientific | Themo Fisher cloud | Analysis software for qRT-PCR data |
| Venus software | Hamilton Robotics | VENUS Two Dynamic Schedular 5.1 Software | Controlling software for the automated system |
Request permission to reuse the text or figures of this JoVE article
Request Permission