Method Article

Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43

DOI:

10.3791/61594

September 11th, 2020

In This Article

Summary

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Here, we describe a S. pneumoniae serotype 1 strain 519/43 that can be genetically modified by using its ability to naturally acquire DNA and a suicide-plasmid. As proof of principle, an isogenic mutant in the pneumolysin (ply) gene was made.

Abstract

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Streptococcus pneumoniae serotype 1 remains a huge problem in low-and-middle income countries, particularly in sub-Saharan Africa. Despite its importance, studies in this serotype have been hindered by the lack of genetic tools to modify it. In this study, we describe a method to genetically modify a serotype 1 clinical isolate (strain 519/43). Interestingly, this was achieved by exploiting the Pneumococcus’ ability to naturally acquire DNA. However, unlike most pneumococci, the use of linear DNA was not successful; to mutate this important strain, a suicide plasmid had to be used. This methodology has provided the means for a deeper understanding of this elusive serotype, both in terms of its biology and pathogenicity. To validate the method, the major known pneumococcal toxin, pneumolysin, was mutated because it has a well-known and easy to follow phenotype. We showed that the mutant, as expected, lost its ability to lyse red blood cells. By being able to mutate an important gene in the serotype of interest, we were able to observe different phenotypes for loss of function mutants upon intraperitoneal and intranasal infections from the ones observed for other serotypes. In summary, this study proves that strain 519/43 (serotype 1) can be genetically modified.

Introduction

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Streptococcus pneumoniae (S. pneumoniae, the pneumococcus) is one of the principal causes of morbidity and mortality globally. Up until recently, close to 100 serotypes of S. pneumoniae have been discovered1,2,3,4,5,6,7. Yearly, invasive pneumococcal disease (IPD) claims around 700,000 deaths, of children younger than 5 years old8. S. pneumoniae is the major cause of bacterial pneumonia, otitis media, meningitis and septicaemia worldwide9.

In the African meningitis belt, serotype 1 is responsible for meningitis outbreaks, where sequence type (ST) ST217, an extremely virulent sequence type, is dominant10,11,12,13,14,15. Its importance in meningitis pathology has been likened to that of Neisseria meningitidis in the African meningitis belt16. Serotype 1 is often the main cause of IPD; however, it is very rarely found in carriage. In fact, in the Gambia, this serotype is accountable for 20% of all invasive disease, but it was only found in 0.5% of healthy carriers14,17,18,19. Genetic exchange and recombination in competent pneumococci occurs generally in carriage rather than in invasive disease20. Furthermore, serotype 1 has been shown to have one of the shortest carriage rates described amongst pneumococci (only 9 days). Therefore, it has been proposed that this serotype might have a much lower recombination rate than others21.

In depth studies are necessary to understand the reason behind serotype 1 strains’ low rate of carriage and its importance in invasive disease in sub-Saharan Africa.

Here we report a protocol that allows genome-wide mutagenesis of a particular serotype 1 strain, 519/43. This strain can easily acquire and recombine new DNA into its genome. This method is not yet inter-strain, but it is very efficient when done in 519/43 background (other targets have been mutated, manuscripts in preparation). By simply using 519/43 strain, and exploit its natural competence, as well as substituting the way that the exogenous DNA is provided, we were able to mutate the pneumolysin gene (ply) in this serotype 1 strain. This method represents an improvement on the one presented by Harvey et al.22 as it is done in one-step without the need to passage the DNA through a different serotype. Nevertheless, and due to inter-strain variability, no method has been standardized to all strains. The ability to mutate specific genes and observe its effects will allow a profound understanding of serotype 1 S. pneumoniae strains and it will provide answers for the role of these strains in meningitis in sub-Saharan Africa.

Access restricted. Please log in or start a trial to view this content.

Protocol

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

1. Generation of the mutating amplicon by SOE-PCR23 and amplification of the spectinomycin cassette

  1. Start by performing PCR for the amplification of the homology arms (ply 5’ (488 bp) and ply3’ (715 bp) respectively) of the flanking regions of the ply gene from strain 519/43. Use primers plyFw1_NOTI (TTT GCGGCCGCCAGTAAATGACTTTATACTAGCTATG), ply5’R1_BamHI (CGAAATATAGACCAAAGGACGCGGATCC AGAACCAAACTTGACCTTGA), ply3’F1_BamHI (TCAAGGTCAAGTTTGGTTCTGGATCC GCGTCCTTTGGTCTATATTTCG) and plyRv2_NotI (TTTGCGGCCGCCATTTTCTACCTTATCCTCTACC).
  2. Use the following PCR conditions for ply5’: denaturing at 94 °C for 60 s, step 2: denaturing at 94 °C for 30 s, step 3: annealing at 58 °C for 30 s, step 4: extension at 72 °C for 30 s, step 5: go back to step 2 and repeat for 35 cycles, step 6: final extension at 72°C for 30 s.
    1. Use the same PCR conditions for ply3’ with the exception of the extension time on step 4 and step 6 where it should be 60 s.
  3. Analyze the PCR products by gel electrophoresis and excise the amplicon from the gel.
  4. Purify the PCR amplicons following the protocol described in the manufacturer’s instructions (Table of Materials).
  5. Use equimolar amounts of both homology arms as templates in the SOE-PCR. Fuse the two amplicons using primers plyFw1_ NOTI (TTT GCGGCCGCCAGTAAATGACTTTATACTAGCTATG), and plyRv2_NotI (TTTGCGGCCGCCATTTTCTACCTTATCCTCTACC).
  6. Use the following SOE-PCR conditions (step1: denaturing at 94 °C for 2 min, step 2: denaturing at 94 °C for 30 s, step 3: annealing 58 °C for 30 s, Step 4: extension at 68 °C for 60 s, step 5: go back to step 2 and repeat for 25 cycles, step 6: final extension at 68 °C for 90 s).
  7. Analyze the SOE-PCR product by gel electrophoresis. Excise it from the gel using a gel extraction kit and follow the instructions provided.
  8. Amplify the spectinomycin cassette from plasmid pR412 using the following PCR conditions: step 1: denaturing at 94 °C for 60 s, step 2: denaturing at 94 °C for 30 s, step 3: annealing at 55 °C for 30 s, step 4: extension at 68 °C for 60 s, step 5: go back to step 2 and repeat for 25 cycles, step 6: final extension at 68 °C for 60 s.
    1. Use primers BamHI_SP2F2 (GGATCC CTA GAA CTA GTG GAT CCC CC) and BamHI_SP2R2 (GGATCC AAT TCT GCA GAT TTT AC ATG ATC). Plasmid pR412 was acquired from Dr Marc PrudHomme (CNRS-Universite Paul Sabatier Toulouse France).
  9. Analyze the PCR amplicons by gel electrophoresis. Excise and purify the resulting PCR amplicon as described above.

2. Generation of plasmid pSD1 and Chemical transformation of E. coli Dh5α

  1. Perform a ligation following the pGEMT-easy system I manufacturer instructions (Table of Materials). In a microcentrifuge tube, add 5 µL of 2x ligation buffer, 1 µL of pGEMTeasy, 2 µL of the ply_SOE product, 1 µL of T4 DNA ligase and water to a 20 µL total volume. Incubate overnight at 4 °C. This generates plasmid pSD1.
  2. Transform chemically competent E. coli Dh5α with pSD1. Start by incubating 50 µL of chemically competent E. coli Dh5α with 3 µL of pSD1 ligation reaction for 15 min on ice. Then continue by exposing the cells to thermic shock (42 °C, 30 s). Place the cells on ice for 2 min.
  3. Remove the cells from ice and add 350 µL of S.O.C media. Incubate the culture for 2 h at 37 °C, 120 rpm.
  4. Plate the transformation on Luria Bertani Agar (LBA) supplemented with 0.4 mM IPTG, 0.24 mg/mL X-Gal for blue/white selection and 100 µg/mL ampicillin to ensure all colonies growing in the plate have the plasmid backbone. White colonies contain pSD1.
  5. Pick three white colonies and set up overnight growths in 10 mL of LB, supplemented with 100 µg/mL ampicillin. Incubate the cultures overnight at 37 °C with shaking.
  6. The next day centrifuge the cultures at 3,082 x g and use the pellet for plasmid extraction.

3. Plasmid DNA extraction, restriction digestion of pSD1 and spectinomycin gene and assembly of pSD2

  1. Extract the plasmid DNA following the instructions provided with the commercial kit (Table of Materials).
  2. Set up a BamHI-restriction digestion for both pSD1 plasmid and the spectinomycin cassette previously amplified and purified. Use the following conditions and quantities described in Table 1.
  3. Incubate the restriction digestion reactions and controls at 37 °C for 3 h.
  4. Analyze the restriction digest by electrophoresis, excise the band and purify following the instructions provided with the commercial kit (Table of Materials).
  5. Next, prepare a ligation reaction following the manufacturer instructions (Table of Materials) using the BamHI- digested pSD1 and spectinomycin (from step 3.2). In a microcentrifuge tube, add the following reaction components: 5 µL of 2x ligation buffer, 2 µL pSD1, 2 µL of spectinomycin cassette, 1 µL of T4 DNA ligase and incubate overnight at 4 °C. This generates plasmid pSD2.
  6. Transform plasmid pSD2 into chemically competent E. coli Dh5α as described in step 2.2.
  7. Select the transformants carrying plasmid pSD2 based on their ability to grow in LBA supplemented with 100 µg/mL of spectinomycin and ampicillin.
  8. Perform a plasmid DNA extraction (pSD2) as described above and following the manufacturer’s instructions (µL).

4. Transformation of S. pneumoniae strain 519/43

  1. Prepare an overnight culture of S. pneumoniae 519/43 in BHI and allow it to grow statically at 37 °C, 5% CO2.
  2. The following day dilute the cultures 1:50 and 1:100 in 10 mL of fresh BHI broth. Incubate the cultures statically at 37 °C until the OD595nm is between 0.05 and 0.1 (optimal acquisition of DNA closer to 0.1 OD).
  3. Once an OD of 0.1 is reached, take 860 µL and transfer into a microcentrifuge tube. In this same microcentrifuge tube add: 100 µL of 100 mM NaOH, 10 µL of 20% (w/v) BSA, 10 µL of 100 mM CaCl2, 2 µL of 50 ng/mL CSP124 and 500 ng of pSD2.
  4. Incubate the reaction statically at 37 °C for 3 h.
  5. Plate 330 µL onto 5% blood agar plates (BA) supplemented with 100 μg/mL spectinomycin, every hour over the 3 incubation hours.
  6. Incubate plates overnight at 37 °C, 5% CO2. Patch spectinomycin resistant colonies onto another BA plate supplemented with 100 μg/mL spectinomycin as well as onto BA plates supplemented with 100 μg/mL of ampicillin. Incubate both sets of plates overnight under the conditions stated above. The ampicillin plates are to test for the presence of the plasmid backbone.
  7. Confirm the presence of the spectinomycin cassette by PCR using primers plyFw1_ NOTI (TTT GCGGCCGCCAGTAAATGACTTTATACTAGCTATG) and SPEC_REV (TAATTCCTCTAAGTCATAATTTCCG). Confirm the mutation by PCR using primers plySCN1 (CCAATGGAAATCGCTAGGCAAGAGATAA) and plySCN2 (ATTACTTAGTCCAACCACGGCTGAT) which attach outside of the mutated region.
  8. Confirm the integration in the correct location of the genome by sequencing using primers plySCN1 (CCAATGGAAATCGCTAGGCAAGAGATAA), plySCN2 (ATTACTTAGTCCAACCACGGCTGAT), as well as primers with their binding site in the spectinomycin cassette sqr1 (CCTGATCCAAACATGTAAGTACC) sqf2 (CGTAGTTATCTTGGAGAGAATA) spec_sqf1 (GGTACTTACATGTTTGGATCAGG ) and spec_sqr2 TATTCTCTCCAAGATAACTACG.

Access restricted. Please log in or start a trial to view this content.

Results

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The protocol described here starts by using PCR to amplify the left and right homology arms, whilst simultaneously deleting 191 bp from the middle region of the ply gene. While performing the PCR a BamHI site is introduced at the 3’ of the left homology arm and at the 5’ end of the right homology arm (Figure 1A). This is followed by PCR-SOE where left and right homology arms are fused into one amplicon (Figure 1B). This SOE-PCR amplicon is then cloned i...

Access restricted. Please log in or start a trial to view this content.

Discussion

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Streptococcus pneumoniae, in particular serotype 1, continues to be a global threat causing invasive pneumococcal disease and meningitis. Despite the introduction of various vaccines that should be protective against serotype 1, in Africa, this serotype is still capable of causing outbreaks that lead to high morbidity and mortality13. The ability to genetically manipulate this serotype is of critical importance because of its clinical relevance. The method described in this study allows t...

Access restricted. Please log in or start a trial to view this content.

Disclosures

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The authors have nothing to disclose.

Acknowledgements

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

We would like to thank the Meningitis Trust and the MRC for providing funding for this work.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
AccuPrime Pfx DNA polymeraseInvitrogen12344024Used for amplification of the fragments
Ampicillin sodium saltSigma AldrichA9518Used for bacterial selection on stage 1(pSD1)
Blood Agar BaseOxoidCM0055Used to plate S. pneumoniae transformants
Bovine Serum Albuminesigma55470used for S. pneumoniae Transformation
Brain Heart InfusionOxoidCM1135used to grow S. pneumoniae cells
Calcium Chloride Cacl2Sigma449709used for S. pneumoniae Transformation
Competence stimulating peptide 1AnaSpecAS-63779used for S. pneumoniae Transformation
Luria Broth AgarGibco22700025used for plating and selection of pSD1 and pSD2
Luria Broth Base (Miller's formulation)Gibco12795027used for plating and selection of pSD1 and pSD2
Monarch Gel Extraction KitNEBT1020SUsed to extract the bands from the DNA gel
Monarch Plasmid Miniprep KitNEBT1010SUsed to extract plasmid from the cells
pGEM T-easyPromegaA1360used as suicide plasmid
S.O.C.Invitrogen15544034used for recovery of cells after transformation
Sodium Hydroxide (NaOH)SigmaS0899used for S.pneumoniae Transformation
Spectinomycin HydrochlorideSigmaAldrichPHR1426Used for bacterial selection
Subcloning Efficiency DH5α Competent CellsInvitrogen18265017used for the creation of pSD1 and pSD2

References

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,
  1. Bentley, S. D., et al. Genetic Analysis of the Capsular Biosynthetic Locus from All 90 Pneumococcal Serotypes. PLoS Genetics. 2 (3), 31(2006).
  2. Calix, J. J., Nahm, M. H. A new pneumococcal serotype, 11E, has a variably inactivated wcjE gene. The Journal of Infectious Diseases. 202 (1), 29-38 (2010).
  3. Park, I. H., Pritchard, D. G., Cartee, R., Brandao, A., Brandileone, M. C. C., Nahm, M. H. Discovery of a New Capsular Serotype (6C) within Serogroup 6 of Streptococcus pneumoniae. Journal of Clinical Microbiology. 45 (4), 1225-1233 (2007).
  4. Jin, P., et al. First Report of Putative Streptococcus pneumoniae Serotype 6D among Nasopharyngeal Isolates from Fijian Children. The Journal of Infectious Diseases. 200 (9), 1375-1380 (2009).
  5. Oliver, M. B., vander Linden, M. P. G., Küntzel, S. A., Saad, J. S., Nahm, M. H. Discovery of Streptococcus pneumoniae Serotype 6 Variants with Glycosyltransferases Synthesizing Two Differing Repeating Units. Journal of Biological Chemistry. 288 (36), 25976-25985 (2013).
  6. Calix, J. J., et al. Serological Characterization of Two Capsule Subtypes among Streptococcus pneumoniae Serotype 20 Strains. Journal of Biological Chemistry. 287 (33), 27885-27894 (2012).
  7. Park, I. H., et al. and Serological Characterization of a New Pneumococcal Serotype, 6H, and Generation of a Pneumococcal Strain Producing Three Different Capsular Repeat Units. Clinical and Vaccine Immunology. 22 (3), 313-318 (2015).
  8. O'Brien, K. L., et al. Burden of disease caused by Streptococcus pneumoniae in children younger than 5 years: global estimates. The Lancet. 374 (9693), 893-902 (2009).
  9. Henriques-Normark, B., Tuomanen, E. I. The Pneumococcus: Epidemiology, Microbiology, and Pathogenesis. Cold Spring Harbor Perspectives in Medicine. 3 (7), 010215(2013).
  10. Leimkugel, J., et al. An Outbreak of Serotype 1 Streptococcus pneumoniae Meningitis in Northern Ghana with Features That Are Characteristic of Neisseria meningitidis Meningitis Epidemics. The Journal of Infectious Diseases. 192 (2), 192-199 (2005).
  11. Yaro, S., et al. Epidemiological and Molecular Characteristics of a Highly Lethal Pneumococcal Meningitis Epidemic in Burkina Faso. Clinical Infectious Diseases. 43 (6), 693-700 (2006).
  12. Antonio, M., et al. Molecular epidemiology of pneumococci obtained from Gambian children aged 2-29 months with invasive pneumococcal disease during a trial of a 9-valent pneumococcal conjugate vaccine. BMC Infectious Diseases. 8 (1), 81(2008).
  13. Kwambana-Adams, B. A., et al. An outbreak of pneumococcal meningitis among older children (≥5 years) and adults after the implementation of an infant vaccination programme with the 13-valent pneumococcal conjugate vaccine in Ghana. BMC Infectious Diseases. 16 (1), 575(2016).
  14. Antonio, M., et al. Seasonality and outbreak of a predominant Streptococcus pneumoniae serotype 1 clone from The Gambia: Expansion of ST217 hypervirulent clonal complex in West Africa. BMC Microbiology. 8 (1), 198(2008).
  15. Staples, M., et al. Molecular characterization of an Australian serotype 1 Streptococcus pneumoniae outbreak. Epidemiology and Infection. 143 (2), 325-333 (2015).
  16. Gessner, B. D., Mueller, J. E., Yaro, S. African meningitis belt pneumococcal disease epidemiology indicates a need for an effective serotype 1 containing vaccine, including for older children and adults. BMC Infectious Diseases. 10 (1), 22(2010).
  17. Hill, P. C., et al. Nasopharyngeal carriage of Streptococcus pneumoniae in Gambian infants: a longitudinal study. Clinical Infectious Diseases. 46 (6), 807-814 (2008).
  18. Ebruke, C., et al. Temporal changes in nasopharyngeal carriage of Streptococcus pneumoniae serotype 1 genotypes in healthy Gambians before and after the 7-valent pneumococcal conjugate vaccine. PeerJ. 3, 90(2015).
  19. Adegbola, R. A., et al. Serotype and antimicrobial susceptibility patterns of isolates of Streptococcus pneumoniae causing invasive disease in The Gambia 1996-2003. Tropical Medicine and International Health. 11 (7), 1128-1135 (2006).
  20. Marks, L. R., Reddinger, R. M., Hakansson, A. P. High Levels of Genetic Recombination during Nasopharyngeal Carriage and Biofilm Formation in Streptococcus pneumoniae. mBio. 3 (5), (2012).
  21. Ritchie, N. D., Mitchell, T. J., Evans, T. J. What is different about serotype 1 pneumococci. Future Microbiology. 7 (1), 33-46 (2012).
  22. Harvey, R. M., et al. The variable region of pneumococcal pathogenicity island 1 is responsible for unusually high virulence of a serotype 1 isolate. Infection and Immunity. 84 (3), 822-832 (2016).
  23. Horton, R. M., Cai, Z. L., Ho, S. N., Pease, L. R. Gene splicing by overlap extension: tailor-made genes using the polymerase chain reaction. BioTechniques. 8 (5), 528-535 (1990).
  24. Alioing, G., Granadel, C., Morrison, D. A., Claverys, J. P. Competence pheromone, oligopeptide permease, and induction of competence in Streptococcus pneumoniae. Molecular Microbiology. 21 (3), 471-478 (1996).
  25. Lund, E. Enumeration and description of the strains belonging to the State Serum Institute, Copenhagen Denmark. , (1951).
  26. Barany, F., Tomasz, A. Genetic transformation of Streptococcus pneumoniae by heterologous plasmid deoxyribonucleic acid. Journal of Bacteriology. 144 (2), 698-709 (1980).
  27. Terra, V. S., Homer, K. A., Rao, S. G., Andrew, P. W., Yesilkaya, H. Characterization of novel β-galactosidase activity that contributes to glycoprotein degradation and virulence in Streptococcus pneumoniae. Infection and Immunity. 78 (1), (2010).
  28. Terra, V. S., Zhi, X., Kahya, H. F., Andrew, P. W., Yesilkaya, H. Pneumococcal 6-phospho-β-glucosidase (BglA3) is involved in virulence and nutrient metabolism. Infection and Immunity. 84 (1), (2015).
  29. Harvey, R. M., Ogunniyi, A. D., Chen, A. Y., Paton, J. C. Pneumolysin with Low Hemolytic Activity Confers an Early Growth Advantage to Streptococcus pneumoniae in the Blood. Infection and Immunity. 79 (10), 4122(2011).
  30. Terra, V. S., Plumptre, C. D., Wall, E. C., Brown, J. S., Wren, B. W. Construction of a pneumolysin deficient mutant in Streptococcus pneumoniae serotype 1 strain 519/43 and phenotypic characterisation. Microbial Pathogenesis. 141, 103999(2020).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Tags

Genetic ModificationPlasmid ConstructionNatural TransformationSuicide PlasmidPneumolysin MutationHemolytic Activity AssayBlue White SelectionRestriction Digestion

Related Articles