DNA-Tethered RNA Polymerase for Programmable In vitro Transcription and Molecular Computation

Summary

We describe the engineering of a novel DNA-tethered T7 RNA polymerase to regulate in vitro transcription reactions. We discuss the steps for protein synthesis and characterization, validate proof-of-concept transcriptional regulation, and discuss its applications in molecular computing, diagnostics, and molecular information processing.

Abstract

DNA nanotechnology enables programmable self-assembly of nucleic acids into user-prescribed shapes and dynamics for diverse applications. This work demonstrates that concepts from DNA nanotechnology can be used to program the enzymatic activity of the phage-derived T7 RNA polymerase (RNAP) and build scalable synthetic gene regulatory networks. First, an oligonucleotide-tethered T7 RNAP is engineered via expression of an N-terminally SNAP-tagged RNAP and subsequent chemical coupling of the SNAP-tag with a benzylguanine (BG)-modified oligonucleotide. Next, nucleic-acid strand displacement is used to program polymerase transcription on-demand. In addition, auxiliary nucleic acid assemblies can be used as "artificial transcription factors" to regulate the interactions between the DNA-programmed T7 RNAP with its DNA templates. This in vitro transcription regulatory mechanism can implement a variety of circuit behaviors such as digital logic, feedback, cascading, and multiplexing. The composability of this gene regulatory architecture facilitates design abstraction, standardization, and scaling. These features will enable the rapid prototyping of in vitro genetic devices for applications such as bio-sensing, disease detection, and data storage.

Introduction

DNA computing uses a set of designed oligonucleotides as the medium for computation. These oligonucleotides are programmed with sequences to dynamically assemble according to user-specified logic and respond to specific nucleic-acid inputs. In proof-of-concept studies, the output of the computation typically consists of a set of fluorescently labelled oligonucleotides that can be detected via gel electrophoresis or fluorescence plate readers. Over the past 30 years, increasingly complex DNA computational circuitries have been demonstrated, such as various digital logic cascades, chemical reaction networks, and neural networks^1,

Protocol

1. Buffer preparation

NOTE: Protein purification buffer preparation can occur on any day; here, it was done prior to beginning the experiments.

1. Prepare lysis/equilibration buffer containing 50 mM tris(hydroxymethyl)aminomethane (Tris), 300 mM sodium chloride (NaCl), 5% glycerol, and 5 mM β-mercaptoethanol (BME), pH 8. Add 1.5 mL of 1M Tris, 1.8 mL of 5M NaCl, 1.5 mL of glycerol, 25.2 mL of deionized water (ddH₂O) into a 50 mL centrifuge tube, and add 10.5 µL of 14.2 M BME just prior to use.
   NOTE: Tris can cause acute toxicity; hence, avoid breathing its dust, and avoid skin and eye contact. BME is toxic and shoul....

Results

Figure 5: SDS-PAGE analysis of SNAP T7 RNAP expression and in vitro transcription assay. (A) SNAP T7 RNAP protein purification analysis, SNAP T7 RNAP molecular weight: 119.4kDa. FT = flow-thro.......

Discussion

This study demonstrates a DNA nanotechnology-inspired approach to control the activity of T7 RNA polymerase by covalently coupling an N-terminally SNAP-tagged recombinant T7 RNAP with a BG-functionalized oligonucleotide, which was subsequently used to program TMDSD reactions. By design, the SNAP-tag was positioned at the N-terminus of the polymerase, as the C-terminus of wild-type T7 RNAP is buried within the protein structure core and makes important contacts with the DNA template²⁸. Prior attemp.......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
0.5% polysorbate 20 (TWEEN 20)	BioShop	TWN510.5
0.5M ethylenediaminetetraacetic acid (EDTA)	Bio Basic	SD8135
10 mM sodium phosphate buffer (pH 7)	Bio Basic	PD0435	Tablets used to make 10 mM buffer
10% ammonium persulfate (APS)	Sigma Aldrich	A3678-100G
100 kDa Amicon Ultra-15 Centrifugal Filter Unit	Fisher Scientific	UFC910008
100% acetone	Fisher Chemical	A18P4
100% ethanol (EtOH)	House Brand	39752-P016-EAAN
10x in vitro transcription (IVT) buffer	New England Biolabs	B9012
10x Tris-Borate-EDTA (TBE) buffer	Bio Basic	A0026
1M Isopropyl β- d-1-thiogalactopyranoside (IPTG)	Sigma Aldrich	I5502-1G
1M sodium bicarbonate buffer	Sigma Aldrich	S6014-500G
1M Tris(hydroxymethyl)aminomethane (Tris)	Sigma Aldrich	648311-1KG
1X Tris-EDTA (TE) buffer	ThermoFisher	12090015
2M imidazole	Sigma Aldrich	56750-100G
2-mercaptoethanol (BME)	Sigma Aldrich	M3148
3M sodium acetate	Bio Basic	SRB1611
40% acrylamide (19:1)	Bio Basic	A00062
4x LDS protein sample loading buffer	Fisher Scientific	NP0007
5M sodium chloride (NaCl)	Bio Basic	DB0483
5mM dithiothreitol (DTT)	Sigma Aldrich	43815-1G
6x gel loading dye	New England Biolabs	B7024S
agarose B powder	Bio Basic	AB0014
BG-GLA-NHS	New England Biolabs	S9151S
BL21 competent E. coli	Addgene	C2530H
BLUeye prestained protein ladder	FroggaBio	PM007-0500
bromophenol blue	Bio Basic	BDB0001
coomassie blue (SimplyBlue SafeStain)	ThermoFisher	LC6060
cyanine dye (SYBR Gold nucleic acid gel stain)	Fisher Scientific	S11494
cyanine dye (SYBR Safe nucleic acid gel stain)	Fisher Scientific	S33102
dry dimethyl sulfoxide (DMSO)	Fisher Scientific	D12345
formamide	Sigma Aldrich	F9037-100ML
glycerol	Bio Basic	GB0232
kanamycin sulfate	BioShop	KAN201.5
lysogeny broth	Sigma Aldrich	L2542-500ML
malachite green oxalate	Sigma Aldrich	2437-29-8
N,N,N'N'-Tetramethylethane-1,2-diamine (TEMED)	Sigma Aldrich	T9281-25ML
NuPAGE MES SDS running buffer (20x)	Fisher Scientific	LSNP0002
NuPAGE Novex 4-12% Bis-Tris gel 1.0 mm 12-well	Life Technologies	NP0322BOX
oligonucleotide (cage antisense)	IDT	N/A	TATAGTGAGTCGTATTAATTTG
oligonucleotide (cage sense)	IDT	N/A	TCAGTCACCTATCTGTTTCAAA TTAATACGACTCACTATA
oligonucleotide (malachite green aptamer antisense)	IDT	N/A	GGATCCATTCGTTACCTGGCT CTCGCCAGTCGGGATCCTATA GTGAGTCGTATTACAGTTCCAT TATCGCCGTAGTTGGTGTACT
oligonucleotide (malachite green aptamer sense)	IDT	N/A	TAATACGACTCACTATAGGATC CCGACTGGCGAGAGCCAGGT AACGAATGGATCC
oligonucleotide (Transcription Factor A)	IDT	N/A	AGTACACCAACTACGAGTGAG
oligonucleotide (Transcription Factor B)	IDT	N/A	TCAGTCACCTATCTGGCGATAA TGGAACTG
oligonucleotide with 3’ Amine modification (tether)	IDT	N/A	GCTACTCACTCAGATAGGTGAC TGA/3AmMO/
Pierce strong ion exchange spin columns	Fisher Scientific	90008
plasmid encoding SNAP T7 RNAP and kanamycin resistance genes	Genscript	N/A	custom gene insert
protein purification column (HisPur Ni-NTA spin column)	Fisher Scientific	88226
rNTP mix	New England Biolabs	N0466S
Roche mini quick DNA spin column	Sigma Aldrich	11814419001
Triton X-100	Sigma Aldrich	T8787-100ML
Ultra Low Range DNA ladder	Fisher Scientific	10597012
urea	BioShop	URE001.1