A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

DNA-Tethered RNA Polymerase for Programmable In vitro Transcription and Molecular Computation

4.1K views

⸱

DOI:

10.3791/62073

⸱

December 29th, 2021

In This Article

Summary

We describe the engineering of a novel DNA-tethered T7 RNA polymerase to regulate in vitro transcription reactions. We discuss the steps for protein synthesis and characterization, validate proof-of-concept transcriptional regulation, and discuss its applications in molecular computing, diagnostics, and molecular information processing.

Abstract

DNA nanotechnology enables programmable self-assembly of nucleic acids into user-prescribed shapes and dynamics for diverse applications. This work demonstrates that concepts from DNA nanotechnology can be used to program the enzymatic activity of the phage-derived T7 RNA polymerase (RNAP) and build scalable synthetic gene regulatory networks. First, an oligonucleotide-tethered T7 RNAP is engineered via expression of an N-terminally SNAP-tagged RNAP and subsequent chemical coupling of the SNAP-tag with a benzylguanine (BG)-modified oligonucleotide. Next, nucleic-acid strand displacement is used to program polymerase transcription on-demand. In addition, auxiliary nucleic acid assemblies can be used as "artificial transcription factors" to regulate the interactions between the DNA-programmed T7 RNAP with its DNA templates. This in vitro transcription regulatory mechanism can implement a variety of circuit behaviors such as digital logic, feedback, cascading, and multiplexing. The composability of this gene regulatory architecture facilitates design abstraction, standardization, and scaling. These features will enable the rapid prototyping of in vitro genetic devices for applications such as bio-sensing, disease detection, and data storage.

Introduction

DNA computing uses a set of designed oligonucleotides as the medium for computation. These oligonucleotides are programmed with sequences to dynamically assemble according to user-specified logic and respond to specific nucleic-acid inputs. In proof-of-concept studies, the output of the computation typically consists of a set of fluorescently labelled oligonucleotides that can be detected via gel electrophoresis or fluorescence plate readers. Over the past 30 years, increasingly complex DNA computational circuitries have been demonstrated, such as various digital logic cascades, chemical reaction networks, and neural networks1,

Access restricted. Please log in or start a trial to view this content.

Protocol

1. Buffer preparation

NOTE: Protein purification buffer preparation can occur on any day; here, it was done prior to beginning the experiments.

  1. Prepare lysis/equilibration buffer containing 50 mM tris(hydroxymethyl)aminomethane (Tris), 300 mM sodium chloride (NaCl), 5% glycerol, and 5 mM β-mercaptoethanol (BME), pH 8. Add 1.5 mL of 1M Tris, 1.8 mL of 5M NaCl, 1.5 mL of glycerol, 25.2 mL of deionized water (ddH2O) into a 50 mL centrifuge tube, and add 10.5 µL of 14.2 M BME just prior to use.
    NOTE: Tris can cause acute toxicity; hence, avoid breathing its dust, and avoid skin and eye contact. BME is toxic and shoul....

Access restricted. Please log in or start a trial to view this content.

Results

Electrophoresis gel protein analysis and fluorescence assay chart showing SNAP T7 RNAP expression result.
Figure 5: SDS-PAGE analysis of SNAP T7 RNAP expression and in vitro transcription assay. (A) SNAP T7 RNAP protein purification analysis, SNAP T7 RNAP molecular weight: 119.4kDa. FT = flow-thro.......

Access restricted. Please log in or start a trial to view this content.

Discussion

This study demonstrates a DNA nanotechnology-inspired approach to control the activity of T7 RNA polymerase by covalently coupling an N-terminally SNAP-tagged recombinant T7 RNAP with a BG-functionalized oligonucleotide, which was subsequently used to program TMDSD reactions. By design, the SNAP-tag was positioned at the N-terminus of the polymerase, as the C-terminus of wild-type T7 RNAP is buried within the protein structure core and makes important contacts with the DNA template28. Prior attemp.......

Access restricted. Please log in or start a trial to view this content.

Disclosures

There are no competing financial interests to declare by any of the authors.

Acknowledgements

L.Y.T.C acknowledges generous support from the New Frontiers in Research Fund-Exploration (NFRF-E), the Natural Sciences and Engineering Research Council of Canada (NSERC) Discovery Grant, and the University of Toronto's Medicine by Design Initiative, which receives funding from the Canada First Research Excellence Fund (CFREF).

....

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
0.5% polysorbate 20 (TWEEN 20)BioShopTWN510.5
0.5M ethylenediaminetetraacetic acid (EDTA)Bio BasicSD8135
10 mM sodium phosphate buffer (pH 7)Bio BasicPD0435Tablets used to make 10 mM buffer
10% ammonium persulfate (APS)Sigma AldrichA3678-100G
100 kDa Amicon Ultra-15 Centrifugal Filter UnitFisher ScientificUFC910008
100% acetoneFisher ChemicalA18P4
100% ethanol (EtOH)House Brand39752-P016-EAAN
10x in vitro transcription (IVT) bufferNew England BiolabsB9012
10x Tris-Borate-EDTA (TBE) bufferBio BasicA0026
1M Isopropyl β- d-1-thiogalactopyranoside (IPTG)Sigma AldrichI5502-1G
1M sodium bicarbonate bufferSigma AldrichS6014-500G
1M Tris(hydroxymethyl)aminomethane (Tris)Sigma Aldrich648311-1KG
1X Tris-EDTA (TE) bufferThermoFisher12090015
2M imidazoleSigma Aldrich56750-100G
2-mercaptoethanol (BME)Sigma AldrichM3148
3M sodium acetateBio BasicSRB1611
40% acrylamide (19:1)Bio BasicA00062
4x LDS protein sample loading bufferFisher ScientificNP0007
5M sodium chloride (NaCl)Bio BasicDB0483
5mM dithiothreitol (DTT)Sigma Aldrich43815-1G
6x gel loading dyeNew England BiolabsB7024S
agarose B powderBio BasicAB0014
BG-GLA-NHSNew England BiolabsS9151S
BL21 competent E. coliAddgeneC2530H
BLUeye prestained protein ladderFroggaBioPM007-0500
bromophenol blueBio BasicBDB0001
coomassie blue (SimplyBlue SafeStain)ThermoFisherLC6060
cyanine dye (SYBR Gold nucleic acid gel stain)Fisher ScientificS11494
cyanine dye (SYBR Safe nucleic acid gel stain)Fisher ScientificS33102
dry dimethyl sulfoxide (DMSO)Fisher ScientificD12345
formamideSigma AldrichF9037-100ML
glycerolBio BasicGB0232
kanamycin sulfateBioShopKAN201.5
lysogeny brothSigma AldrichL2542-500ML
malachite green oxalateSigma Aldrich2437-29-8
N,N,N'N'-Tetramethylethane-1,2-diamine (TEMED)Sigma AldrichT9281-25ML
NuPAGE MES SDS running buffer (20x)Fisher ScientificLSNP0002
NuPAGE Novex 4-12% Bis-Tris gel 1.0 mm 12-wellLife TechnologiesNP0322BOX
oligonucleotide (cage antisense)IDTN/ATATAGTGAGTCGTATTAATTTG
oligonucleotide (cage sense)IDTN/ATCAGTCACCTATCTGTTTCAAA
TTAATACGACTCACTATA
oligonucleotide (malachite green aptamer antisense)IDTN/AGGATCCATTCGTTACCTGGCT
CTCGCCAGTCGGGATCCTATA
GTGAGTCGTATTACAGTTCCAT
TATCGCCGTAGTTGGTGTACT
oligonucleotide (malachite green aptamer sense)IDTN/ATAATACGACTCACTATAGGATC
CCGACTGGCGAGAGCCAGGT
AACGAATGGATCC
oligonucleotide (Transcription Factor A)IDTN/AAGTACACCAACTACGAGTGAG
oligonucleotide (Transcription Factor B)IDTN/ATCAGTCACCTATCTGGCGATAA
TGGAACTG
oligonucleotide with 3’ Amine modification (tether)IDTN/AGCTACTCACTCAGATAGGTGAC
TGA/3AmMO/
Pierce strong ion exchange spin columnsFisher Scientific90008
plasmid encoding SNAP T7 RNAP and kanamycin resistance genesGenscriptN/Acustom gene insert
protein purification column (HisPur Ni-NTA spin column)Fisher Scientific88226
rNTP mixNew England BiolabsN0466S
Roche mini quick DNA spin columnSigma Aldrich11814419001
Triton X-100Sigma AldrichT8787-100ML
Ultra Low Range DNA ladderFisher Scientific10597012
ureaBioShopURE001.1

References

  1. Cherry, K. M., Qian, L. Scaling up molecular pattern recognition with DNA-based winner-take-all neural networks. Nature. 559 (7714), 370-376 (2018).
  2. Qian, L., Winfree, E., Bruck, J. Neural network computation with DNA strand displacement cascades. Nature. 4....

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

DNA NanotechnologyT7 RNA PolymeraseDNA TetheringGene Regulatory NetworksStrand DisplacementArtificial Transcription FactorsSDS-PAGEFluorescence Plate Reader