Method Article

Isolating Brown Adipocytes from Murine Interscapular Brown Adipose Tissue for Gene and Protein Expression Analysis

DOI:

10.3791/62332

March 12th, 2021

In This Article

Summary

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

This study describes a new method of isolating murine brown adipocytes for gene and protein expression analysis.

Abstract

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Brown adipose tissue (BAT) is responsible for non-shivering thermogenesis in mammals, and brown adipocytes (BAs) are the functional units of BAT. BAs contain both multilocular lipid droplets and abundant mitochondria, and they express uncoupling protein 1 (UCP1). BAs are categorized into two sub-types based on their origin: embryo derived classical BAs (cBAs) and white adipocytes derived BAs. Due to their relatively low density, BAs cannot be isolated from BAT with traditional centrifugation method. In this study, a new method was developed to isolate BAs from mice for gene and protein expression analysis. In this protocol, interscapular BAT from adult mice was digested with Collagenase and Dispase solution, and the dissociated BAs were enriched with 6% iodixanol solution. Isolated BAs were then lysed with Trizol reagent for simultaneous isolation of RNA, DNA, and protein. After RNA isolation, the organic phase of the lysate was used for protein extraction. Our data showed that 6% iodixanol solution efficiently enriched BAs without interfering with follow-up gene and protein expression studies. Platelet-derived growth factor (PDGF) is a growth factor that regulates the growth and proliferation of mesenchymal cells. Compared to the brown adipose tissue, isolated BAs had significantly higher expression of Pdgfa. In summary, this new method provides a platform for studying the biology of brown adipocytes at a single cell-type level.

Introduction

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Both mice and humans have two types of adipose tissues: white adipose tissue (WAT) and brown adipose tissue (BAT)1. WAT stores energy in the form of triglycerides in white adipocytes, and the brown adipocytes (BAs) of BAT dissipate chemical energy as heat2. Based on their developmental origin, BAs are further categorized into classical BAs (cBAs) that formed during embryo development and white adipocytes derived BAs (beige/brite cells, converted from white adipocytes under stress conditions)3. BAs are multilocular and express the thermogenic protein uncoupling protein 1 (UCP1)4. Interscapular BAT (iBAT) depot is one of the primary cBAs depots in small mammals5, whereas beige cells are dispersed within WAT6.

Due to their nature of dissipating energy, BAs have received much attention as a therapeutic target for reducing obesity7. To exploit BAs for the purpose of treating obesity, it is essential to understand the molecular mechanisms that control BAs function, survival, and recruitment. Adipose tissues including BAT and WAT are heterogeneous. Except for adipocytes, adipose tissues contain many other cell types, such as endothelial cells, mesenchymal stem cells and macrophages8. Although genetic tools to specifically deplete candidate genes in mice BAs are available, such as UCP1::Cre line9, techniques for purifying BAs from BAT or WAT are limited, making it hard to study BAs at a single-cell type level. Additionally, without obtaining pure BAs, the relationship between BAs and non-BAs will not be clearly delineated. For instance, platelet-derived growth factor receptor alpha (PDGFRα) has been used as a marker for undifferentiated mesenchymal cells, and it is expressed in the endothelial and interstitial cells of BAT. In cold stressed BAT, PDGFRα positive progenitor cells give rise to new BAs10. PDGFRα is activated by its ligand PDGF, a growth factor that regulates the growth and proliferation of mesenchymal cells11; however, it is unclear whether BAs influence the behavior of PDGFRα positive progenitor cells by secreting PDGF.

Recently, a BAs isolation protocol has been published, which is based on fluorescence-activated cell sorting (FACS)12. In this protocol, 3% bovine serum albumin (BSA) solution was used to separate BAs from non-BAs, and the enriched BAs were further purified by FACS. The application of this protocol is limited by the requirement of FACS process, which relies on both equipment and FACS operation experiences. In this study, a new protocol for isolating BAs from BAT was developed. The BAs isolated by this protocol can be directly used for gene and protein expression studies. Furthermore, data from this study suggest that BAs are a major PDGF resource.

Access restricted. Please log in or start a trial to view this content.

Protocol

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

All mice were maintained in pathogen-free conditions, and all procedures were approved by Masonic Medical research Institutional Animal Care and Use Committee (IACUC). UCP1::Cre9 and Rosa 26tdTomato mice lines13 were reported previously. All mice were kept at room temperature with a 12 h light/dark cycle.

1. Preparing the Solutions and brown adipose tissue (BAT)

  1. Prepare digestion solution and separation solution in 15 mL centrifuge tubes.
  2. 10 mL of BAT Digestion solution: To 10 mL of sterile phosphate-buffered saline (PBS), add 3.5 mg/mL Dispase II, 1 mg/mL Collagenase II and 10 mM CaCl2 to make BAT digestion solution.
  3. 10 mL of 12% iodixanol solution (separation solution): Mix 1 mL of 10x PBS, 2 mL of 60% iodixanol, 0.01 mL of 1 M MgCl2, 0.025 mL of 1 M KCl, 0.1 mL of 0.2 M ethylenediaminetetraacetic acid (EDTA) and 6.865 mL of ddH2O to obtain 12% iodixanol.
  4. Euthanize one adult mouse with CO2 overdose. Briefly, fill the mouse cage with 100% CO2 at a displacement rate of 10-30% cage volume per min. 5 min later, confirm death by checking for the absence of visibly breathing.
  5. Dissect the animal and collect interscapular BAT. Remove WAT and muscle layers under a stereo microscope.
  6. To have sufficient digestion, cut each BAT lobe into ~ 3 mm3 parts and place them into a clean 50 mL flask with a metal stir bar and 5 mL digestion solution. Before starting digestion, let the flask containing BAT and digestion buffer sit on ice for 1 h.
    ​NOTE: In the following steps, around 80 mg BAT was used for brown adipocytes isolation.

2. BAs isolation procedure

  1. Place the flask on a magnetic stirrer that is enclosed in an incubator. Set the stirring speed at 60 rpm and the temperature of the incubator at 35 °C, respectively. The digestion will last for around 30 min. If the BAT slices form clumps around the stirrer bar during digestion, use a 1 mL pipette tip to disrupt the aggregated tissues.
  2. Place a 70 µm strainer filter on top of a clean 50 mL centrifuge tube. Pipette around 4 mL cell suspension through the strainer. Wash the strainer with 4 mL of 12% iodixanol solution. Pipette up and down to mix the cells and the iodixanol solution. Transfer the cell mixture into two clear 5 mL polystyrene test tubes.
    NOTE: At the end of digestion, the digestion solution should be cloudy, indicating sufficient digestion. Use fresh digestion solution every time. Once prepared, the digestion solution should be used within 2 h.
  3. Repeat step 2.2 and 2.3 once more if the digestion is not sufficient.
  4. Leave the clear polystyrene tubes containing the separation solution and BAs on ice for 1 h. The BAs will form a layer on the top.
  5. Take out 20 µL of the isolated BAs for microscope examination.

3. RNA and protein isolation from BAs

  1. Pipette the BAs layer into two 1.7 mL microcentrifuge tubes for RNA and protein isolation. Carefully remove the excessive iodixanol solution without disrupting the BAs layer.
  2. Add 1 mL Trizol to simultaneously isolate RNA, DNA, and protein into the cell solution. Mix sufficiently to lyse the cells.
  3. Add 200 µL of Chloroform to separate the phases.
  4. Centrifuge the tube for 9,981 x g for 10 min at 4 °C.
  5. After centrifugation, use the aqueous phase for RNA isolation. In this study, total RNA was used for reverse transcription, and quantitative RT-PCR was carried out with Real-Time PCR. Primer sequences are listed in Table of Materials.
  6. Transfer 300 µL of the organic phase into a 2 mL microcentrifuge tube.
  7. To the organic phase, add 2.5 volume 100% ethanol and vortex for 10 s.
  8. Add 200 µL of 1-Bromo-3-chloropropane and vortex for 10 s.
  9. Add 600 µL of double distilled water and vortex for 10 s.
  10. Let the mixed solution stand for 10 min at room temperature.
  11. Centrifuge at 9,981 x g for 10 min at 4 °C. At this step, the phases will be separated. The protein phase is localized in the middle layer.
  12. Remove the top aqueous solution. Add 1 mL 100% ethanol into the remaining solution.
  13. Centrifuge for 10 min, 9,981 x g, 4 °C. After centrifugation, the protein pellet will form. Discard the supernatant.
  14. Wash the pellet with 1 mL 100% ethanol.
  15. Centrifuge for 10 min, 9981 x g, 4 °C. Save the pellet and discard the supernatant.
  16. Air-dry the pellet for 10 min at room temperature.
  17. Measure the weight of the wet pellet. Add in 1% SDS solution at a ratio of 20 µL/mg pellet.
  18. Dissolve the pellet by putting the tube in a heated shaker. Set the temperature at 55 °C, and the speed at 11 x g. It usually takes 5-10 min to completely dissolve the protein pellet.
    NOTE: The concentration of the dissolved protein can be measured by BCA assay14.

Access restricted. Please log in or start a trial to view this content.

Results

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Preparation of interacapular BAT for brown adipocytes isolation
The brown adipocytes (BAs) isolation process is depicted in Figure 1A. The whole process, from preparing BAT and digestion/separation solutions to obtaining isolated BAs will take around 4 h.

In adult mice, abundant BAT exists in the interscapular region. This interscapular BAT (iBAT) is covered by muscle layers and WAT (Figure 1B). Before starting th...

Access restricted. Please log in or start a trial to view this content.

Discussion

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

In this study, a new method of isolating BAs for gene and protein expression analysis was developed.

In a published BAs isolation protocol, 3% BSA solution was used to enrich BAs12. Nevertheless, the enriched BAs achieved by this published protocol could not be directly used for protein expression analysis. This is because the concentrated BSA existing in the BAs solution interferes with following-up protein extraction. When the BAs enriched in the 3% BSA solution were ...

Access restricted. Please log in or start a trial to view this content.

Acknowledgements

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Z. Lin was supported by National Institutes of Health HL138454-01 and Masonic Medical Research Institute funds.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
Antibodies
AntigenCompanyCatalog
PPARγLSBioLs-C368478
PDGFRaSanta Cruzsc-398206
UCP1R&D systemIC6158P
Chemical and solutions
Collagenase, Type IIThermo Fisher Scientific17101015
1-Bromo-3-chloropropaneSigma-AldrichB62404
Bovine Serum Albumin (BSA) GoldbioA-421-10
Calcium chlorideBio BasicCT1330
ChloroformIBI ScientificIB05040
Dispase II, proteaseSigma-AldrichD5693
EDTABio BasicEB0107
EthanolIBI ScientificIB15724
LiQuant Universal Green qPCR Master MixLifeSctLS01131905Y
Magnesium Chloride HexahydrateBoston BioProductsP-855
OneScrip Plus cDNA Synthesis SuperMixABMG454
OptiPrep (Iodixanol)Cosmo Bio USAAXS-1114542
PBS (10x)Caisson LabsPBL07
PBS (1x)Caisson LabsPBL06
Pierce BCA Protein Assay KitThermo Fisher Scientific23227
Potassium ChlorideBoston BioProductsP-1435
SimplyBlue safe StainInvitrogenLC6060
Sodium dodecyl sulfate (SDS)Sigma-Aldrich75746
Trizol reagentLife technoologies15596018
Primers
Gene name (Species) ForwardReverse
Pdgfra (Mouse)CTCAGCTGTCTCCTCACAgGCAACGCATCTCAGAGAAAAGG
Pdgfa (Mouse)TGTGCCCATTCGCAGGAAGAGTTGGCCACCTTGACACTGCG
36B4(Mouse)TGCTGAACATCTCCCCCTTCTCTCTCCACAGACAATGCCAGGAC
Ucp1ACTGCCACACCTCCAGTCATTCTTTGCCTCACTCAGGATTGG
Equipment
NameCompanyApplication
Keyence BZ-X700KeyenceImaging brown adipocytes
Magnetic stirrerVWRDissociate BAT
QuantStudio 6 Flex Real-Time PCR SystemApplied BiosystemQuantitative PCR
The Odyssey Fc Imaging systemLI-CORWestern blot immaging

References

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,
  1. Zwick, R. K., Guerrero-Juarez, C. F., Horsley, V., Plikus, M. V. Anatomical, physiological, and functional diversity of adipose tissue. Cell Metabolism. 27, 68-83 (2018).
  2. Symonds, M. E. Brown adipose tissue growth and development. Scientifica. 2013, Cairo. 305763(2013).
  3. Giralt, M., Villarroya, F. White, brown, beige/brite: Different adipose cells for different functions. Endocrinology. 154, 2992-3000 (2013).
  4. Cannon, B., Nedergaard, J. Brown adipose tissue: function and physiological significance. Physiological Reviews. 84, 277-359 (2004).
  5. Cinti, S. The adipose organ. Prostaglandins, Leukotrienes and Essential Fatty Acids. 73, 9-15 (2005).
  6. Wu, J., et al. Beige adipocytes are a distinct type of thermogenic fat cell in mouse and human. Cell. 150, 366-376 (2012).
  7. Cypess, A. M., Kahn, C. R. Brown fat as a therapy for obesity and diabetes. Current Opinion in Endocrinology, Diabetes and Obesity. 17, 143-149 (2010).
  8. Schoettl, T., Fischer, I. P., Ussar, S. Heterogeneity of adipose tissue in development and metabolic function. Journal of Experimental Biology. 221, (2018).
  9. Kong, X., et al. IRF4 is a key thermogenic transcriptional partner of PGC-1α. Cell. 158, 69-83 (2014).
  10. Lee, Y. H., Petkova, A. P., Konkar, A. A., Granneman, J. G. Cellular origins of cold-induced brown adipocytes in adult mice. The FASEB Journal. 29, 286-299 (2015).
  11. Kim, W. -S., Park, H. -S., Sung, J. -H. The pivotal role of PDGF and its receptor isoforms in adipose-derived stem cells. Histology and Histopathology. 30 (7), 793-799 (2015).
  12. Hagberg, C. E. Flow cytometry of mouse and human adipocytes for the analysis of browning and cellular heterogeneity. Cell Report. 24, 2746-2756 (2018).
  13. Madisen, L., et al. A robust and high-throughput Cre reporting and characterization system for the whole mouse brain. Nature Neuroscience. 13, 133-140 (2010).
  14. Smith, P. K., et al. Measurement of protein using bicinchoninic acid. Analytical biochemistry. 150, 76-85 (1985).
  15. Chey, S., Claus, C., Liebert, U. G. Improved method for simultaneous isolation of proteins and nucleic acids. Analytical Biochemistry. 411, 164-166 (2011).
  16. Ford, T., Graham, J., Rickwood, D. Iodixanol: A nonionic iso-osmotic centrifugation medium for the formation of self-generated gradients. Analytical Biochemistry. 220, 360-366 (1994).
  17. Kovacovicova, K., Vinciguerra, M. Isolation of senescent cells by iodixanol (OptiPrep) density gradient-based separation. Cell Proliferation. 52, 12674(2019).
  18. Lock, M., et al. versatile manufacturing of recombinant adeno-associated viral vectors at scale. Human Gene Therapy. 21, 1259-1271 (2010).
  19. Marin, R. D., Crespo-Garcia, S., Wilson, A. M., Sapieha, P. RELi protocol: Optimization for protein extraction from white, brown, and beige adipose tissues. MethodsX. 6, 918-928 (2019).
  20. Sonna, L. A., Fujita, J., Gaffin, S. L., Lilly, C. M. Invited Review: effects of heat and cold stress on mammalian gene expression. Journal of Applied Physiology. 92, 1725-1742 (2002).
  21. Gensch, N., Borchardt, T., Schneider, A., Riethmacher, D., Braun, T. Different autonomous myogenic cell populations revealed by ablation of Myf5-expressing cells during mouse embryogenesis. Development. 135, 1597-1604 (2008).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Tags

Gene ExpressionCell IsolationIodixanol EnrichmentCollagenase DigestionSDS PAGE GelMultilocular Lipid DropletsUncoupling Protein 1

Related Articles