Reconstruct Human Retinoblastoma In Vitro

Summary

We describe a method for generating human retinoblastoma (RB) by introducing biallelic RB1 mutations in human embryonic stem cells (hESC). RB cell lines could also be successfully cultured using the isolated RB in a dish.

Abstract

Human RB is pediatric cancer, which is lethal if no treatment is administered. As RB originates from cone precursors, which is relatively rare in rodent models, meanwhile regarding the interspecies differences between humans and rodents, a disease model derived from humans is more beneficial for uncovering the mechanisms of human RB and seeking the targets of therapy. Herein, the protocol describes the generation of two gene-edited hESC lines with a biallelic RB1 point mutation (RB1^Mut/Mut) and an RB1 knockout mutation (RB1^-/-), respectively. During the process of retinal development, the formation of RB is observed. The RB cell lines are also established by segregating from the RB organoids. Altogether, by differentiating the gene-edited hESC lines into the retinal organoids using a 2D and 3D combined differentiation protocol, we have successfully reconstructed the human RB in a dish and identified its cone-precursor origin. It would provide a helpful disease model for observing the retinoblastoma genesis, proliferation, and growth as well as further developing novel therapeutic agents.

Introduction

Human retinoblastoma (RB) is a rare, fatal tumor derived from the retinal cone-precursors^1,2,3, is the most common type of intraocular malignancy in childhood⁴. Homozygous inactivation of RB1 gene is the initiating genetic lesion in RB⁵. However, mice with RB1 mutations fail to form the retinal tumor². Although the mouse tumors could be generated with the combination of Rb1 mutations and other genetic modifications, they still lack the features of human RB⁶

Protocol

This study is approved by the institutional Ethics Committee of Beijing Tongren Hospital, Capital Medical University. H9 hESCs are obtained from the WiCell Research Institute.

1. Generation of RB1 mutated hESC

1. CRISPR/Cas9 targeting vector for the knockout (KO) of RB1.
   1. Design a pair of sgRNA. For the ablation of RB1, target the first exon of this gene. The forward primer sequence is CACCGCGGTGGCGGCCGTTTTTCGG, and the reverse primer sequence is AAACCCGAAAAACGGCCGCCACCGC.
      NOTE: For the specific RB1 mutation, a repaired template is also required. In this protocol, RB1....

Results

The procedure of RB generation is elucidated in the Figure 1, which combines the adherent and floating culture. It was possible to harvest the human RB from RB1-KO hESC, and obtain the RB cell line by isolating the RB organoids.

Here, the protocol provides the details of the differentiation in different stages (Figure 2). Hollow spheres are formed in the first 3 days which attach to the culture surface and then expand (

Discussion

Human retinoblastoma (RB) is caused by the inactivation of RB1 and the dysfunction of Rb protein. In this protocol, the RB1-KO hESC is the pivotal step for the generation of RB in a dish. While even with RB1^-/- hESC, it is possible that there is no RB formation due to the methods of retinal organoid differentiation¹⁰. In this protocol, the transfer from adherent culture to floating culture is essential in the process of differentiation. The density of the cyst.......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
2-mercaptoethanol	Life Technologies	21985-023
Anti-ARR3	Sigma	HPA063129	Antibody
Anti-CRX (M02)	Abnove	ABN-H00001406-M02	Antibody
Anti-Ki67	Abcam	ab15580	Antibody
Anti-Syk (D3Z1E)	Cell Signaling Technology	13198	Antibody
BbsI	NEB	R3539S	Restriction enzymes
Dispase (1U/mL)	Stemcell Technologies	7923
DMEM basic	Gibco	10566-016
DMEM/F-12-GlutaMAX	Gibco	10565-042
DMSO	Sigma	D2650
DPBS	Gibco	C141905005BT
EDTA	Thermo	15575020
Fetal Bovine Serum (FBS), Qualified for Human Embryonic Stem Cells	Biological Industry	04-002-1A
Glutamine	Gibco	35050-061
Ham's F-12 Nutrient Mix (Hams F12)	Gibco	11765-054
MEM Non-essential Amino Acid Solution (100X)	Sigma	M7145
Neurobasal Medium	Gibco	21103-049
P3 Primary Cell 4D-Nucleofector X Kit S	Lonza	V4XP-3032	Nucleofection kit
Pen Strep	Gibco	15140-122
Puromycin	Gene Operation	ISY1130- 0025MG
QIAquick PCR Purification Kit	QIAGEN	28104
ncEpic-hiPSC/hESC culture medium	Nuwacell	RP01001	ncEpic-hiPSC/hESC culture medium in 1.2.1
Growth factor reduced basement membrane matrix	BD	356231	Matrigel in 1.2.1
Cell dissociation enzyme	Gibco	12563-011	TrypLE Express in 1.2.8
RNeasy Midi Kit	QIAGEN	75144
RNeasy Mini Kit	QIAGEN	74104
Supplement A	Life Technologies	17502-048	N-2 Supplement (100X), liquid, supplemet in medum I
Supplement B	Life Technologies	17105-041	B-27 Supplement (50X),liquid, supplemet in medum I,II,III
T4 Polynucleotide Kinase	Life Technologies	EK0032
Taurine	Sigma	T-8691-25G
Y-27632 2HCl	Selleck	S1049
pX330-U6- Chimeric BB-CBh-hSpCas9-2A-Puro	Addgene	42230
Nucleofector 4D	Lonza
RPMI	Sigma	R0883-500ML