Method Article

An Optimized O9-1/Hydrogel System for Studying Mechanical Signals in Neural Crest Cells

3K views

DOI:

10.3791/62693

August 13th, 2021

* These authors contributed equally

In This Article

Summary

Detailed step-by-step protocols are described here for studying mechanical signals in vitro using multipotent O9-1 neural crest cells and polyacrylamide hydrogels of varying stiffness.

Abstract

Neural crest cells (NCCs) are vertebrate embryonic multipotent cells that can migrate and differentiate into a wide array of cell types that give rise to various organs and tissues. Tissue stiffness produces mechanical force, a physical cue that plays a critical role in NCC differentiation; however, the mechanism remains unclear. The method described here provides detailed information for the optimized generation of polyacrylamide hydrogels of varying stiffness, the accurate measurement of such stiffness, and the evaluation of the impact of mechanical signals in O9-1 cells, a NCC line that mimics in vivo NCCs.

Hydrogel stiffness was measured using atomic force microscopy (AFM) and indicated different stiffness levels accordingly. O9-1 NCCs cultured on hydrogels of varying stiffness showed different cell morphology and gene expression of stress fibers, which indicated varying biological effects caused by mechanical signal changes. Moreover, this established that varying the hydrogel stiffness resulted in an efficient in vitro system to manipulate mechanical signaling by altering gel stiffness and analyzing the molecular and genetic regulation in NCCs. O9-1 NCCs can differentiate into a wide range of cell types under the influence of the corresponding differentiation media, and it is convenient to manipulate chemical signals in vitro. Therefore, this in vitro system is a powerful tool to study the role of mechanical signaling in NCCs and its interaction with chemical signals, which will help researchers better understand the molecular and genetic mechanisms of neural crest development and diseases.

Introduction

Neural crest cells (NCCs) are a group of stem cells during vertebrate embryogenesis with a remarkable ability to migrate and contribute to the development of various organs and tissues. NCCs can differentiate into different cell types, including sensory neurons, cartilage, bone, melanocytes, and smooth muscle cells, depending on the location of axial origin and the local environmental guidance of the NCC1,2. With the ability to differentiate into a wide array of cell types, genetic abnormalities that cause dysregulation at any stage of neural crest (NC) development can lead to numerous congenital diseases2. For instance, perturbations during the formation, migration, and development of NCCs lead to developmental disorders known collectively as neurocristopathies1,3. These diseases range from craniofacial defects due to failure in NCC formation, such as Treacher Collins syndrome, to the development of various cancers due to NCC metastatic migratory ability, as seen in melanoma3,4,5,6. Over the last few decades, researchers have made remarkable discoveries about the roles and mechanisms of NCCs in development and diseases, with the majority of findings being focused on chemical signals7,8. More recently, mechanical signals have been indicated to play a critical but poorly understood role in NCC development9,10.

The environmental cues of NCCs play a critical role during their development, including the regulation of NCC differentiation into various cell types. Environmental cues, e.g., physical cues, influence pivotal behaviors and cellular responses, such as functional diversification. Mechanotransduction allows cells to sense and respond to those cues to maintain various biological processes2. NCCs are surrounded by neighboring cells and different substrates, such as the extracellular matrix (ECM), which can give rise to mechanical stimuli to maintain homeostasis and adapt to the changes through fate determination, proliferation, and apoptosis11. Mechanotransduction begins at the plasma membrane where the sensory component of mechanical extracellular stimuli occurs, resulting in the intracellular regulation of the cell12. Integrins, focal adhesions, and junctions of the plasma membrane relay mechanical signals, such as shearing forces, stress, and the stiffness of surrounding substrates, into chemical signals to produce cellular responses12. The relaying of chemical signals from the plasma membrane to the final cellular regulation is carried out via different signaling pathways to finalize vital processes for the organism, such as differentiation.

Several studies have suggested that mechanical signaling from substrate stiffness plays a role in cell differentiation13,14. For instance, previous studies have shown that mesenchymal stem cells (MSCs) grown on soft substrates with a stiffness similar to that of brain tissue (in the range of 0.1-1.0 kPa) resulted in neuronal cell differentiation15,16. However, more MSCs differentiate into myocyte-like cells when grown on 8-17 kPa substrates mimicking the stiffness of muscle, while osteoblast-like differentiation was observed when MSCs were cultured on stiff substrates (25-40 kPa)15,16. The significance of mechanotransduction is highlighted by the irregularities and abnormalities in the mechanical signaling pathway that potentially lead to severe developmental defects and diseases, including cancer, cardiovascular diseases, and osteoporosis17,18,19. In cancers, normal breast tissue is soft, and the risk of breast cancer increases in stiff and dense breast tissue, an environment that is more akin to breast tumors15. With this knowledge, the effects of mechanical signaling on NCC development can be studied through simple manipulation of substrate stiffness through an in vitro system, providing further advantages and possibilities in understanding the fundamentals of NC-related disease progression and etiology.

To study the impact of mechanical signals in NCCs, we established an efficient in vitro system for NCCs based on the optimization of previously published methods and evaluation of the responses of NCCs to different mechanical signals20,21. A detailed protocol was provided for varying hydrogel stiffness preparation and evaluation of the impact of mechanical signaling in NCCs. To achieve this, O9-1 NCCs are utilized as the NC model to study the effects and changes in response to stiff versus soft hydrogels. O9-1 NCCs are a stable NC cell line isolated from mouse embryo (E) at day 8.5. O9-1 NCCs mimic NCCs in vivo because they can differentiate into various NC-derived cell types in defined differentiation media22. To study the mechanical signaling of NCCs, a matrix substrate was fabricated with tunable elasticity from varying concentrations of acrylamide and bis-acrylamide solutions to achieve the desired stiffness, correlating to the biological substrate stiffness20,21,23. To optimize the conditions of matrix substrate for NCCs, specifically O9-1 cells, modifications were made from the previously published protocol20. One change made in this protocol was to incubate hydrogels in collagen I, diluted in 0.2% acetic acid instead of 50 mM HEPES, at 37 °C overnight. The low pH of acetic acid leads to a homogeneous distribution and higher collagen I incorporation, thus allowing for a more uniform attachment of the ECM protein24. In addition, a combination of horse serum and fetal bovine serum (FBS) was used at the concentrations of 10% and 5% in phosphate buffer saline (PBS), respectively, before storing the hydrogels in the incubator. Horse serum was used as an additional supplement to FBS due to its ability to promote cell proliferation and differentiation at the concentration of 10%25.

With this method, a biological environment was mimicked by the ECM protein coating (e.g., Collagen I) to create an accurate in vitro environment for NCCs to grow and survive20,21. The stiffness of the prepared hydrogels was quantitatively analyzed via atomic force microscopy (AFM), a well-known technique to depict the elastic modulus26. To study the effect of different stiffness levels on NCCs, wild-type O9-1 cells were cultured and prepared on hydrogels for immunofluorescence (IF) staining against filamentous actin (F-actin) to show the differences in cell adhesion and morphologies in response to changes in substrate stiffness. Utilizing this in vitro system, researchers will be able to study the roles of mechanical signaling in NCCs and its interaction with other chemical signals to gain a deeper understanding of the relationship between NCCs and mechanical signaling.

Access restricted. Please log in or start a trial to view this content.

Protocol

1. Hydrogel preparation

NOTE: All steps must be performed in a cell culture hood that has been disinfected with ethanol and ultraviolet (UV)-sterilized before use to maintain sterility. Tools, such as tweezers and pipettes, must be sprayed with ethanol. Buffer solutions must also be sterile-filtered.

  1. Preparation of aminosilane-coated glass coverslips
    1. Place the desired number of glass coverslips onto a piece of laboratory wipe.
      NOTE: Prepare an additional 3-4 coverslips to ensure sufficient backup supplies as they break easily. Different materials of glass coverslips will yield different compatibility of cell seeding and attachment. It is better to determine which type suits the experiment best before starting the experiments (see the Table of Materials).
    2. Use an alcohol burner or Bunsen burner to sterilize each coverslip by passing it back and forth through the flame (30 s for protein assay experiments). Place each glass coverslip on a laboratory wipe to cool down.
    3. Once the glass coverslips are cooled down, transfer them onto a Petri dish lined with parafilm to prevent slippage.
      NOTE: If the coverslips are not cool enough, the residual heat will melt the parafilm onto the slips, rendering them unusable.
    4. Cover the coverslips with approximately 200 μL and 800 μL of 0.1 M NaOH for a 12 mm and a 25 mm coverslip, respectively, and let them sit for 5 min. Then, aspirate the 0.1 M NaOH and allow the coverslips to air-dry for another 5 min to form an even film.
    5. Once the coverslips are dried, pipette approximately 80 μL and 150 μL of 3-aminopropyl triethoxysilane (APTS) for 12 mm and 25 mm coverslips, respectively. Be careful to avoid spilling the solution onto the parafilm. Allow the solution to sit for 5 min.
    6. Aspirate as much excess APTS as possible and allow the residual APTS to dry for 5 min. Rinse the coverslips well by submerging them in sterile, deionized (DI) H2O three times for 5 min each time.
      NOTE: If the glass coverslips are not rinsed well, the residual APTS causes unwanted reactions with glutaraldehyde, causing a white precipitate to form and resulting in unusable coverslips.
    7. Move the coverslips to a new Petri dish with the reactive side facing up. Add enough 0.5% glutaraldehyde to the Petri dish to cover the coverslips entirely and allow the coverslips to sit for 30 min.
    8. Aspirate the 0.5% glutaraldehyde and rinse the coverslips again in DI H2O one time for 3 min. Set the coverslips reactive side up on a laboratory wipe or a clean Petri dish to air-dry completely before using.
      NOTE: The protocol can be paused here; coverslips must be placed in sterile DI H2O until use.
  2. Preparation of siliconized coverslips
    1. Place the same number of coverslips as the aminosilane-coated coverslips (step 1.1.1) in a Petri dish lined with parafilm.
    2. Pipette 40 μL or 150 μL for 12 mm and 25 mm coverslips, respectively, of dichloromethylsilane (DCMS) to one side of the coverslip and allow the solution to sit for 5 min.
    3. Aspirate any remaining solution from the coverslip, wash in sterile DI H2O once for 1 min, and place the reactive coverslips face up on a laboratory wipe to air-dry completely before moving onto the next step.
  3. Preparing hydrogels
    1. Mix acrylamide, bis-acrylamide, and DI H2O in a 1.5 mL centrifuge tube to prepare 500 μL of solutions with varying stiffnesses (see Table 1). Vortex the solution for 30 s to mix it thoroughly.
    2. Working swiftly, add the 10% ammonium persulfate solution (APS) and tetramethylethylenediamine (TEMED) to the tube and vortex the solutions again to mix the solutions.
      NOTE: Prepare fresh 10% APS and leave it on ice or freeze into single-use aliquots due to its sensitive freeze/thaw cycle.
    3. Pipette approximately 33 μL or 100 μL of the solution onto the dried 12 mm or 25 mm aminosilane-coated coverslips (section 1.1), respectively.
    4. Using curved tweezers, immediately place the DCMS-treated coverslip on top of the gel solution with the treated side touching the gel solution, thus sandwiching the gel solution between the DCMS-treated coverslip and aminosilane-coated coverslip.
    5. Allow the gel solution to polymerize for 5-15 min, while actively monitoring for gel polymerization of the leftover solution in the tube.
    6. Once the gel is polymerized, separate the DCMS-treated coverslip with curved tweezers or a razor blade, leaving the gel attached to the original aminosilane-coated coverslip.
    7. Immediately place the coverslip with the attached hydrogel in a predetermined 4-well/24-well and 6-well plate covered with 500 µL and 2 mL of sterile PBS or DI H2O for 12 mm and 25 mm coverslips, respectively, to prevent the gel from drying out.
    8. Repeat steps 1.3.4-1.3.7 for all coverslips.
    9. Submerge the hydrogels in sterile PBS or DI H2O for 30 min to remove excess acrylamide solution. Store the hydrogels in sterile PBS or DI H2O at 4 °C for a procedural stop here.
    10. In a dark room, prepare the sulfosuccinimidyl 6-(4'-azido-2'-nitrophenylamino) hexanoate (sulfo-SANPAH) mixture by mixing 2.5 mL of 50 mM 2-[4-(2-hydroxyethyl) piperazin-1-yl] ethanesulfonic acid(HEPES) (pH=8.5) with 25 μL of the 50 μg/mL sulfo-SANPAH in a conical tube, wrapped in aluminum foil to protect from light. Use a pipette to mix the solution well before using.
      NOTE: A volume of 2.5 mL of sulfo-SANPAH solution is enough for approximately twenty-five 12 mm hydrogels or five 25 mm hydrogels.
    11. Aspirate PBS or DI H2O from the well plate. Add approximately 100 μL or 500 μL for 12 mm and 25 mm coverslips, respectively, of sulfo-SANPAH solution (step 1.3.10) to cover the gel. Ensure the solution covers the gel entirely.
      NOTE: Adjust the vacuum suction strength to prevent the strong force from ripping or disturbing the hydrogels.
    12. Place the gels with the solution under a 15 W, 365 nm UV light for 10 min, uncovered to minimize any interference of the UV light reacting with the sulfo-SANPAH.
    13. Aspirate the excess sulfo-SANPAH by tilting the plate to collect as much of the solution as possible. Wash the gel with 50 mM HEPES two to three times.
    14. Add 500 μL and 2 mL for 12 mm and 25 mm gels, respectively, of 50 mg/mL collagen I diluted in 0.2% acetic acid to each well containing the hydrogel. Allow the gels to incubate overnight in a 37 °C, 5% CO2 incubator.
      NOTE: Dilute collagen I in 0.2% acetic acid instead of 50 mM HEPES to promote homogenous distribution and attachment of collagen I.
    15. Aspirate the collagen I and wash the gels with sterile PBS three times to remove excess collagen I for 5 min each wash. Incubate the hydrogels in PBS with 10% horse serum, 5% FBS for 2 h in the 37 °C, 5% CO2 incubator.
      NOTE: The addition of 10% horse serum promotes higher proliferation compared to only using FBS as done in the previous publication.
    16. Aspirate the medium. Add 500 mL of sterile-filtered Dulbecco's Modified Eagle Medium (DMEM) with 10% FBS and 1% penicillin-streptomycin (P/S) to each well. Store the gels in the 37 °C, 5% CO2 incubator until ready for cell culture.
    17. Once ready, plate approximately 1.5 × 104 O9-1 cells/cm2 in basal medium in the culture dishes. Incubate the cells for 2 days in an incubator at 37 °C, 5% CO2. Check the cells for confluency to ensure that the cells are sufficiently attached to gels, and that the number of cells is enough before collecting for analysis.
      NOTE: See the previously published protocol for the steps of recovery, passage, and collection of O9-1 cells20.
    18. Proceed to sections 2, 3, or 4 for further analysis of the hydrogels.

2. Quantitative analysis of stiffness via AFM

  1. Start the AFM system computer, followed by the AFM controller (see the Table of Materials).
  2. Mount the AFM cantilever on the AFM probe holder. Use a spherical cantilever with a 0.5 μm silica bead mounted at the end of the cantilever (cantilever with spherical bead).
    NOTE: For stiffer hydrogels, such as 10 kPa, 20 kPa, and 40 kPa, a stiffer probe was used with the spring constant of 0.24 N/m. A softer probe was used for softer hydrogels, such as 0.5 kPa and 1 kPa, with a spring constant of 0.059 N/m.
  3. Set the AFM software under contact mode.
  4. Mount the silicon wafer onto the AFM sample stage to collect force curves by clicking on Engage for the cantilever to touch the silicon substrate, thus generating the force curves.
  5. Use the force curves above (2.4) for calibration, click on Calibrate in the controlling software to obtain an average spring constant of the cantilever under thermal tune condition, and save the calibrated values in the controlling software.
  6. Mount the samples by placing the coverslip with the attached hydrogel in a 60 mm Petri dish onto the AFM scanning stage. Add 3 mL of PBS into the dish before conducting measurements to prevent the gel from drying out.
  7. Set the AFM to work in contact mode (fluid) to start measurement. Engage the spherical bead to continuously touch and lift from the gel sample.
  8. Set the cantilever so that its deflection threshold remains at 10 nm. Keep the ramping size of the probe at 10 μm. Then, record the force curves as in step 2.4.
  9. Acquire at least 20 force curves from at least 3 to 10 different spots across the surface of the hydrogel.
  10. Calculate the average Young's modulus of ~20 force curves for each spot with AFM imaging and analysis software. Use extend ramp force curves and a linearized model (spherical). Calculate the average of all spots for each sample to yield the final stiffness.
    NOTE: Young's modulus and related data (i.e., standard deviations) are automatically saved as a spreadsheet.
  11. Repeat steps 2.6-2.10 for all samples.

3. Molecular analysis of stiffness via immunofluorescence staining

  1. Use tweezers to transport the coverslip to a new plate to minimize false signals from cells grown directly onto the plate. Wash the cells with 500 µL of sterile PBS three times to remove dead cells and any remaining culture medium.
  2. Fix the cells using 500 µL of 4% paraformaldehyde (PFA) for 10 min at room temperature, undisturbed. Then, rewash the cells three times using 500 µL of PBS/well for 2 min each.
    NOTE: Store at 4 °C for a procedural stop.
  3. Treat the cells with 500 µL of 0.1% Triton X-100 for 15 min at room temperature. Then, wash the cells three times with 500 µL of PBS/well.
  4. Block the cells with 250 µL of 10% donkey serum (diluted in PBS and 0.1% Tween 20) per well for 30 min at room temperature.
  5. Incubate the cells with 250 µL of primary antibodies for 2 h at room temperature or overnight at 4 °C. Then, wash the cells three times with 500 µL of PBS/well for 5 min each.
    NOTE: Anti-Vinculin (Vcl) (1:250) and anti-AP2 alpha (1:250) were used in this experiment and were diluted in 10% donkey serum.
  6. Incubate the cells with corresponding secondary antibodies and/or phalloidin used for F-actin staining at a dilution of 1:400 in 250 µL of 10% donkey serum for 30 min at room temperature. Then, wash the cells three times with PBS for 5 min each.
    NOTE: 568 nm Phalloidin can be co-incubated with 488 nm or 647 nm secondary antibodies or on its own.
  7. Incubate the cells with 4′,6-diamidino-2-phenylindole (DAPI, 1:1000 dilution) in 250 µL of PBS for 10 min followed by one last wash of PBS for 2 min.
  8. Add 3-4 drops of mounting medium to each well. Store the samples at 4 °C to set for at least 2 h before imaging to ensure the mounting medium has set properly.
  9. Capture images of at least 3 random frames per hydrogel sample with a fluorescence microscope, producing individual and merged channels.

4. Quantitative real-time PCR (RT-qPCR)

  1. Transfer the hydrogels with the adherent cells for RNA collection to a new plate to minimize unwanted RNA from cells attached to the cell plate. Wash the cells with PBS three times to remove dead cells and culture medium.
  2. Extract the total mRNA using an RNA extraction kit. Perform reverse-transcription of RNA to cDNA using a reverse transcription supermix following the manufacturer's instructions.
  3. Perform RT-qPCR with primers for Vcl as the stiffness marker of choice and analyze using the 2-ΔΔCT method.
    NOTE: Primer sequence of Vcl: Forward 5' GCTTCAGTCAGACCCATACTCG 3'; reverse 5' AGGTAAGCAGTAGGTCAGATGT 3'.

Access restricted. Please log in or start a trial to view this content.

Results

Hydrogel preparation and stiffness assessment through AFM and the Hertz model
Here, a detailed protocol is provided to generate polyacrylamide hydrogels of varying stiffness by regulating the ratio of acrylamide and bis-acrylamide. However, the polyacrylamide hydrogels are not ready for the adhesion of cells due to the lack of ECM proteins. Thus, sulfo-SANPAH, acting as a linker, covalently binds to the hydrogels and reacts with the primary amines of ECM proteins to allow the adhesion of ECM proteins...

Access restricted. Please log in or start a trial to view this content.

Discussion

The goal of the current study is to provide an effective and efficient in vitro system to better understand the impact of mechanical signals in NCCs. In addition to following the step-by-step protocol mentioned above, researchers need to keep in mind that the cell culture of O9-1 NCCs is affected by the type of glass coverslips used to prepare hydrogels. For instance, it was noted that cells seeded on a specific type of glass coverslip (see the Table of Materials) survived and proliferated ...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors have no conflicts of interest to disclose.

Acknowledgements

We thank Dr. Ana-Maria Zaske, operator of Atomic Force Microscope-UT Core facility at the University of Texas Health Sciences Center, for the contributed expertise in AFM in this project. We also thank the funding sources from the National Institutes of Health (K01DE026561, R03DE025873, R01DE029014, R56HL142704, and R01HL142704 to J. Wang).

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
12 mm #1 Corning 0211 Glass CoverslipChemglass Life SciencesCLS-1763-012
2% Bis-AcrylamideSigma AldrichM1533
24-well plateGreiner Bio-one662165
25 mm #1 Corning 0211 Glass CoverslipChemglass Life SciencesCLS-1763-025
3-aminopropyl triethoxysilane (APTS)Sigma AldrichA3648
4-well cell culture plateThermo Scientific179830
4% ParaformaldehydeSigma AldrichJ61899-AP
40% AcrylamideSigma AldrichA4058
50% glutaraldehydeSigma AldrichG7651
6-well cell culture plateGreiner Bio-one657160
AFM cantilever (spherical bead)Novascan
AFM softwareCatalyst NanoScopeModel: 8.15 SR3R1
Alexa Fluor 488 PhalloidinThermo FisherA12379
Ammonium Persulfate (APS)Sigma Aldrich248614Powder
anti-AP-2α AntibodySanta Cruzsc-12726
anti-Vinculin antibodyAbcamab129002
Atomic Force Microscopy (AFM) Bioscope CatalystBruker Corporation
Collagen type I (100mg)Corning354236
DAPI (4',6-Diamidino-2-Phenylindole, Dihydrochloride)Thermo FisherD1306
Dichloromethylsilane (DCMS)Sigma Aldrich440272
Donkey serumSigma AldrichD9663
Dulbecco's Modified Eagle Medium (DMEM)Corning10-017-CV
Fetal bovine serum (FBS)Corning35-010-CV
Fluorescence microscopeLeicaModel DMi8
Fluoromount-G mounting mediumSouthernBiotech0100-35
HEPESSigma AldrichH3375Powder
Horse serumCorning35-030-CI
iScript Reverse Transcription SupermixBio-Rad1708841
Penicillin-Streptomycin antibioticThermo Fisher15140148
RNeasy micro kitQiagen74004
Sterile 1x PBSHycloneSH30256.02
Sterile deionized waterHardy DiagnosticsU284
sulfo-SANPAHThermo Fisher22589
SYBR greenApplied Biosystems4472908
TEMEDSigma AldrichT9281
Triton X-100Sigma AldrichX100
Tween 20Sigma AldrichP9416

References

  1. Mehrotra, P., Tseropoulos, G., Bronner, M. E., Andreadis, S. T. Adult tissue-derived neural crest-like stem cells: Sources, regulatory networks, and translational potential. Stem Cells Translational Medicine. 9 (3), 328-341 (2020).
  2. Liu, J. A., Cheung, M. Neural crest stem cells and their potential therapeutic applications. Developmental Biology. 419 (2), 199-216 (2016).
  3. Watt, K. E. N., Trainor, P. A. Neurocristopathies: the etiology and pathogenesis of disorders arising from defects in neural crest cell development. Neural Crest Cells-Evolution, Development and Disease. Trainor, P. A. , Academic Press. 361-394 (2014).
  4. Lavelle, C. L. B. Applied oral physiology. , Butterworth-Heinemann. (1988).
  5. Chin, L. The genetics of malignant melanoma: lessons from mouse and man. Nature Reviews Cancer. 3 (8), 559-570 (2003).
  6. Hindley, C. J., et al. The Hippo pathway member YAP enhances human neural crest cell fate and migration. Scientific Reports. 6 (1), 1-9 (2016).
  7. Wang, Q., et al. Perturbed development of cranial neural crest cells in association with reduced sonic hedgehog signaling underlies the pathogenesis of retinoic-acid-induced cleft palate. Disease Models & Mechanisms. 12 (10), (2019).
  8. Rocha, M., Singh, N., Ahsan, K., Beiriger, A., Prince, V. E. Neural crest development: insights from the zebrafish. Developmental Dynamics. 249 (1), 88-111 (2020).
  9. Barriga, E. H., Franze, K., Charras, G., Mayor, R. Tissue stiffening coordinates morphogenesis by triggering collective cell migration in vivo. Nature. 554 (7693), 523-527 (2018).
  10. Weber, G. F., Bjerke, M. A., DeSimone, D. W. A mechanoresponsive cadherin-keratin complex directs polarized protrusive behavior and collective cell migration. Developmental Cell. 22 (1), 104-115 (2012).
  11. Mason, D. E., et al. YAP and TAZ limit cytoskeletal and focal adhesion maturation to enable persistent cell motility. Journal of Cell Biology. 218 (4), 1369-1389 (2019).
  12. Dupont, S., et al. Role of YAP/TAZ in mechanotransduction. Nature. 474 (7350), 179-183 (2011).
  13. Lu, Y. -B., et al. Viscoelastic properties of individual glial cells and neurons in the CNS. Proceedings of the National Academy of Sciences of the United States of America. 103 (47), 17759-17764 (2006).
  14. Georges, P. C., Miller, W. J., Meaney, D. F., Sawyer, E. S., Janmey, P. A. Matrices with compliance comparable to that of brain tissue select neuronal over glial growth in mixed cortical cultures. Biophysical Journal. 90 (8), 3012-3018 (2006).
  15. Janmey, P. A., Miller, R. T. Mechanisms of mechanical signaling in development and disease. Journal of Cell Science. 124 (1), 9-18 (2011).
  16. Engler, A., Sweeney, H., Discher, D., Schwarzbauer, J. E. Extracellular matrix elasticity directs stem cell differentiation. Journal of Musculoskeletal and Neuronal Interactions. 7 (4), 335(2007).
  17. Paszek, M. J., et al. Tensional homeostasis and the malignant phenotype. Cancer Cell. 8 (3), 241-254 (2005).
  18. Engler, A. J., et al. Embryonic cardiomyocytes beat best on a matrix with heart-like elasticity: scar-like rigidity inhibits beating. Journal of Cell Science. 121 (22), 3794-3802 (2008).
  19. Robling, A. G., Turner, C. H. Mechanical signaling for bone modeling and remodeling. Critical Reviews in Eukaryotic Gene Expression. 19 (4), 319-338 (2009).
  20. Tse, J. R., Engler, A. J. Preparation of hydrogel substrates with tunable mechanical properties. Current Protocols in Cell Biology. , Chapter 10, Unit 10.16 (2010).
  21. Cretu, A., Castagnino, P., Assoian, R. Studying the effects of matrix stiffness on cellular function using acrylamide-based hydrogels. Journal of Visualized Experiments: JoVE. (42), e2089(2010).
  22. Ishii, M., et al. A stable cranial neural crest cell line from mouse. Stem Cells and Development. 21 (17), 3069-3080 (2012).
  23. Engler, A., et al. Substrate compliance versus ligand density in cell on gel responses. Biophysical Journal. 86 (1), 617-628 (2004).
  24. Stanton, A. E., Tong, X., Yang, F. Varying solvent type modulates collagen coating and stem cell mechanotransduction on hydrogel substrates. APL Bioengineering. 3 (3), 036108(2019).
  25. Fedoroff, S., Hall, C. Effect of horse serum on neural cell differentiation in tissue culture. In vitro. 15 (8), 641-648 (1979).
  26. Huth, S., Sindt, S., Selhuber-Unkel, C. Automated analysis of soft hydrogel microindentation: Impact of various indentation parameters on the measurement of Young's modulus. PLoS One. 14 (8), 0220281(2019).
  27. Mitchell, P. J., Timmons, P. M., Hébert, J. M., Rigby, P., Tjian, R. Transcription factor AP-2 is expressed in neural crest cell lineages during mouse embryogenesis. Genes & Development. 5 (1), 105-119 (1991).
  28. Wegner, M. Neural crest diversification and specification: transcriptional control of Schwann Cell differentiation. Encyclopedia of Neuroscience. , 153-158 (2010).
  29. Park, J. S., et al. The effect of matrix stiffness on the differentiation of mesenchymal stem cells in response to TGF-β. Biomaterials. 32 (16), 3921-3930 (2011).
  30. Sun, M., et al. Effects of matrix stiffness on the morphology, adhesion, proliferation and osteogenic differentiation of mesenchymal stem cells. International Journal of Medical Sciences. 15 (3), 257(2018).
  31. Burridge, K., Guilluy, C. Focal adhesions, stress fibers and mechanical tension. Experimental Cell Research. 343 (1), 14-20 (2016).
  32. Burridge, K. Focal adhesions: a personal perspective on a half century of progress. The FEBS Journal. 284 (20), 3355-3361 (2017).
  33. Zhou, C., et al. Compliant substratum modulates vinculin expression in focal adhesion plaques in skeletal cells. International Journal of Oral Science. 11 (2), 1-9 (2019).
  34. Fernández, J. L. R., Geiger, B., Salomon, D., Ben-Ze'ev, A. Overexpression of vinculin suppresses cell motility in BALB/c 3T3 cells. Cell Motility and the Cytoskeleton. 22 (2), 127-134 (1992).
  35. Coll, J., et al. Targeted disruption of vinculin genes in F9 and embryonic stem cells changes cell morphology, adhesion, and locomotion. Proceedings of the National Academy of Sciences of the United States of America. 92 (20), 9161-9165 (1995).
  36. Saunders, R. M., et al. Role of vinculin in regulating focal adhesion turnover. European Journal of Cell Biology. 85 (6), 487-500 (2006).
  37. Kuo, J. -C. Focal adhesions function as a mechanosensor. Progress in Molecular Biology and Translational Science. 126, 55-73 (2014).
  38. Nguyen, B. H., Ishii, M., Maxson, R. E., Wang, J. Culturing and manipulation of O9-1 neural crest cells. Journal of Visualized Experiments: JoVE. (140), e58346(2018).
  39. Kolewe, K. W., Zhu, J., Mako, N. R., Nonnenmann, S. S., Schiffman, J. D. Bacterial adhesion is affected by the thickness and stiffness of poly (ethylene glycol) hydrogels. ACS Applied Materials & Interfaces. 10 (3), 2275-2281 (2018).
  40. Lin, Y. -C., et al. Mechanosensing of substrate thickness. Physical Review E. 82 (4), 041918(2010).
  41. Mullen, C. A., Vaughan, T. J., Billiar, K. L., McNamara, L. M. The effect of substrate stiffness, thickness, and cross-linking density on osteogenic cell behavior. Biophysical Journal. 108 (7), 1604-1612 (2015).
  42. Tusan, C. G., et al. Collective cell behavior in mechanosensing of substrate thickness. Biophysical Journal. 114 (11), 2743-2755 (2018).
  43. McBurney, M. W., Jones-Villeneuve, E. M., Edwards, M. K., Anderson, P. J. Control of muscle and neuronal differentiation in a cultured embryonal carcinoma cell line. Nature. 299 (5879), 165-167 (1982).
  44. Hasegawa, A., Shirayoshi, Y. P19 cells overexpressing Lhx1 differentiate into the definitive endoderm by recapitulating an embryonic developmental pathway. Yonago Acta Medica. 58 (1), 15(2015).
  45. Wells, R. G. Tissue mechanics and fibrosis. Biochimica et Biophysica Acta. 1832 (7), 884-890 (2013).
  46. Gavara, N. A beginner's guide to atomic force microscopy probing for cell mechanics. Microscopy Research and Technique. 80 (1), 75-84 (2017).
  47. Butler, J. P., Tolic-Nørrelykke, I. M., Fabry, B., Fredberg, J. J. Traction fields, moments, and strain energy that cells exert on their surroundings. American Journal of Physiology. Cell Physiology. 282 (3), 595-605 (2002).
  48. Leong, W. S., et al. Thickness sensing of hMSCs on collagen gel directs stem cell fate. Biochemical and Biophysical Research Communications. 401 (2), 287-292 (2010).
  49. Caliari, S. R., Burdick, J. A. A practical guide to hydrogels for cell culture. Nature Methods. 13 (5), 405-414 (2016).
  50. Funaki, M., Janmey, P. A. Technologies to engineer cell substrate mechanics in hydrogels. Biology and Engineering of Stem Cell Niches. , Academic Press. 363-373 (2017).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Tags

Hydrogel StiffnessMechanical SignalingO9 1 CellsPolyacrylamide HydrogelsAtomic Force MicroscopyCell DifferentiationImmunofluorescent StainingStress Fiber ExpressionFocal Adhesion

Related Articles