A Reporter Based Cellular Assay for Monitoring Splicing Efficiency

Summary

This protocol describes a minigene reporter assay to monitor the impact of 5´-splice site mutations on splicing and develops suppressor U1 snRNA for the rescue of mutation-induced splicing inhibition. The reporter and suppressor U1 snRNA constructs are expressed in HeLa cells, and splicing is analyzed by primer extension or RT-PCR.

Abstract

During gene expression, the vital step of pre-mRNA splicing involves accurate recognition of splice sites and efficient assembly of spliceosomal complexes to join exons and remove introns prior to cytoplasmic export of the mature mRNA. Splicing efficiency can be altered by the presence of mutations at splice sites, the influence of trans-acting splicing factors, or the activity of therapeutics. Here, we describe the protocol for a cellular assay that can be applied for monitoring the splicing efficiency of any given exon. The assay uses an adaptable plasmid encoded 3-exon/2-intron minigene reporter, which can be expressed in mammalian cells by transient transfection. Post-transfection, total cellular RNA is isolated, and the efficiency of exon splicing in the reporter mRNA is determined by either primer extension or semi-quantitative reverse transcriptase-polymerase chain reaction (RT-PCR). We describe how the impact of disease associated 5′ splice-site mutations can be determined by introducing them in the reporter; and how the suppression of these mutations can be achieved by co-transfection with U1 small nuclear RNA (snRNA) construct carrying compensatory mutations in its 5′ region that basepairs with the 5′-splice sites at exon-intron junctions in pre-mRNAs. Thus, the reporter can be used for the design of therapeutic U1 particles to improve recognition of mutant 5′ splice-sites. Insertion of cis-acting regulatory sites, such as splicing enhancer or silencer sequences, into the reporter can also be used to examine the role of U1 snRNP in regulation mediated by a specific alternative splicing factor. Finally, reporter expressing cells can be incubated with small molecules to determine the effect of potential therapeutics on constitutive pre-mRNA splicing or on exons carrying mutant 5′ splice sites. Overall, the reporter assay can be applied to monitor splicing efficiency in a variety of conditions to study fundamental splicing mechanisms and splicing-associated diseases.

Introduction

Pre-mRNA splicing is an essential processing step that removes non-coding introns and precisely ligates coding exons to form mature mRNA. Recognition of consensus sequences at exon-intron junctions, referred to as 5′-splice site and 3′-splice site, by components of the splicing machinery initiates the splicing process. The U1 small nuclear ribonucleoprotein (snRNP) recognizes the 5′-splice site by base pairing of the U1 snRNA to the pre-mRNA¹. Genetically inherited mutations that alter 5′-splice site sequences are associated with many diseases^2,3. It is predicted that the loss of basepairing of U1 snRNA with the mutant 5′-splice sites causes aberrant splicing, which can compromise translation of the affected transcript. A potential therapeutic approach to correct the splicing defects involves suppression of mutations by modified U1 snRNA carrying compensatory nucleotide changes in its 5′-region that basepairs with the 5′-splice site. Such modified U1 snRNAs, also referred to as exon specific U1 snRNAs, have been found to be effective in reversing splicing defects, resulting in increased protein expression from the rescued mRNA^4,5,6,7,8.

Here, we describe the U1 snRNP complementation assay, a reporter-based cellular splicing assay that allows assessment of the effect of 5′-ss mutations on splicing of an exon and can also be used for the development of modified U1 snRNAs to enable the rescue of exon inclusion. We also provide protocols for monitoring of the spliced reporter transcripts by primer extension and RT-PCR, and for determining the expression of modified U1 snRNAs by primer extension and RT-qPCR.

Protocol

1. Reagents and buffers

NOTE: All sterilization using vacuum filters should be performed with 0.2 µm polyethersulfone (PES) membrane in a biosafety cabinet.

1. Prepare RNase-free water by adding 1.0 mL of diethylpyrocarbonate (DEPC) to 1.0 L of deionized water, mix for at least 1 hr at room temperature (RT), autoclave twice, and then cool to RT before use.
2. Prepare Dulbecco's Modified Eagle Medium (DMEM) by mixing one packet of DMEM powder (13.4 g), 3.7 g of sodium bicarbonate, 100 mL of fetal bovine serum (FBS), penicillin, and streptomycin to ~800 mL of sterile deionized water. The final concentration of penicillin and streptomycin in DMEM should be 50 U/mL and 50 µg/mL, respectively. Adjust the pH to 7.4 and then make up the volume to 1.0 L with sterile deionized water. Sterilize by filtration and store at 4 °C.
3. Prepare 10x phosphate buffered saline (10x PBS) by adding 25.6 g of disodium hydrogen heptahydrate (Na₂HPO₄·7H₂O), 2 g of potassium dihydrogen phosphate (KH₂PO₄), 2 g of potassium chloride (KCl), and 80 g of sodium chloride (NaCl) to 800 mL of deionized water. Mix to dissolve and make up the volume to 1.0 L. Sterilize by filtration and store at 4 °C.
4. Prepare 0.5 M ethylene diamine tetra-acetic acid (EDTA) by dissolving 186.1 g of Na₂•EDTA•2H₂O into ~800 mL of deionized water. Adjust pH to 8.0 and then make up the volume to 1.0 L with sterile deionized water. Sterilize by filtration and store at 4 °C.
5. Prepare 1x trypsin-EDTA solution by mixing 100 mL of 10x trypsin (2.5%), 2 mL of 0.5 M EDTA, and add 1x PBS up to 1.0 L. Sterilize by filtration and aliquot into 50 mL conical tubes. Store at 4 °C for 1-2 weeks or freeze at -20 °C for long-term use.
6. Prepare 2x formamide DNA/RNA loading dye by mixing 14.4 mL of formamide and 0.6 mL of 0.5 M EDTA for a final volume of 15 mL. Add bromophenol blue and xylene cyanol powder to a final concentration of 0.02% and store at 4 °C.
   NOTE: Formamide is toxic and corrosive. Read the material safety data sheets for additional safety recommendations.
7. Prepare 5x Tris/Borate/EDTA (5x TBE) buffer by mixing 54.0 g of tris base, 27.5 g of boric acid, and 20 mL of 0.5 M EDTA into ~800 mL of deionized water. Mix to dissolve and make up the volume to 1.0 L with deionized water.
8. Prepare urea-polyacrylamide gel electrophoresis (urea-PAGE) solution by mixing 200 mL of 5x TBE, 250 mL of 40% 19:1 bis/acrylamide, and 450.5 g of urea. Then add deionized water up to 1.0 L. Mix until the ingredients are completely dissolved, then sterilize by filtration, and store at 4 °C in an amber glass bottle.
   NOTE: Bis/acrylamide is toxic. Read the material safety data sheets for additional safety procedures.
9. Prepare 10% ammonium persulfate (APS) by dissolving 1 g of APS in 10 mL of deionized water and store at 4 °C.

2. Cotransfection of HeLa cells with the reporter and U1 snRNA plasmids

NOTE: The transfection of Hela cells must be performed under sterile conditions in a biological safety cabinet. The outer surface of all materials must be sprayed with 70% ethanol before being introduced into the biological safety cabinet.

1. Maintain Hela cells in DMEM in a 37 °C incubator with 5% CO₂ by passaging every 2-3 days when the cells are about 80-90% confluent.
2. For passaging HeLa cells, aspirate the spent medium and then incubate cells with 3 mL of 0.25% trypsin containing 1 mM EDTA at 37 °C for 3 min.
3. After incubation, add 7 mL of fresh DMEM. Transfer the cell suspension to a 10 mL tube, centrifuge at 1,000 x g for 5 min.
4. Resuspend the cell pellet in 10 mL of fresh DMEM, and then plate the cells on a new tissue culture dish at 20% confluence.
5. For transient transfections, count Hela cells with a clean hemocytometer slide and prepare a suspension with a density of 2.5 x 10⁵ cells/mL.
6. Seed 1.0 mL of 2.5 x 10⁵ cells/mL Hela cell suspension into each well of a 12-well plate and incubate overnight at 37 °C.
7. The next day, aspirate the spent medium and add 0.8 mL of fresh DMEM with serum.
8. Prepare Solution I by adding 0.2 µg of Dup51 or Dup51p reporter plasmid, 1.8 µg of pcDNA, pNS6U1, or pNS6U1-5a plasmid, and 100 µL of transfection medium into a new 1.5 mL microcentrifuge tube.
9. Prepare a master mix of Solution II for all samples to be transfected by adding 100 µL of transfection medium and 4.0 µL of transfection reagent per sample.
10. Prepare the transfection mix by adding 100 µL of Solution II into each microcentrifuge tube containing Solution I.
11. Vortex the transfection mixes for 15 s, centrifuge in a tabletop microcentrifuge at 3,000 x g for 10 s at RT, and then incubate at RT for 5 min.
12. Add all 200 µL of the transfection mix into one well of the 12-well HeLa cell plate to achieve a final volume of 1.0 mL per well and incubate the plate at 37 °C for 48 hrs.
13. After incubation, extract RNA from the transfected HeLa cells with commercially available guanidine thiocyanate and phenol solution.
    NOTE: This reagent contains phenol and this step should be performed in a fume hood. The use of DEPC treated water is recommended for resuspension of extracted RNA.
    1. Aspirate the spent medium and add 500 µL of the reagent into each well. Incubate at RT for 5 min.
    2. Homogenize by pipetting up and down. Then transfer the solution to a new 1.5 mL microcentrifuge tube.
    3. Add 100 µL of chloroform and vortex for 15 s.
    4. Centrifuge at 12,000 x g for 15 min at RT.
    5. Transfer 200 µL of the RNA containing, top aqueous layer to a new 1.5 mL microcentrifuge tube.
    6. Add 2 µg of glycogen and 200 µL of isopropanol to each RNA sample. Mix by inverting the tubes.
    7. Collect the RNA precipitate by centrifugation at 12,000 x g for 10 min at 4 °C.
    8. Remove and discard the supernatant without disturbing the RNA pellet.
    9. Wash the pellet twice by adding 1.0 mL of 70% ethanol, inverting the tubes, and centrifuging as described in Step 2.13.7.
    10. Air dry the pellet for ~10-20 min at RT and resuspend the RNA in 10-20 µL of RNase-free water.
    11. Determine RNA concentration by measuring absorbance at 260 nm as described by Desjardins and Conklin⁹.
14. Proceed with primer extension or store RNA samples in -20 °C. Isolated RNA can be stored at -20 °C for 6-12 months.

3. ³²P-labeling of oligonucleotides

NOTE: Steps involving the use of ³²P-ATP and ³²P-labeled oligonucleotides must be performed behind an acrylic shield by trained individuals with approval from authorized institutional entities. The protocol described below can be used for labeling of oligonucleotides, Dup3r and U1_7-26-R, and markers for urea-PAGE. Use of DEPC treated water is recommended for resuspension of oligonucleotides and size exclusion beads.

1. To a 1.5 mL microcentrifuge tube, add oligonucleotide, T4 polynucleotide kinase (T4 PNK), T4 PNK buffer, and ³²P-ATP as described in Table 1. Add ³²P-ATP last to the mixture; this is important.
   NOTE: For the addition of radioactive solutions, use of filter tips is recommended.
2. Incubate in a water bath at 37 °C for 30 min.
3. While the labeling reactions are incubating, resuspend the size exclusion beads with a 25 kDa molecular weight cut off by gently vortexing for ~10 s.
   NOTE: The size exclusion beads should be prepared according to the manufacturer's instructions and stored as a 50% suspension in 25% ethanol at 4 °C.
4. Prepare columns by transferring 600 μL of the resuspended beads to a disposable mini column placed in a 1.5 mL collection tube and returning the bead stock to 4 °C.
5. Centrifuge at 2,000 x g for 1 min at RT and discard the flow through.
6. Wash the beads by adding 300 µL of RNase-free water to the column.
7. Repeat steps 3.5. and 3.6. twice and transfer the mini-column to a new 1.5 mL centrifuge tube.
8. Add the kinase reaction mix to the size-exclusion bead column and centrifuge at 5000 x g for 1 min at RT.
9. Collect and save the flow through, which has the ³²P-labeled oligonucleotide, and discard all tips and tubes into an acrylic waste box.
10. Add 20 µL of RNase-free water to dilute ³²P-labeled oligonucleotide to a final concentration of 2.5 µM.
    NOTE: Dilute the labeled markers as needed for loading on urea-PAGE gels.
11. Store the labeled oligonucleotide in an acrylic microtube box at -20 °C or proceed with primer extension analysis.

4. Analysis of the spliced reporter transcripts by primer extension

NOTE: It is recommended to clean surfaces and equipment with an RNase inactivating reagent before use.

1. Add 2.0 µg of RNA extracted from the Hela cells into separate 200 μL microcentrifuge tubes and add RNase-free water to make up the volume to 6.55 µL.
2. Prepare Master Mix I with the diluted ³²P-Dup3r and dNTPs as shown in Table 2 and add 0.9 µL of the mix to each PCR tube containing RNA samples.
3. Incubate the tubes, first at 65 °C for 5 min and then on ice for 1 min.
4. Prepare Master Mix II with 5x First Strand Buffer, dithiothreitol (DTT), RNase inhibitor, and reverse transcriptase as shown in Table 2.
5. Add 2.55 µL of the mix to each tube containing RNA and Master Mix 1; the total volume of the reaction should be 10 µL. Keep the tubes at RT for 10 min.
6. Transfer the tubes to a dry bath or a thermal cycler and incubate, first at 50 °C for 60 min and then at 70 °C for 15 min.
7. After incubation, add 10 µL of 2x formamide RNA loading dye to each sample and store in an acrylic box at -20 °C or proceed with the separation of fragments by urea-PAGE using a 14-cm long gel and visualization of gel image as described below in Step 8.
8. Perform densitometric scanning of the gel image with an image analysis software and use the band intensities of included and skipped products to calculate the percentage of exon 2 inclusion as shown below.
   

5. Analysis of the spliced reporter transcripts by fluorescent RT-PCR

NOTE: The RT-PCR analysis described below uses random hexamers for cDNA synthesis and a combination of unlabeled Dup8f and Cy5-labeled Dup3r oligonucleotides for PCR amplification of the spliced products.

1. For cDNA synthesis, add 2.0 µg of RNA extracted from the transfected Hela cells into separate 200 μL microcentrifuge tubes and add RNase-free water to make up the volume to 11.0 µL.
2. Prepare Master Mix I, containing random hexamers and dNTP as shown in Table 3 and add 2.0 μL of the mix to each sample. Incubate, first at 65 °C for 5 min then on ice for 1 min.
3. Prepare Master Mix II, containing First Strand Buffer, RNase inhibitor, DTT, and reverse transcriptase as shown in Table 3 and add 7.0 μL of the mix to each tube containing RNA and Master Mix I.
4. Keep the tubes at RT for 10 min, and then incubate at 50 °C for 60 min and 70 °C for 15 min.
   NOTE: Completed cDNA reactions may be stored at -20 °C.
5. For PCR, transfer 1.0 μL (100 ng/μL) of each cDNA sample to new PCR tubes.
6. Prepare a master mix consisting of Dup8f, Cy5-Dup3r, dNTPs, Taq buffer, Taq polymerase, and water as described in Table 4 and add 11.5 μL of the mix to each tube containing cDNA.
7. Perform PCR using a thermal cycler with an initial denaturation step at 94 °C for 3 min; followed by 20 cycles of denaturation (94 °C for 30 s), annealing (65 °C for 30 s), and extension (72 °C for 15 s), and a termination step at 72 °C for 5 min.
8. Add 12.5 µL of 2x formamide DNA loading dye to each tube and heat at 95 °C for 5 min.
9. Store the PCR reaction at -20 °C or proceed with urea-PAGE as described below in Step 8.1-8.4.
10. After electrophoresis, remove the glass plates from the electrophoresis apparatus and scan using a fluorescence imager to visualize the gel.
11. Perform densitometric scanning of the gel image and use band intensity of the included and the skipped products to calculate percentage of exon 2 inclusion as described in Step 4.8.

6. Analysis of variant U1 snRNA expression by primer extension

1. Add 2.0 µg of RNA extracted from the Hela cells into separate 200 μL microcentrifuge tubes and add RNase-free water to make up the volume to 4.325 µL and then add dATP, as shown in Table 5.
2. Add 10,000 CPM of the ³²P-U1_7-26-R oligonucleotide to each tube.
   NOTE: To prepare a 10,000 cpm/μL solution of ³²P-U1_7-26-R (from Step 3), dilute the labeled oligonucleotide (1:20 dilution), determine cpm in 1.0 μL using a scintillation counter, and further dilute with deionized water to prepare a solution of 10,000 cpm/μL in a new 1.5 mL microcentrifuge tube.
3. Incubate at 65 °C for 5 min, and then on ice for 1 min.
4. Prepare a master mix with 5x First Strand Buffer, RNase inhibitor, DTT, and reverse transcriptase as shown in Table 5 and add 1.8 µL of the mix to each sample.
5. Incubate, first at RT for 10 min and then at 42 °C for 10 min.
6. After incubation, add 10 µL of 2x formamide RNA loading dye into each sample and store in an acrylic box at -20 °C or proceed with separation of fragments by urea-PAGE using a 38-cm long gel (see Step 8).

7. Analysis of variant U1 snRNA expression by RT-qPCR

1. Dilute the cDNA stock prepared as described above in Steps 5.1 - 5.4 to a concentration of 0.2 ng/µL.
2. Pipette 5.0 µL of diluted cDNA into individual wells of a 96-well qPCR plate in triplicate. Add deionized water instead of cDNA for no-template control (NTC).
3. Prepare two separate primer mixes consisting of the forward and reverse primers for U1 and U2 snRNAs, and water as shown in Table 6.
   NOTE: Sequences for U1 and U2 snRNA specific primers are provided in Table 7.
4. Add 5.0 µL of the U1 and U2 snRNA primer mix to the sample and NTC wells.
5. Add 10.0 µL of real-time PCR mix to each well.
6. Seal the plates with an optical film, then centrifuge at 1,000 x g for 2 min at RT to collect the reactions to the bottom of the wells.
7. Perform qPCR with an initial denaturation step at 95 °C for 10 min, followed by 40 cycles of a 2-step protocol consisting of denaturation (95 °C for 15 s) and annealing/extension (62 °C for 60 s) while collecting the threshold quantification cycle (Cq) values of target amplicons.
8. Finish the qPCR reaction by checking for a single peak in the dissociation curve for U1 and U2 snRNA reactions.
9. From the Cq values, calculate delta Cq (ΔCq) for U1 and U2 snRNAs as compared to the pcDNA control.
10. Determine variant U1 snRNA expression as relative quantity (RQ) of U1 as compared to U2 using the ΔΔCq value as shown below for all samples.
    
    
    

8. Setup and running of Urea-PAGE gels

NOTE: Assembly of glass plates and the gel running apparatus should be performed according to manufacturer's instructions. The casting of the 10% urea-PAGE gel can be performed according to a previously described protocol by Summer et al.¹⁰. Steps involving the preparation of markers and samples, and of running and visualization of gels are described below. Optionally, to prevent the gel from sticking to glass plates, the inner surface may be coated with silicone solution by adding 1 mL of the solution onto the surface and evenly spreading over the entire surface with tissue. Once dry, the plates should be washed with deionized water and dried again.

CAUTION: Unpolymerized acrylamide is neurotoxic and must be handled with protections recommended in the material safety data sheet.

1. Prepare the primer extension samples and markers by heating at 95 °C for 5 min and then centrifuging in a tabletop microcentrifuge at 3,000 x g for 5 s at RT.
2. Prior to loading the markers and samples, flush out the wells with 1x TBE buffer to remove the settled urea.
3. Load 10 μL/sample/well and run the gel at 300-500V for 2-3 hrs or until the xylene cyanol reaches the bottom.
   NOTE: About 1,000 cpm of the ³²P-labeled marker can be loaded.
4. After electrophoresis, remove the glass plates from the electrophoresis apparatus.
5. Carefully separate the two plates so that the gel lays flat on either glass surface and transfer the gel onto a filter paper and cover it with plastic wrap.
6. Vacuum dry the gel on the filter paper at 80 °C for 30 min using a gel dryer.
7. Place the dried gel in a phosphor imaging cassette and keep at RT overnight.
   NOTE: The phosphor screen should be erased using a light box prior to use.
8. To visualize the gel image, remove the screen and scan using a phosphor imager.

Representative Results

The splicing reporter Dup51, a three exon-two intron minigene, was derived from the human β-globin gene and has been described previously (Figure 1A)^11,12 . We created a mutant reporter, Dup51p, by introducing Usher syndrome associated 5´-splice site mutations that occur in exon 3 of the protocadherin 15 (PCDH15) gene¹³. The 5´-splice site sequence at the exon 2-intron 2 junction was changed from CAG/GUUGGUAUC to AUG/GUGUGUAUC (/ is the exon-intron boundary) (Figure 1B)¹⁴. These sequence changes alter the predicted pattern of 5´-splice site basepairing with the endogenous U1 snRNA and also result in skipping of exon 2 in the mature transcript (Figure 2). The effect of these mutations could be suppressed by a compensatory change in the 5´-region of the U1 snRNA. Substitution of the uracil with adenine at the 5^th position of the U1 snRNA (U1-5a) reversed the effect of 5´-splice site mutations in Dup51p (Figure 1B).

The splicing of the Dup51 and Dup51p transcripts can be monitored by primer extension using ³²P-Dup3r or by semi quantitative RT-PCR using Dup8f and Dup3r oligonucleotides (Figure 1); sequences are provided in Table 7. When expressed in HeLa cells, the Dup51 minigene expresses the mature full-length transcript in which exon 2 is spliced-in efficiently (Figure 2A,B, lane 1). The 5´-splice site mutations in Dup51p reduce exon 2 inclusion from ~95% to ~30%, leading to the formation of the shorter transcript (lane 5). Coexpression of Dup51p with U1-5a snRNA rescues exon 2 splicing and restores formation of full-length transcript (lane 8). Coexpression with wildtype U1 (U1-WT) or U1-5g variant does not have a similar effect on Dup51p splicing (lanes 6 and 7). U1-WT, U1-5g, or U1-5a coexpression also does not alter the splicing pattern of the Dup51 reporter (lanes 2-4). Overall, these results indicate that the rescue of exon 2 splicing in Dup51p transcripts is specifically due to the U>A mutation in the U1-5a snRNA.

To monitor the expression of transfected U1 snRNAs, primer extension or RT-qPCR can be applied. Detection of U1-5a variant transcripts by primer extension uses the U1_7-26 oligonucleotide, which is 20 nucleotides long and basepairs near the adenine at the 5^th position of U1 snRNA (Figure 3A). In the presence of dATP alone, U1_7-26 allows incorporation of 2-3 nucleotides for the endogenous wildtype U1 snRNA yielding 22 or 23 nucleotides long product (Figure 3B, lanes 1, 2, 5, and 6). For the U1-5a and U1-5g variants, extension terminates after addition of a single adenosine producing a 21 nucleotides long product (lanes 3, 4, 7, and 8). Analysis by RT-qPCR allows estimation of fold increase in expression of the variant U1 over the endogenous wildtype snRNA. Here, U1 specific primer pairs are designed so that no overlap exists with the mutations introduced into the variant snRNAs (Figure 3A). After normalization to U2 snRNA expression, the transfected U1-WT, and the U1-5g and U1-5a variants were found to be expressed at 3-5 folds over the endogenous snRNA (Figure 3C). Endogenous U1 is estimated to be present at 10⁶ copies per cell in HeLa cells¹⁵. Thus, the exogenous variant snRNAs are expressed at ~3-5 fold over the endogenous U1. The ability of the U1-5a snRNA to rescue exon 2 inclusion to ~95% demonstrates that levels of the exogenous variant snRNAs are sufficient for the splicing of the nascent reporter transcripts.

Ingredients	Amount for One Reaction
PNK Buffer (10x)	2.0 µL
T4 Polynucleotide Kinase (T4 PNK) (10,000 U/mL)	1.0 µL
Oligonucleotide* (10 µM)	10.0 µL
32P-ATP (10 mM)	1.0 µL
H2O (DEPC treated)	6.0 μL
*For labeling markers, 0.5 µL of the pBR322 DNA-MspI Digest or the Low Molecular Weight Marker is used.

Table 1: ³²P-labeling of oligonucleotides. Reaction for preparation of a 5′-³²P-labeled primer using ³²P-ATP.

Ingredients - Master Mix I	Amount for One Reaction
RNA and H2O (DEPC treated)	6.55 µL
32P-Dup3r (2.5 µM)	0.4 µL
dNTP (10 mM)	0.5 µL
Ingredients – Master Mix II	Amount for One Reaction
First-Strand Buffer (5x)	2.00 µL
RNase Inhibitor (40 U/µL)	0.25 µL
DTT (0.1 M)	0.05 µL
Reverse Transcriptase (RT) (200U/µL)	0.25 µL

Table 2: ³²P-Dup3r primer extension. Reaction for the analysis of spliced reporter transcripts by primer extension.

Ingredients - Master Mix I	Amount for One Reaction
RNA and ddH2O (DEPC treated)	11.0 µL
Random Hexamer (50 ng/µL)	1.0 µL
dNTP (10 mM)	1.0 µL
Ingredients – Master Mix II	Amount for One Reaction
First-Strand Buffer (5x)	4.0 µL
RNase Inhibitor (40 U/µL)	1.0 µL
DTT (0.1 M)	1.0 µL
Reverse Transcriptase (RT) (200U/µL)	1.0 µL

Table 3: cDNA Synthesis. Reaction for the synthesis of cDNA from total RNA.

Ingredients	Amount for One Reaction
cDNA Template (100 ng/µL)	1.00 µL
Forward Primer (Dup8f) (10 µM)	0.25 µL
Cy5 Reverse Primer (Cy5-Dup3r) (10 µM)	0.25 µL
dNTP (10 µM)	0.25 µL
Taq Buffer (10x)	1.25 µL
Taq DNA Polymerase (5000 U/mL)	0.25 µL
H2O (DEPC treated)	9.25 µL

Table 4: Fluorescent RT-PCR. Reaction for the analysis of the spliced reporter transcripts by RT-PCR using Cy5-labeled primer.

Ingredients	Amount for One Reaction
RNA and H2O (DEPC treated)	4.325 µL
dATP (10 mM)	0.375 µL
32P-U17-26-R oligo nucleotide*	1.000 µL
Ingredients – Master Mix	Amount for One Reaction
First-Strand Buffer (5x)	1.5 µL
RNase Inhibitor (40 U/µL)	0.1 µL
DTT (0.1 M)	0.1 µL
Reverse Transcriptase (RT) (200U/µL)	0.1 µL
*10,000 CPM of the 32P-U17-26-R oligonucleotide should be added to the diluted RNA (Step 6.2.).

Table 5: ³²P-U1-snRNA primer extension. Reaction for the analysis of variant U1 snRNA expression by primer extension.

Ingredients	Amount for One Reaction
Real Time PCR Mix	10.0 µL
cDNA (0.2 ng/µL)	5.0 µL
Forward Primer (10 µM)	0.2 µL
Reverse Primer (10 µM)	0.2 µL
H2O (DEPC treated)	4.6 µL

Table 6: Quantitative RT-qPCR. Reactions for quantitative analysis of variant U1 snRNA expression by RT-qPCR.

Oligo Name	Sequence (5′ to 3′)	Technique
Dup8f	GACACCATGCATGGTGCACC	Fluorescent RT-PCR
Cy5-Dup3r	/5Cy5/AACAGCATCAGGAGTGGACAGATCCC	Fluorescent RT-PCR
Dup3r	AACAGCATCAGGAGTGGACAGATCCC	Primer Extension
U17-26R	TGGTATCTCCCCTGCCAGGT	Primer Extension
U1/17-39F	GGAGATACCATGATCACGAAGG	RT-qPCR
U1/58-80R	CATCCGGAGTGCAATGGATAAG	RT-qPCR
U2/8-19F	CTCGGCCTTTTGGCTAAGATCA	RT-qPCR
U2/62-84R	TCCTCGGATAGAGGACGTATCA	RT-qPCR

Table 7: Sequence of oligonucleotides primers. List of primer names, sequences, and the technique the primers were used for.

Figure 1: Dup51 and Dup51p Minigene Reporters. (A) Schematic representation of the three-exon/two-intron minigene reporters, Dup51 and Dup51p. Locations of the Dup8f and Dup3r in exons 1 and 3, respectively, are indicated. (B) Predicted basepairing of the wildtype U1 snRNA and the U1-5a variant with the 5'-splice site sequences of Dup51 and Dup51p reporter transcripts. Please click here to view a larger version of this figure.

Figure 2: Analysis of Spliced Reporter Transcripts. HeLa cells were cotransfected with the Dup51 or Dup51p minigene plasmids and pcDNA control or pNS6U1 plasmids for U1-WT, U1-5g, or U1-5a snRNAs. (A) Primer extension analysis with ³²P-labeled Dup3r primer demonstrating the splicing of the Dup51 and Dup51p minigene transcripts. The mRNA products are indicated to the left of the gel image. The percentage of the full-length product (± s.d., n = 3) was calculated from band intensities of the two mRNA isoforms and is represented in the graphs below. (B) RT-PCR analysis with Dup8f and Cy5-Dup3r primers on cDNA prepared from total RNA extracted from HeLa cells demonstrating splicing of the Dup51 or Dup51p minigene transcripts. The mRNA products are indicated to the left of the gel image. The percentage of the full-length product (± s.d., n = 3) was calculated from band intensities of the two mRNA isoforms and is represented in the graphs below. Please click here to view a larger version of this figure.

Figure 3: Analysis of the variant U1-5a snRNA. HeLa cells were cotransfected with the Dup51 or Dup51p minigene plasmids and pcDNA control or pNS6U1 plasmids for U1-WT, U1-5g, or U1-5a snRNAs. (A) A two-dimensional representation of the U1 snRNA sequence. Position of the U1_7-26R primer, used for primer extension analysis of U1 snRNA, is indicated by the red line. Position of U1/_17-39F and U1/_58-80R primers, used for RT-qPCR of U1 snRNA, is indicated by the blue lines.(B) Primer extension analysis with ³²P-labeled U1_7-26 to detect the expression of the wildtype U1 snRNA, and the U1-5g and U1-5a variants. Positions of the products formed from U1-WT and the variants snRNAs are indicated. (C) RT-qPCR analysis of the levels of U1 snRNA expression in Hela cells. The fold change in U1-snRNA expression was calculated relative to the pcDNA negative control and normalized to U2-snRNA, fold change (± s.d.; n = 3) in U1 is graphed. Please click here to view a larger version of this figure.

Discussion

The assay can be adapted for splicing analysis in cell lines other than HeLa, however, factors affecting transfection efficiency, such as cell confluency and quantity of DNA may need to be optimized. The reporter to U1 construct ratio is another critical parameter that may need to be determined depending upon the expression levels observed in other cell types. The quality of extracted RNA is critical for splicing analysis; therefore, the use of RNase-free water and decontamination of surfaces with RNase inactivating agents is highly recommended.

Analysis of reporter transcripts by either primer extension or fluorescent RT-PCR yield similar results, hence either technique can be employed for monitoring changes in the inclusion of exon 2 in the mature transcript. The fluorescent PCR reaction must be stopped and quantified in the exponential phase of amplification, which is dependent on the initial RNA concentration. Thus, the number of amplification cycles may have to be determined for assays with different transfections conditions than those described here. The ease of use due to the non-radioactive nature is an advantage of the RT-PCR assay. Although primer extension with radioactively labeled primer requires extra safety precautions, it can detect signals from a low amount of RNA. The low throughput of primer extension and RT-PCR is a limitation of this assay.

The U1 snRNP complementation assay has been employed for multiple purposes. In addition to reversing the effects of 5´-splice site mutations, U1 snRNAs carrying changes to the 5´-region have been applied for gene silencing and for studying splicing mechanisms. Fortes et al. showed that targeting U1 snRNAs to terminal exons of endogenous transcripts can efficiently inhibit gene expression¹⁶. Roca et al. used the U1 complementation to study the noncanonical mechanisms of 5'-splice site recognition and showed that the U1 snRNA can basepair to 5´-splice sites in an alternate register where basepairing is shifted by one nucleotide and also in "bulge registers" where bulged nucleotides are present in either the pre-mRNA or the snRNA^17,18. This reporter system can potentially be used to study the role of U1 snRNP in splicing modulation by small molecules and splicing regulatory proteins. By substituting exon 2 of Dup51p with a target exon, the assay can be applied for examining the mechanism of action of small molecules that are known to enhance or repress splicing of specific exons, as in the case of splice switching compounds¹⁹. By incorporating regulatory sequences for alternative splicing factors into the exons or introns, it should be possible to examine U1 dependence in splicing regulation. This concept was applied by Hamid et al. to demonstrate the involvement of the stem-loop 4 of the U1 snRNA in splicing regulation by the polypyrimidine tract binding protein 1²⁰. We have used this assay to study the functions of stem-loops 3 and 4 of the U1 snRNA. By incorporating mutations in the stem-loop of the suppressor U1-5a snRNA that activates a mutant 5'-splice site in the Dup51p splicing reporter, we have identified their critical roles in the formation of cross intron contacts with the U2 snRNP specific protein SF3A1 in the early steps of spliceosome assembly^14,21. Thus, the three-exon two-intron Dup51 reporter serves as an adaptive tool for monitoring splicing efficiency in studies on mechanisms underlying spliceosome assembly and splicing-associated disease.

Materials

Name	Company	Catalog Number	Comments
Reagent Grade Deionized Water	ThermoFisher Scientific	23-751628
Diethyl pyrocarbonate (DEPC)	Sigma-Aldrich	D5758-25ML
Dulbecco's Modified Eagle Medium (DMEM) powder packet	Gibco	12100-046
Sodium Bicarbonate	ThermoFisher Scientific	S233-500
Fetal Bovine Serum (FBS), Australian Source, Heat Inactivated	Omega Scientific	FB-22
Penicillin-Streptomycin (P/S)	Sigma-Aldrich	P4458-100ML
Sodium Hydroxide, Standard Solution 1.0N	Sigma-Aldrich	S2567-16A
Hydrochloric Acid, Certified ACS Plus, 36.5 to 38.0%	ThermoFisher Scientific	A144-500
Disposable PES Bottle Top Filters	ThermoFisher Scientific	FB12566510
EDTA Disodium Salt Dihydrate	Amresco	0105-2.5KG
2.5% Trypsin (10x), no phenol red	ThermoFisher Scientific	15090046
Sodium Chloride	Fisher Bioreagent	BP358-212
Potassium Chloride	Fisher Bioreagent	BP366-1
Disodium Hydrogen Phosphate Heptahydrate	Fisher Bioreagent	BP332-1
Potassium Dihydrogen Phosphate	Fisher Bioreagent	BP362-1
Transfection medium - Opti-MEM™ I Reduced Serum Medium, no phenol red	ThermoFisher Scientific	11058021
Transfection Reagent - Lipofectamine™ 2000	ThermoFisher Scientific	13778150
TRIzol™ Reagent	ThermoFisher Scientific	15596018
Chloroform (Approx. 0.75% Ethanol as Preservative/Molecular Biology)	ThermoFisher Scientific	BP1145-1
Ethanol, Absolute (200 Proof), Molecular Biology Grade, Fisher BioReagents	ThermoFisher Scientific	BP2818-4
Isopropanol, Molecular Biology Grade, Fisher BioReagents	ThermoFisher Scientific	BP2618-212
Glycogen (5 mg/ml)	ThermoFisher Scientific	AM9510
Direct-zol RNA Miniprep Kit	Zymo Research	R2052
ATP, [γ-32P]- 6000Ci/mmol 150mCi/ml Lead, 1 mCi	PerkinElmer	NEG035C001MC
T4 Polynucleotide Kinase	New England Biolabs	M0201L
Size exclusion beands - Sephadex® G-25	Sigma-Aldrich	G2580-10G
Size exclusion mini columns	USA Scientific	1415-0600
pBR322 DNA-MspI Digest	New England Biolabs	N3032S
Low Molecular Weight Marker, 10-100 nt	Affymetrix	76410 100 UL
Rnase inactivating reagents - RNaseZAP™	Sigma-Aldrich	R2020-250ML
dNTP Mix (10 mM ea)	ThermoFisher Scientific	18427013
RNaseOUT™ Recombinant Ribonuclease Inhibitor	ThermoFisher Scientific	10777019
Reverse Transcriptase - M-MLV Reverse Transcriptase	ThermoFisher Scientific	28025013	used for primer extension
Taq DNA Polymerase	ThermoFisher Scientific	10342020
Random Hexamers (50 µM)	ThermoFisher Scientific	N8080127
Real time PCR mix - SYBR™ Select Master Mix	ThermoFisher Scientific	4472903
SuperScript™ III Reverse Transcriptase	ThermoFisher Scientific	18080093	used for cDNA preparation
Dithiothreitol (DTT)	ThermoFisher Scientific	18080093
5X First-Strand Buffer	ThermoFisher Scientific	18080093
Formamide (≥99.5%)	ThermoFisher Scientific	BP228-100	Review Material Safety Data Sheets
Bromophenol Blue sodium salt	Sigma-Aldrich	114405-5G
Xylene Cyanol FF	Sigma-Aldrich	2650-17-1
Tris Base (White Crystals or Crystalline Powder/Molecular Biology)	ThermoFisher Scientific	BP152-5
Boric Acid (Crystalline/Electrophoresis)	ThermoFisher Scientific	BP168-500
Acrylamide: Bis-Acrylamide 19:1 (40% Solution/Electrophoresis)	ThermoFisher Scientific	BP1406-1	Review Material Safety Data Sheets
Urea (Colorless-to-White Crystals or Crystalline Powder/Mol. Biol.)	ThermoFisher Scientific	BP169-212
Ammonium peroxodisulphate (APS) ≥98%, Pro-Pure, Proteomics Grade	VWR	M133-25G
Sigmacote	Sigma-Aldrich	SL2-100ML
N,N,N',N'-Tetramethylethylenediamine (TEMED) ≥99%, Ultrapure	VWR	0761-25ML	Review Material Safety Data Sheets
Adjustable Slab Gel Systems, Expedeon	VWR	ASG-400
Vertical Gel Wrap™ Glass Plate Sets, 16.5 x 14.5cm	VWR	NGP-125NR
Vertical Gel Wrap™ Glass Plate Sets, 16.5 x 22.0cm	VWR	NGP-200NR
Vertical Gel Wrap™ Glass Plate Sets, 16.5 x 38.7cm	VWR	NGP-400NR
GE Storage Phosphor Screens	Sigma-Aldrich	GE28-9564
Typhoon™ FLA 7000 Biomolecular Imager	GE Healthcare	28-9610-73 AB
Beckman Coulter LS6500 Liquid Scintillation Counter	GMI	8043-30-1194
C1000 Touch Thermal Cycler	ThermoFisher Scientific
QuantStudio 6 Flex Real-Time PCR Systems	ThermoFisher Scientific