This protocol aims to isolate cell-type-specific translating ribosomal mRNAs using the NuTRAP mouse model.
A subscription to JoVE is required to view this content. Sign in or start your free trial.
Method Article
This protocol aims to isolate cell-type-specific translating ribosomal mRNAs using the NuTRAP mouse model.
Cellular heterogeneity poses challenges to understanding the function of complex tissues at a transcriptome level. Using cell-type-specific RNAs avoids potential pitfalls caused by the heterogeneity of tissues and unleashes the powerful transcriptome analysis. The protocol described here demonstrates how to use the Translating Ribosome Affinity Purification (TRAP) method to isolate ribosome-bound RNAs from a small amount of EGFP-expressing cells in a complex tissue without cell sorting. This protocol is suitable for isolating cell-type-specific RNAs using the recently available NuTRAP mouse model and could also be used to isolate RNAs from any EGFP-expressing cells.
High-throughput approaches, including RNA sequencing (RNA-seq) and microarray, have made it possible to interrogate gene expression profiles at the genome-wide level. For complex tissues such as the heart, brain, and testis, the cell-type-specific data will provide more details comparing the use of RNAs from the whole tissue1,2,3. To overcome the impact of cellular heterogeneity, the Translating Ribosome Affinity Purification (TRAP) method has been developed since early 2010s4. TRAP is able to isolate ribosome-bound RNAs from specific cell types withou....
Access restricted. Please log in or start a trial to view this content.
All performed animal experiments followed the protocols approved by the Institutional Animal Care and Use Committees (IACUC) at Auburn University.
NOTE: The following protocol uses one testis (about 100 mg) at P28 from Gli1-CreERT2; NuTRAP mice (Mus musculus). Volumes of reagents may need to be adjusted based on the types of samples and the number of tissues.
1. Tissue collection
Access restricted. Please log in or start a trial to view this content.
Gli1-CreERT2 mouse (Jackson Lab Stock Number: 007913) were first crossed with the NuTRAP reporter mouse (Jackson Lab Stock Number: 029899) to generate double-mutant mice. Mice carrying both genetically engineered gene alleles (i.e., Gli1-CreERT2 and NuTRAP) were injected with tamoxifen once a day, every other day, for three injections. Tissue samples were collected on the 7th day after the 1st day of the injection. Immunofluorescence analysis showed t.......
Access restricted. Please log in or start a trial to view this content.
The usefulness of the whole-tissue transcriptome analysis could be dampened, especially when studying complex heterogeneous tissues. How to obtain cell-type-specific RNAs becomes an urgent need to unleash the powerful RNA-seq technique. The isolation of cell-type-specific RNAs usually relies on the collection of a specific type of cells using micromanipulation, fluorescent-activated cell sorting (FACS), or laser capture microdissection (LCM)18. Other modern high-throughput single-cell collection m.......
Access restricted. Please log in or start a trial to view this content.
The authors declare no conflict of interest.
This work was partially supported by NIH R00HD082686. We thank the Endocrine Society Summer Research Fellowship to H.S.Z. We also thank Dr. Yuan Kang for breeding and maintaining the mouse colony.
....Access restricted. Please log in or start a trial to view this content.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| Actb | eurofins | qPCR primers | ATGGAGGGGAATACAGCCC / TTCTTTGCAGCTCCTTCGTT (forward primer/reverse primer) |
| Bioanalyzer | Agilent | 2100 Bioanalyzer Instrument | |
| cOmplete Mini EDTA-free Protease Inhibitor Cocktail | Millipore | 11836170001 | |
| cycloheximide | Millipore | 239764-100MG | |
| Cyp11a1 | eurofins | qPCR primers | CTGCCTCCAGACTTCTTTCG / TTCTTGAAGGGCAGCTTGTT (forward primer/reverse primer) |
| dNTP | Thermo Fisher Scientific | R0191 | |
| DTT, Dithiothreitol | Thermo Fisher Scientific | P2325 | |
| DynaMag-2 magnet | Thermo Fisher Scientific | 12321D | |
| Falcon tubes 15 mL | VWR | 89039-666 | |
| GFP antibody | Abcam | ab290 | |
| Glass grinder set | DWK Life Sciences | 357542 | |
| heparin | BEANTOWN CHEMICAL | 139975-250MG | |
| Hsd3b | eurofins | qPCR primers | GACAGGAGCAGGAGGGTTTGTG / CACTGGGCATCCAGAATGTCTC (forward primer/reverse primer) |
| KCl | Biosciences | R005 | |
| MgCl2 | Biosciences | R004 | |
| Microcentrifuge tubes 2 mL | Thermo Fisher Scientific | 02-707-354 | |
| Mouse Clariom S Assay microarrays | Thermo Fisher Scientific | Microarray service | |
| NP-40 | Millipore | 492018-50 Ml | |
| oligo (dT)20 | Invitrogen | 18418020 | |
| PicoPure RNA Isolation Kit | Thermo Fisher Scientific | KIT0204 | |
| Protein G Dynabead | Thermo Fisher Scientific | 10003D | |
| RNase-free water | growcells | NUPW-0500 | |
| RNaseOUT Recombinant Ribonuclease Inhibitor | Thermo Fisher Scientific | 10777019 | |
| Sox9 | eurofins | qPCR primers | TGAAGAACGGACAAGCGGAG / CTGAGATTGCCCAGAGTGCT (forward primer/reverse primer |
| Superscript IV reverse transcriptase | Invitrogen | 18090050 | |
| SYBR Green PCR Master Mix | Thermo Fisher Scientific | 4309155 | |
| Sycp3 | eurofins | qPCR primers | GAATGTGTTGCAGCAGTGGGA /GAACTGCTCGTGTATCTGTTTGA (forward primer/reverse primer) |
| Tris | Alfa Aesar | J62848 |
Access restricted. Please log in or start a trial to view this content.