Isolate Cell-Type-Specific RNAs from Snap-Frozen Heterogeneous Tissue Samples without Cell Sorting

Summary

This protocol aims to isolate cell-type-specific translating ribosomal mRNAs using the NuTRAP mouse model.

Abstract

Cellular heterogeneity poses challenges to understanding the function of complex tissues at a transcriptome level. Using cell-type-specific RNAs avoids potential pitfalls caused by the heterogeneity of tissues and unleashes the powerful transcriptome analysis. The protocol described here demonstrates how to use the Translating Ribosome Affinity Purification (TRAP) method to isolate ribosome-bound RNAs from a small amount of EGFP-expressing cells in a complex tissue without cell sorting. This protocol is suitable for isolating cell-type-specific RNAs using the recently available NuTRAP mouse model and could also be used to isolate RNAs from any EGFP-expressing cells.

Introduction

High-throughput approaches, including RNA sequencing (RNA-seq) and microarray, have made it possible to interrogate gene expression profiles at the genome-wide level. For complex tissues such as the heart, brain, and testis, the cell-type-specific data will provide more details comparing the use of RNAs from the whole tissue^1,2,3. To overcome the impact of cellular heterogeneity, the Translating Ribosome Affinity Purification (TRAP) method has been developed since early 2010s⁴. TRAP is able to isolate ribosome-bound RNAs from specific cell types withou....

Protocol

All performed animal experiments followed the protocols approved by the Institutional Animal Care and Use Committees (IACUC) at Auburn University.

NOTE: The following protocol uses one testis (about 100 mg) at P28 from Gli1-CreER^T2; NuTRAP mice (Mus musculus). Volumes of reagents may need to be adjusted based on the types of samples and the number of tissues.

1. Tissue collection

1. Euthanize the mice using a CO₂ chamber, sanitize the abdomen surface with 70% ethanol.
2. Open the lower abdomen with scissors and remove the testes. Use li....

Results

Gli1-CreER^T2 mouse (Jackson Lab Stock Number: 007913) were first crossed with the NuTRAP reporter mouse (Jackson Lab Stock Number: 029899) to generate double-mutant mice. Mice carrying both genetically engineered gene alleles (i.e., Gli1-CreER^T2 and NuTRAP) were injected with tamoxifen once a day, every other day, for three injections. Tissue samples were collected on the 7^th day after the 1^st day of the injection. Immunofluorescence analysis showed t.......

Discussion

The usefulness of the whole-tissue transcriptome analysis could be dampened, especially when studying complex heterogeneous tissues. How to obtain cell-type-specific RNAs becomes an urgent need to unleash the powerful RNA-seq technique. The isolation of cell-type-specific RNAs usually relies on the collection of a specific type of cells using micromanipulation, fluorescent-activated cell sorting (FACS), or laser capture microdissection (LCM)¹⁸. Other modern high-throughput single-cell collection m.......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
Actb	eurofins	qPCR primers	ATGGAGGGGAATACAGCCC / TTCTTTGCAGCTCCTTCGTT (forward primer/reverse primer)
Bioanalyzer	Agilent	2100 Bioanalyzer Instrument
cOmplete Mini EDTA-free Protease Inhibitor Cocktail	Millipore	11836170001
cycloheximide	Millipore	239764-100MG
Cyp11a1	eurofins	qPCR primers	CTGCCTCCAGACTTCTTTCG / TTCTTGAAGGGCAGCTTGTT (forward primer/reverse primer)
dNTP	Thermo Fisher Scientific	R0191
DTT, Dithiothreitol	Thermo Fisher Scientific	P2325
DynaMag-2 magnet	Thermo Fisher Scientific	12321D
Falcon tubes 15 mL	VWR	89039-666
GFP antibody	Abcam	ab290
Glass grinder set	DWK Life Sciences	357542
heparin	BEANTOWN CHEMICAL	139975-250MG
Hsd3b	eurofins	qPCR primers	GACAGGAGCAGGAGGGTTTGTG / CACTGGGCATCCAGAATGTCTC (forward primer/reverse primer)
KCl	Biosciences	R005
MgCl2	Biosciences	R004
Microcentrifuge tubes 2 mL	Thermo Fisher Scientific	02-707-354
Mouse Clariom S Assay microarrays	Thermo Fisher Scientific		Microarray service
NP-40	Millipore	492018-50 Ml
oligo (dT)20	Invitrogen	18418020
PicoPure RNA Isolation Kit	Thermo Fisher Scientific	KIT0204
Protein G Dynabead	Thermo Fisher Scientific	10003D
RNase-free water	growcells	NUPW-0500
RNaseOUT Recombinant Ribonuclease Inhibitor	Thermo Fisher Scientific	10777019
Sox9	eurofins	qPCR primers	TGAAGAACGGACAAGCGGAG / CTGAGATTGCCCAGAGTGCT (forward primer/reverse primer
Superscript IV reverse transcriptase	Invitrogen	18090050
SYBR Green PCR Master Mix	Thermo Fisher Scientific	4309155
Sycp3	eurofins	qPCR primers	GAATGTGTTGCAGCAGTGGGA /GAACTGCTCGTGTATCTGTTTGA (forward primer/reverse primer)
Tris	Alfa Aesar	J62848