A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Isolation of Rat Adipose Tissue Mesenchymal Stem Cells for Differentiation into Insulin-producing Cells

8.1K views

DOI:

10.3791/63348

August 29th, 2022

In This Article

Summary

Adipose tissue-derived mesenchymal stem cells (Ad-MSCs) can be a potential source of MSCs that differentiate into insulin-producing cells (IPCs). In this protocol, we provide detailed steps for the isolation and characterization of rat epididymal Ad-MSCs, followed by a simple, short protocol for the generation of IPCs from the same rat Ad-MSCs.

Abstract

Mesenchymal stem cells (MSCs)-especially those isolated from adipose tissue (Ad-MSCs)-have gained special attention as a renewable, abundant source of stem cells that does not pose any ethical concerns. However, current methods to isolate Ad-MSCs are not standardized and employ complicated protocols that require special equipment. We isolated Ad-MSCs from the epididymal fat of Sprague-Dawley rats using a simple, reproducible method. The isolated Ad-MSCs usually appear within 3 days post isolation, as adherent cells display fibroblastic morphology. Those cells reach 80% confluency within 1 week of isolation. Afterward, at passage 3-5 (P3-5), a full characterization was carried out for the isolated Ad-MSCs by immunophenotyping for characteristic MSC cluster of differentiation (CD) surface markers such as CD90, CD73, and CD105, as well as inducing differentiation of these cells down the osteogenic, adipogenic, and chondrogenic lineages. This, in turn, implies the multipotency of the isolated cells. Furthermore, we induced the differentiation of the isolated Ad-MSCs toward the insulin-producing cells (IPCs) lineage via a simple, relatively short protocol by incorporating high glucose Dulbecco's modified Eagle medium (HG-DMEM), β-mercaptoethanol, nicotinamide, and exendin-4. IPCs differentiation was genetically assessed, firstly, via measuring the expression levels of specific β-cell markers such as MafA, NKX6.1, Pdx-1, and Ins1, as well as dithizone staining for the generated IPCs. Secondly, the assessment was also carried out functionally by a glucose-stimulated insulin secretion (GSIS) assay. In conclusion, Ad-MSCs can be easily isolated, exhibiting all MSC characterization criteria, and they can indeed provide an abundant, renewable source of IPCs in the lab for diabetes research.

Introduction

Mesenchymal stem cells (MSCs), also known as mesenchymal stromal cells, are among the most widely used cell types for regenerative medicine1,2. They are classified as adult stem cells and characterized by multilineage differentiation potential and self-renewal capacity3. MSCs can be isolated and obtained from various sources, including adipose tissue, bone marrow, peripheral blood, umbilical cord tissue and blood, hair follicles, and teeth4,5.

The isolation of stem cells from adipose tissue is seen as both appealing and promising due to their easy access, rapid expansion in vitro, and high yield6. Adipose tissue-derived mesenchymal stem cells (Ad-MSCs) can be isolated from different species such as humans, bovines, mice, rats, and, more recently, goats7. It has been proven that Ad-MSCs are now potential candidates for tissue engineering and gene/cell therapy that can even be used to develop an autologous alternative for the long-term repair of soft tissue injury or defects7,8.

The International Society for Cell and Gene Therapy (ISCT) has defined three minimum criteria that must be exhibited by MSCs for full characterization9. First, they must be plastic adherent. Second, MSCs should express mesenchymal stem cell surface markers such as CD73, CD90, and CD105 and lack expression of the hematopoietic markers CD45, CD34, CD14 or CD11b, CD79α or CD19, and HLA-DR. Finally, MSCs should exhibit the ability to differentiate into the three mesenchymal lineages: adipocytes, osteocytes, and chondrocytes. Interestingly, MSCs can also differentiate into other lineages such as neuronal cells, cardiomyocytes, hepatocytes, and epithelial cells10,11.

In fact, MSCs possess unique properties that enable them to be applied as potential therapeutic agents in regenerative therapy for different diseases. MSCs can secrete soluble factors to induce an immunomodulatory environment that provides therapeutic benefits12. In addition, MSCs can migrate toward sites of injury and tumor microenvironments to deliver targeted therapy; however, the mechanisms are not fully elucidated13. In addition, MSCs have the ability to secrete exosomes, extracellular vesicles in the nanoscale that carry a cargo of non-coding RNAs, protein, and soluble factors, which lately emerged as a novel mechanism of the MSCs' therapeutic potential in various diseases14.

More importantly, MSCs have generated marked attention for their potential to differentiate into insulin-producing cells (IPCs), either by genetic modification15,16 or through utilizing various extrinsic-inducing factors within the culture media in vitro17. The IPC induction period varies greatly, as it depends on the used induction protocol and the utilized extrinsic factors. The process of differentiation can last from days to months, and it requires a combination of exogenous-inducing factors that must be added and/or withdrawn in different stages. Many of these factors that have been used for endocrine pancreatic differentiation are biologically active compounds that have been shown to promote the proliferation or differentiation/neogenesis of insulin-secreting β-cells and/or increase the insulin content of IPCs18,19,20,21. It is noteworthy here that MSCs have also been reported to have therapeutic effects in diabetes and its complications via several mechanisms, including their secretome, as well as a wide array of immuno-modulatory actions22,23,24.

In this protocol, we present a detailed stepwise protocol for the isolation and characterization of Ad-MSCs from rat epididymal fat, followed by a simple, relatively short protocol for the generation of IPCs from Ad-MSCs.

Access restricted. Please log in or start a trial to view this content.

Protocol

All experiments were carried out according to the approved guidelines, and all procedures were approved by the Ethical Committee of the Faculty of Pharmacy, The British University in Egypt (BUE), Cairo, Egypt. The Ad-MSC isolation protocol was adopted from Lopez and Spencer, with modifications15.

1. Isolation of Ad-MSCs from rat epididymal fat pads

  1. Use male Sprague-Dawley rats weighing 250-300 g that are not more than 1 month of age (two per isolation). Anesthetize the animals, then euthanize them by cervical dislocation. Spray the euthanized animal with 70% ethanol. Excise the skin and the muscle at the lower part of the abdomen, and then pull out the two testes to expose the epididymal fat pads.
  2. Gently cut the epididymal fat pads and be careful not to cut the blood vessels.
  3. Isolate the fat tissue surrounding the epididymis, then place it in a Petri dish containing phosphate-buffered saline (PBS).
  4. In the biosafety cabinet, cut these fat pads into small pieces using forceps and scalpel. Transfer these cut adipose tissue pieces into a 50 mL centrifuge tube containing 10 mL of sterile PBS.
  5. Wash the minced fat tissues 5 times with 10 mL of PBS each time to remove the contaminating blood. The following washing procedures must be meticulously carried out.
    1. Add 10 mL of PBS to the tissue and mix thoroughly for 45 s. Then, allow the tissue to settle via gravity by keeping the tube standing for 5 min to separate into two layers.
    2. Aspirate the PBS from the infranatant using a 10 ml syringe and replace with fresh 10 mL of PBS for another wash.
    3. Repeat this washing step 4-5 times until the PBS is clear of blood. This indicates that most, if not all, of the blood is removed.
  6. After washing, resuspend the adipose tissue in 10 mL of collagenase solution (0.1% collagenase type 1 in PBS). Seal the tube tightly with parafilm, then incubate it in a shaking water bath (37 °C, 80 rpm, for 45 min) until the tissue is almost homogenous.
    NOTE: Avoid the complete digestion of the tissue (when the solution becomes completely homogenous with complete disappearance of all tissue residues/pieces), because it adversely affects the culturing of cells afterward. Usually, the digestion takes 30-45 min.
  7. Once the collagenase digestion is done, vortex the tube for 15 s, then centrifuge for 5 min at 300 x g. Vortex the tube again for 10 s, followed by another 5 min centrifugation. Three layers will then be observed. Carefully discard the oil layer, followed by the aqueous layer, without disturbing the stromal vascular fraction (SVF) pellet.
    NOTE: Remove the supernatant containing adipocytes and the collagenase solution. First, remove the adipocytes and the accompanying oil layer with a 10 mL pipette to ensure complete removal of the oil droplets, then remove the underneath aqueous layer.
  8. Resuspend the SVF pellet at the bottom of the tube in 10 mL of sterile BSA solution (1% albumin, bovine serum Fraction V solution in PBS), then centrifuge the tube for 5 min at 300 x g.
  9. After centrifugation, discard the supernatant and suspend the SVF pellet in 8.5 mL of complete media for Ad-MSCs (composed of Dulbecco's Modified Eagle Medium/Nutrient Mixture F-12 [DMEM/F12] media supplemented with 10% FBS, 100 U/mL penicillin, 100 µg/mL streptomycin, 0.25 µg/mL amphotericin B, and 2 mM L-glutamine).
  10. Culture the cells in a 25 cm2 flask at 37 °C under 5% CO2. On the following day, check the attached cells, remove the suspended cells, and replace the media. Afterward, change the media every other day.
  11. Passage the cells every 5-7 days when they are 80%-90% confluent using Trypsin-EDTA. Use cells between passages 3-5 for the subsequent experiments described in this protocol. A schematic presentation of all the isolation steps is provided in Figure 1.
    NOTE: Usually, Trypisn-EDTA potency may vary among different suppliers, so try to minimize the time of trypsinization to avoid toxic effects on the cells.

2. Characterization of Ad-MSCs by immunophenotyping using flow cytometry analyses

  1. At passage 3, split the cells using Trypsin-EDTA. Wash with PBS 2 times and then count the cells with a hemocytometer.
  2. Incubate 100,000 cells at 4 °C in the dark for 20 min with either mouse anti-rat CD90 or CD105 (mesenchymal markers) or CD34 (hematopoietic marker) monoclonal antibody labeled with fluorescein-isothiocyanate (FITC).
  3. Wash the cells and suspend them in 500 µL of FACS buffer. Analyze by flow cytometry25.

3. Assessment of the differentiation potential of isolated Ad-MSCs into various mesenchymal lineages

  1. Adipogenic differentiation
    1. Resuspend the cells in complete media (as described in step 1.9.), then culture the cells at a density of 3.7 x 104 cells/well in a 24-well tissue culture plate. Incubate at 37 °C in a humidified atmosphere of 5% CO2. Next,change the media every 3 days until the cells reach almost 100% confluency, which usually takes 3 days.
    2. When the cells reach the desired confluency, replace the proliferation media with the adipogenic differentiation media (consisting of LG-DMEM media supplemented with 10% FBS, 100 U/mL penicillin, 100 µg/mL streptomycin, 0.25 µg/mL amphotericin B, and 2 mM L-glutamine with 1x adipogenic supplement, supplied with the Mesenchymal Stem Cells Functional Identification Kit) to induce adipogenesis. Then, change the media every 3 days (0.5 mL/well). Take care to perform the media replacement gently so as not to disrupt the lipid vacuoles.
    3. After 21 days, assess the adipogenic differentiation by microscopic examination of the lipid vacuoles appearance and by Oil Red staining.
    4. Prepare a stock solution of Oil Red by dissolving 30 mg of Oil Red stain in 10 mL of isopropanol, and then keep it for at least 20 min at room temperature. Afterward, prepare a working solution by mixing 3 parts stock solution with 2 parts double-distilled water (ddH2O), mix them well, and keep it for 10 min at room temperature, then filter afterward by filter paper.
    5. To document the adipogenic differentiation, wash the cells 2 times with PBS, then fix them using neutral-buffered formalin 10% (0.75 ml/well) for 15 min. After that, wash the cells 2 times with PBS using 1 mL/well and incubate the cells for 5 min each time. It is important to completely aspirate the PBS before adding the Oil Red working solution.
    6. After the last wash, add the Oil Red working solution to the cells and incubate them for 60 min at 37 °C. Afterward, remove the stain solution and gently wash the cells 2 times with PBS. Observe the stained lipid droplets under the microscope.
  2. Osteogenic differentiation
    1. Seed 7.4 x 103 cells/well (0.5 mL medium/well) in a 24-well plate and incubate them at 37 °C in a humidified atmosphere of 5% CO2 in complete media (as described in step 1.9.) for 3 days to reach almost 70% confluency.
    2. Induce the cells with the osteogenic supplement (provided with the kit) in LG-DMEM media supplemented with 10% FBS, 100 U/mL penicillin, 100 µg/mL streptomycin, 0.25 µg/mL amphotericin B, and 2 mM L-glutamine.
    3. Continue the osteogenic induction for 21 days, changing the differentiation media every 3 days.
    4. Prepare a working solution of Alizarin Red S stain by dissolving 200 mg of Alizarin Red S stain in 9 mL of ddH2O, and then adjust pH to 4.1-4.3 using ammonium hydroxide and HCl. Next, make up the volume to 10 mL by ddH2O. Following this, remove any precipitates by filtration using filter paper.
    5. Wash the cells 2 times with PBS, then fix them using 10% buffered formalin (0.75 mL/well) for 15 min. Afterward, wash the cells 2 times using PBS (1 mL/well). Each time, incubate the cells for 5 min.
    6. Incubate the fixed cells with the prepared 2% Alizarin-Red S solution for 30 min in a 37 °C incubator.
    7. After that, remove the stain solution, wash the cells 2 times with ddH2O and once with PBS, and then observe the stained calcium-rich extracellular matrix to assess osteogenic differentiation under the microscope.
  3. Chondrogenic differentiation
    1. Seed 7.4 x 103 cells/well (0.5 mL medium/well) in a 24-well plate and incubate these at 37 °C in a humidified atmosphere of 5% CO2 in complete media (as described in step 1.9.) for 3 days to reach almost 70% confluency.
    2. When the desired confluency is reached, induce the chondrogenic differentiation of the cells with serum-free DMEM/F12 containing insulin-transferrin selenium (ITS), chondrogenic supplement (provided with the kit), 100 U/mL penicillin, 100 µg/mL streptomycin, 0.25 µg/mL amphotericin B, and 2 mM L-glutamine21.
    3. Incubate the cells with the chondrogenic media for 21 days, while changing the chondrogenic differentiation media every 3 days.
    4. Prepare a working solution of Alcian Blue 8GX stain as follows: First, prepare a 3% glacial acetic acid solution in ddH2O by adding 3 mL of glacial acetic acid to 97 mL of ddH2O. Then, prepare a working solution of Alcian Blue 8GX stain by mixing 0.1 g in 100 mL of 3% glacial acid solution, and remove any precipitates by filtration using filter paper.
    5. Wash the cells 2 times with PBS, then fix them using 10% buffered formalin (0.75 mL/well) for 15 min. Afterward, wash the cells 2 times using PBS (1 mL/well). Each time, incubate the cells for 5 min.
    6. The next step is to incubate the cells in the prepared 0.1% Alcian Blue 8GX stain in 3% glacial acetic acid for 60 min at 37 °C. Wash the stained cells 2 times with ddH2O and once with PBS, and then observe the stained sulfated proteoglycans under the microscope.

4. Differentiation of Ad-MSCs into IPCs

  1. At passage 3, split the Ad-MSCs using Trypsin- EDTA. First, remove the media, then wash the cells while still attached in the culture flask with 5 mL of PBS. Next, add 5 mL of Trypsin- EDTA to the 75 cm2 flask and incubate at 37 °C for 3-10 min.
    NOTE: Try to induce the cells at early passages, usually between P3-P5, as late passages adversely affect the cells' properties and differentiation abilities17,24.
  2. Afterward, inspect the cells for detachment and for being a single-cell suspension. Add 5 mL of complete DMEM/F12 media to the flask to inhibit the trypsin action. Collect the cell suspension and transfer it to a 15 mL tube, and then add another 5 mL of complete DMEM/F12 media to the tube.
  3. Centrifuge the cells at 300 x g for 2 min to pellet the cells.
  4. Wash the cells once with PBS, centrifuge again at 300 x g for 2 min, and then resuspended the cell pellet in 3-5 mL of complete DMEM/F12 media.
  5. Count the cells using trypan blue exclusion dye and a hemocytometer.
  6. Then, seed the cells in 6-well plates (1 x 106 cells/plate) and a 12-well plate (for GSIS assay; 1 x 106 cells/plate) and incubate in a 37 °C, 5% CO2 incubator in complete media (as described in step 1.9.) for 3 days to reach almost 90% confluency.
  7. On the day of induction, remove the media, wash the cells with PBS, and then pre-induce the cells for 2 days by pre-induction media (DMEM/F12 supplemented with 10% FBS, 100 U/mL penicillin, 100 µg/mL streptomycin, 0.25 µg/mL amphotericin B, 2 mM L-glutamine, 10 mM nicotinamide [NA], and 1mM β-mercaptoethanol [β-ME]).
  8. Induce the cells for another 1 day using high glucose DMEM (HG-DMEM, 4.5g/L glucose) supplemented with 2.5% FBS, 100 U/mL penicillin, 100 µg/mL streptomycin, 0.25 µg/mL amphotericin B, 2 mM L-glutamine, 10 mM NA, and 1mM β-mercaptoethanol. Collect cell pellets at the end of this stage (designated D3 cells in this protocol).
  9. Incubate the cells for an additional 7 days in the final differentiation induction media composed of HG-DMEM supplemented with 2.5% FBS, 100 U/mL penicillin, 100 µg/mL streptomycin, 0.25 µg/mL amphotericin B, 2 mM L-glutamine, 10 mM NA, 1mM β-mercaptoethanol, and 10 nM exendin-4.
  10. At the end of the specified period, collect cell pellets (named Final in this protocol), and assess the successful differentiation of the cells by DTZ staining and GSIS assay, as follows in this protocol.
  11. Assess the generated IPCs by following steps 5 and 6 below.

5. Dithizone staining

  1. Prepare dithizone (DTZ) stain stock solution as follows: Completely dissolve 25 mg of DTZ in 2.5 mL of dimethyl sulfoxide (DMSO), divide into aliquots, and store at −20 °C in the dark until use.
  2. For staining, prepare a working solution 1:100 (volume/volume) by diluting the stock solution in complete culture medium (HG-DMEM supplemented with 5% FBS, 100 U/mL penicillin, 100 µg/mL streptomycin, 0.25 µg/mL amphotericin B, and 2 mM L-glutamine). Then, filter the working solution through a 0.2 µm syringe filter.
  3. Next, for the specified DTZ staining culture cells in a 6-well plate and, after aspirating the culture media, wash the cells once with PBS, and then add 2 mL of DTZ working solution into each well. Incubate for at least 2 h at 37 °C in the CO2 incubator.
  4. Carefully wash the cells 2 times with PBS. After the last wash, add 2 mL of PBS into each well. Then, observe the crimson red-stained IPCs under an inverted microscope. Use uninduced Ad-MSCs initially cultured in complete growth medium (10% FBS - DMEM/F12) as a control.

6. Gene expression of β-cell markers by RT-qPCR

  1. RNA extraction
    1. After differentiation, collect the cell pellets and store them at −80 °C until use. Suspend each cell pellet (derived from the six wells of one 6-well plate pooled) in 1 mL of guanidium thiocyanate RNA extraction reagent in a 1.5 mL nuclease-free tube, along with pipetting up and down several times. Incubate the lysed samples at room temperature for 5 min to permit complete dissociation of the nucleoprotein complexes.
    2. Add 200 µL of chloroform per 1 mL of RNA extraction reagent, and securely cap the tubes to be vigorously shaken by hand for 15 s. Next, incubate for 3 min at room temperature.
    3. Centrifuge the samples at 13,800 x g for 15 min at 4 °C. This will lead to mixture separation into a lower chloroform phase, an interphase, and a colorless upper aqueous phase, with the RNA remaining in the aqueous phase.
    4. Place the upper aqueous phase into a new tube, while carefully avoiding touching the interphase.
    5. Add 600 µL of 100% isopropanol to the aqueous phase (1:1 volume), then mix the samples thoroughly by inversion 25 times, and incubate at room temperature for 10 min.
    6. Centrifuge the samples at 18,800 x g for 30 min at 4 °C. The precipitated RNA forms a small gel-like pellet on the tube side.
    7. Remove the supernatant and wash the pellets with 1 mL of 80% ice-cold ethanol. After adding the ethanol, slowly conduct multiple pipetting of the RNA pellet for 10 s.
    8. Centrifuge the samples for 5 min at 9,600 x g at 4 °C. Discard the supernatant and leave the RNA pellets to air-dry for 5-10 min.
    9. After drying, dissolve the RNA pellets in 25-100 µL of RNase-free water (according to the initial pellet size) by pipetting up and down several times until complete solubilization in 1.5 mL nuclease-free tubes. Avoid excessive drying of the RNA pellet.
      NOTE: Usually, the pellet becomes transparent when it dries. However, once it is clear, promptly resuspend it to avoid excessive dryness of the pellet.
    10. Quantify RNA by determining the optical densities (OD) at 260 nm and 280 nm, using nuclease-free water as blank.
    11. Ensure that the samples have OD260/OD280 = 1.8-2.0.
  2. cDNA synthesis
    1. Synthesize cDNA from the isolated total RNA using a cDNA synthesis kit.
    2. Carry out the cDNA synthesis reaction according to the manufacturer's instructions. In a 200 µL PCR tube, add a volume of RNA solution containing 0.5 µg of total RNA to the reaction master mix shown in Table 1.
    3. After adding the RNA to the master mix, enter the mixture through a cycling program of 50 °C for 30 min for one cycle, followed by an inactivation cycle of 95 °C for 2 min, using a thermal cycler.
    4. Dilute the cDNA using nuclease-free water to a final concentration of 2 ng/µL. Store at −20 °C for subsequent RT-qPCR.
  3. RT-qPCR using SYBR Green Master Mix
    1. Carry out the RT-qPCR reaction for each target gene using cDNA template according to the reaction mix shown in Table 2. Do all the measures in triplicates.
    2. The sets of primers used are shown in Table 3. Perform all the RT-qPCR procedures on ice.
    3. Carry out the RT-qPCR reaction using a real-time PCR machine on default program settings. The thermal cycling conditions included initial denaturation of 95 °C for 10 min, followed by 45 cycles of denaturation (95 °C, 15 s) and combined annealing/extension (60 °C, 1 min).
    4. Determine the Ct values and detect the expression levels in accordance to 2-ΔΔCt, with β-actin as an internal control.

cDNA synthesis master mixVolume (µl)
5x cDNA synthesis buffer4
dNTP2
RNA primer1
Verso Enzyme Mix1
RT enhancer1
Nuclease Free waterVariable
Total RNAVariable
Total Reaction volume20

Table 1: cDNA synthesis master mix volumes.

RT-qPCR reaction mixVolume (µl)Final concentration in 10 µL
cDNA22 ng/well
RT-qPCR Forward primer (3 µM)1300 nM
RT-qPCR Reverse primer (3 µM)1300 nM
Nuclease free water1-------
2x SYBR Green master mix51x
Total reaction volume10

Table 2: RT-qPCR reaction mixture.

GeneForward primerReverse primer
FOXA2GAGCCGTGAAGATGGAAGGATGTTGCCGGAACCACTG
PDX-1ATCCACCTCCCGGACCTTTCCCTCCGGTTCTGCTGCGTAT
NKX6.1ACACCAGACCCACATTCTCCGATCTCGGCTGCGTGCTTCTT
MafATTCAGCAAGGAGGAGGTCATCCGCCAACTTCTCGTATTTC
Ins-1CACCTTTGTGGTCCTCACCTCTCCAGTGCCAAGGTCTGA
β-actinTGGAGAAGATTTGGCACCACAACACAGCCTGGATGGCTAC

Table 3: Forward and reverse primer sequences.

7. Glucose-stimulated insulin secretion

  1. Preparation of Kreb's Ringer bicarbonate (KRB) buffer
    1. Prepare Kreb's Ringer bicarbonate (KRB) buffer solution with both 2 mM glucose (low glucose) and 20 mM glucose (high glucose) concentrations for the glucose-stimulated insulin secretion (GSIS) assay. The components used for the KRB buffer preparation are given in Table 4.
    2. Adjust the pH of the buffer using 1 N HCl to about 7.25-7.35 (i.e., 0.1-0.2 units below the desired pH 7.4, because it may rise during filtration).
    3. Add bovine serum albumin (BSA) freshly in a concentration of 0.1 % (weight/volume).
    4. Add glucose afterward (18 mg for 50 mL of KRB to prepare the 2 mM low glucose KRB buffer, and 180 mg for 50 mL of KRB to prepare the 20 mM high glucose KRB buffer).
    5. Sterilize the prepared LG and HG KRB buffers by filtration through a 0.2 µm syringe filter to be ready for the GSIS assay.
  2. GSIS assay
    1. Initially seed 1 x 105 cells/well in a 12-well cell culture plate and induce these cells by using the exact same differentiation induction protocol.
    2. At the end of the induction protocol, gently wash the generated IPCs (in plate) 2 times with PBS and once with LG-KRB.
    3. Afterward, incubate the IPCs with 300 µL of LG-KRB/well for 1 h, and then discard this buffer.
    4. Next, incubate the IPCs with 300 µL of either 2 mM (LG) or 20 mM (HG) KRB buffer for an additional 1 h. At the end of the incubation period, collect the supernatant and store at −80 °C for the subsequent secreted insulin assay using a commercial ELISA kit and following the manufacturer's instructions.
      NOTE: Try to be as gentle as possible while aspirating or adding the PBS and KRB buffer when performing the GSIS assay.
ComponentConcentration
Magnesium Chloride (Anhydrous)0.0468 g/L
Potassium Chloride0.34 g/L
Sodium Chloride7.00 g/L
Sodium Phosphate Dibasic (Anhydrous)0.1   g/L
Sodium Phosphate Monobasic (Anhydrous)0.18 g/L
Sodium Bicarbonate1.26 g/L
Calcium Chloride0.2997 g/L

Table 4: The components used for the KRB buffer preparation.

8. Statistical analysis

  1. Express all data as mean ± standard error of the mean (SEM). All comparisons were done using one-way analysis of variance (ANOVA) and Tukey's post hoc test using statistical software. Results with p-values **p ≤ 0.01 and *p ≤ 0.05 were considered statistically significant.

Access restricted. Please log in or start a trial to view this content.

Results

Isolation and characterization of Ad-MSCs
As shown in Figure 2, the isolated cells from adipose tissue showed a heterogeneous population of rounded and fibroblast-like cells starting from the next day of isolation (Figure 2A). 4 days post isolation, the fibroblast cells started to increase in number and size and grow as a homogenous population by passage 1 (Figure 2B,C). These cells continued to...

Access restricted. Please log in or start a trial to view this content.

Discussion

In this protocol, we managed to present a detailed protocol for the isolation of Ad-MSCs from rat epididymal fat and the differentiation of these Ad-MSCs into IPCs. In fact, rat epidydimal fat is an easily attainable source of adipose tissue for obtaining Ad-MSCs and does not require any special equipment, neither for collection nor for processing15,26,27. The isolated Ad-MSCs showed excellent culture expansion and exhibited all...

Access restricted. Please log in or start a trial to view this content.

Disclosures

All the co-authors declare no conflict of interests associated with this work.

Acknowledgements

We acknowledge Dr. Rawda Samir Mohamed, MSc, Veterinarian Specialist, Faculty of Pharmacy, The British University of Egypt (BUE) for helping with the dissection of the rats.

We also would like to acknowledge and appreciate the efforts of the Faculty of Mass Communication, The British University in Egypt (BUE) for the production and editing of the video of this manuscript.

We would like to thank Miss Fatma Masoud, MSc, Assistant Lecturer of English, The British University in Egypt (BUE) for the revision and English language proofreading of the manuscript.

This work was partially funded by the Center for Drug Research and Development (CDRD), Faculty of Pharmacy, The British University in Egypt (BUE), Cairo, Egypt.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
Albumin, bovine serum Fraction VMP Biomedicals
Alcian Blue 8GXSigma-Aldrich, USAA3157
Alizarin Red SSigma-Aldrich, USAA5533
Ammonium hydroxideFisher Scientific, Germany
Antibody for Rat CD90, FITCStem Cell Technologies60024FI
Bovine serum albuminSigma AldrichA3912
Calcium ChlorideFisher Scientific, Germany
CD105 Monoclonal Antibody, FITCThermo Fisher Scientific, Invitrogen, USAMA1-19594
CD34 Polyclonal AntibodyThermo Fisher Scientific, Invitrogen, USAPA5-85917
ChloroformFisher Scientific, USA
Collagenase type I, powderGibco, Thermo Fisher, USA17018029
D-Glucose anhydrous, extra pureFisher Scientific, GermanyG/0450/53
Dimethyl sulfoxide (DMSO)Fisher Scientific, GermanyBP231-100
Dithizone stainingSigma-Aldrich, USAD5130
DMEM - High Glucose 4.5 g/LLonza, Switzerland12-604F
DMEM - Low Glucose 1 g/LLonza, Switzerland12-707F
DMEM/F12 mediumLonza, SwitzerlandBE12-719F
DNAse/RNAse free waterGibco Thermo Fisher, USA10977-035
Ethanol absolute, Molecular biology gradeSigma-Aldrich, Germany24103
Exendin-4Sigma-Aldrich, GermanyE7144
Fetal Bovine Serum (FBS)Gibco Thermo Fisher, Brazil10270-106
Formaldehyde 37%Fisher Scientific
Hydrochloric acid (HCl)Fisher Scientific, Germany
Isopropanol, Molecular biology gradeFisher Scientific, USABP2618500
L-GlutamineGibco Thermo Fisher, USA25030-024
Magnesium Chloride (Anhydrous)Fisher Scientific, Germany
Mesenchymal Stem Cell Functional identification kitR&D systems Inc., MN, USASC006
NicotinamideSigma-Aldrich, GermanyN0636
Oil Red StainSigma-Aldrich, USAO0625
Penicillin-Streptomycin-AmphotericinGibco Thermo Fisher, USA15240062
Phosphate buffered saline, 1X, without Ca/MgLonza, SwitzerlandBE17-516F
Potassium ChlorideFisher Scientific, Germany
Rat Insulin ELISA KitCloud-Clone Corp., USACEA682Ra
Sodium BicarbonateFisher Scientific, Germany
Sodium ChlorideFisher Scientific, Germany
Sodium Phosphate Dibasic (Anhydrous)Fisher Scientific, Germany
Sodium Phosphate Monobasic (Anhydrous)Fisher Scientific, Germany
SYBR Green MaximaThermo Scientific, USAK0221
Syringe filter, 0.2 micronCorning, USA431224
TRIzolThermo Scientific, USA15596026
Trypan blueGibco Thermo Fisher, USA15250061
Trypsin-Versene-EDTA, 1XLonza, SwitzerlandCC-5012
Verso cDNA synthesis kitThermo Scientific, USAAB-1453/A
β-mercaptoethanolSigma-Aldrich, GermanyM3148

References

  1. Hmadcha, A., Martin-Montalvo, A., Gauthier, B. R., Soria, B., Capilla-Gonzalez, V. Therapeutic potential of mesenchymal stem cells for cancer therapy. Frontiers in Bioengineering and Biotechnology. 8, 43(2020).
  2. Kamal, M., Kassem, D., Haider, K. H. Sources and therapeutic strategies of mesenchymal stem cells in regenerative medicine. Handbook of Stem Cell Therapy. Haider, K. H. , Springer. Singapore. 1-28 (2022).
  3. Jiang, Y., et al. Pluripotency of mesenchymal stem cells derived from adult marrow. Nature. 418 (6893), 41-49 (2002).
  4. De Ugarte, D. A., et al. Differential expression of stem cell mobilization-associated molecules on multi-lineage cells from adipose tissue and bone marrow. Immunology Letters. 89 (2-3), 267-270 (2003).
  5. Mosna, F., Sensebe, L., Krampera, M. Human bone marrow and adipose tissue mesenchymal stem cells: A user's guide. Stem Cells and Development. 19 (10), 1449-1470 (2010).
  6. Camara, B. O. S., et al. Differentiation of canine adipose mesenchymal stem cells into insulin-producing cells: Comparison of different culture medium compositions. Domestic Animal Endocrinology. 74, 106572(2021).
  7. Ren, Y., et al. Isolation, expansion, and differentiation of goat adipose-derived stem cells. Research in Veterinary Science. 93 (1), 404-411 (2012).
  8. Vallee, M., Cote, J. F., Fradette, J. Adipose-tissue engineering: Taking advantage of the properties of human adipose-derived stem/stromal cells. Pathologie Biologie. 57 (4), 309-317 (2009).
  9. Dominici, M., et al. Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy. 8 (4), 315-317 (2006).
  10. Gong, W., et al. Mesenchymal stem cells stimulate intestinal stem cells to repair radiation-induced intestinal injury. Cell Death & Disease. 7 (9), 2387(2016).
  11. Dai, R., Wang, Z., Samanipour, R., Koo, K. I., Kim, K. Adipose-derived stem cells for tissue engineering and regenerative medicine applications. Stem Cells International. 2016, 6737345(2016).
  12. Ceccarelli, S., Pontecorvi, P., Anastasiadou, E., Napoli, C., Marchese, C. Immunomodulatory effect of adipose-derived stem cells: The cutting edge of clinical application. Frontiers in Cell and Developmental Biology. 8, 236(2020).
  13. Karp, J., Leng Teo, G. Mesenchymal stem cell homing: The devil is in the details. Cell Stem Cell. 4 (3), 206-216 (2009).
  14. Andaloussi, S., Mager, I., Breakefield, X. O., Wood, M. J. Extracellular vesicles: Biology and emerging therapeutic opportunities. Nature Reviews Drug Discovery. 12 (5), 347-357 (2013).
  15. Lopez, M. J., Spencer, N. D. In vitro adult rat adipose tissue-derived stromal cell isolation and differentiation. Methods in Molecular Biology. 702, 37-46 (2011).
  16. Karnieli, O., Izhar-Prato, Y., Bulvik, S., Efrat, S. Generation of insulin-producing cells from human bone marrow mesenchymal stem cells by genetic manipulation. Stem Cells. 25 (11), 2837-2844 (2007).
  17. Yang, Y. K., Ogando, C. R., Wang See, C., Chang, T. Y., Barabino, G. A. Changes in phenotype and differentiation potential of human mesenchymal stem cells aging in vitro. Stem Cell Research & Therapy. 9 (1), 131(2018).
  18. Lee, R. H., et al. Multipotent stromal cells from human marrow home to and promote repair of pancreatic islets and renal glomeruli in diabetic NOD/scid mice. Proceedings of the National Academy of Sciences of the United States of America. 103 (46), 17438-17443 (2006).
  19. Gao, L. R., et al. Overexpression of apelin in Wharton's jelly mesenchymal stem cell reverses insulin resistance and promotes pancreatic β cell proliferation in type 2 diabetic rats. Stem Cell Research & Therapy. 9 (1), 339(2018).
  20. Ghoneim, M. A., Refaie, A. F., Elbassiouny, B. L., Gabr, M. M., Zakaria, M. M. From mesenchymal stromal/stem cells to insulin-producing cells: Progress and challenges. Stem Cell Reviews and Reports. 16 (6), 1156-1172 (2020).
  21. Kassem, D. H., Kamal, M. M., El-Kholy, A. E. -L. G., El-Mesallamy, H. O. Exendin-4 enhances the differentiation of Wharton's jelly mesenchymal stem cells into insulin-producing cells through activation of various β-cell markers. Stem Cell Research & Therapy. 7, 108(2016).
  22. Yang, Z., Li, K., Yan, X., Dong, F., Zhao, C. Amelioration of diabetic retinopathy by engrafted human adipose-derived mesenchymal stem cells in streptozotocin diabetic rats. Graefe's Archive for Clinical and Experimental Ophthalmology. 248 (10), 1415-1422 (2010).
  23. Zhang, N., Li, J., Luo, R., Jiang, J., Wang, J. A. Bone marrow mesenchymal stem cells induce angiogenesis and attenuate the remodeling of diabetic cardiomyopathy. Experimental and Clinical Endocrinology & Diabetes. 116 (2), 104-111 (2008).
  24. Zhao, A. G., Shah, K., Freitag, J., Cromer, B., Sumer, H. Differentiation potential of early- and late-passage adipose-derived mesenchymal stem cells cultured under hypoxia and normoxia. Stem Cells International. 2020, 8898221(2020).
  25. Krishnamurthy, H., Cram, L. S. Basics of flow cytometry. Applications of Flow Cytometry in Stem Cell Research and Tissue. , Hoboken, NJ. 1-12 (2010).
  26. Habib, S. A., Kamal, M. M., El-Maraghy, S. A., Senousy, M. A. Exendin-4 enhances osteogenic differentiation of adipose tissue mesenchymal stem cells through the receptor activator of nuclear factor-kappa B and osteoprotegerin signaling pathway. Journal of Cellular Biochemistry. , (2022).
  27. Qi, Y., et al. Adipose-derived mesenchymal stem cells from obese mice prevent body weight gain and hyperglycemia. Stem Cell Research & Therapy. 12 (1), 277(2021).
  28. Tiryaki, T., Conde-Green, A., Cohen, S. R., Canikyan, S., Kocak, P. A 3-step mechanical digestion method to harvest adipose-derived stromal vascular fraction. Plastic and Reconstructive Surgery - Global Open. 8 (2), 2652(2020).
  29. Alstrup, T., Eijken, M., Bohn, A. B., Moller, B., Damsgaard, T. E. Isolation of adipose tissue-derived stem cells: Enzymatic digestion in combination with mechanical distortion to increase adipose tissue-derived stem cell yield from human aspirated fat. Current Protocols in Stem Cell Biology. 48 (1), 68(2019).
  30. Taghizadeh, R. R., Cetrulo, K. J., Cetrulo, C. L. Collagenase impacts the quantity and quality of native mesenchymal stem/stromal cells derived during processing of umbilical cord tissue. Cell Transplantation. 27 (1), 181-193 (2018).
  31. Kamal, M. M., Kassem, D. H. Therapeutic potential of Wharton's jelly mesenchymal stem cells for diabetes: Achievements and challenges. Frontiers in Cell and Developmental Biology. 8, 16(2020).
  32. Gabr, M. M., et al. From human mesenchymal stem cells to insulin-producing cells: Comparison between bone marrow- and adipose tissue-derived cells. BioMed Research International. 2017, 3854232(2017).
  33. Xin, Y., et al. Insulin-producing cells differentiated from human bone marrow mesenchymal stem cells in vitro ameliorate streptozotocin-induced diabetic hyperglycemia. PLoS One. 11 (1), 0145838(2016).
  34. Kassem, D. H., Kamal, M. M. Therapeutic efficacy of umbilical cord-derived stem cells for diabetes mellitus: A meta-analysis study. Stem Cell Research & Therapy. 11 (1), 484(2020).
  35. El-Demerdash, R. F., Hammad, L. N., Kamal, M. M., El Mesallamy, H. O. A comparison of Wharton's jelly and cord blood as a source of mesenchymal stem cells for diabetes cell therapy. Regenerative Medicine. 10 (7), 841-855 (2015).
  36. Kassem, D. H., Kamal, M. M., El-Kholy, A. E. -L. G., El-Mesallamy, H. O. Association of expression levels of pluripotency/stem cell markers with the differentiation outcome of Wharton's jelly mesenchymal stem cells into insulin producing cells. Biochimie. 127, 187-195 (2016).
  37. El-Asfar, R. K., Kamal, M. M., Abd El-Razek, R. S., El-Demerdash, E., El-Mesallamy, H. O. Obestatin can potentially differentiate Wharton's jelly mesenchymal stem cells into insulin-producing cells. Cell and Tissue Research. 372 (1), 91-98 (2018).
  38. Gabr, M. M., et al. Insulin-producing cells from adult human bone marrow mesenchymal stromal cells could control chemically induced diabetes in dogs: A preliminary study. Cell Transplantation. 27 (6), 937-947 (2018).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Adipose Mesenchymal Stem CellsStem Cell DifferentiationStromal Vascular FractionCollagenase DigestionCD Surface MarkersGlucose-Stimulated Insulin SecretionDithizone StainingBeta Cell Markers