A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Removal of an Internal Translational Start Site from mRNA While Retaining Expression of the Full-Length Protein

2.2K views

DOI:

10.3791/63405

March 16th, 2022

In This Article

Summary

The present protocol describes a single M213L mutation in Gja1 that retains full-length Connexin43 generation but prevents translation of the smaller GJA1-20k internally translated isoform.

Abstract

The CRISPR-Cas9 gene-editing system, based on genome repair mechanisms, enables the generation of gene-modified mouse models more quickly and easily relative to traditional homologous recombination. The CRISPR-Cas9 system is particularly attractive when a single-point mutation is desired. The gap junction protein, Connexin 43 (Cx43), is encoded by gene Gja1, which has a single coding exon and cannot be spliced. However, Gja1 produces not only full-length Cx43 protein but up to six N-terminus truncated isoforms by a process known as internal translation, the result of ribosomal translation initiation at internal AUG (Methionine) start sites. GJA1-20k is the most commonly generated truncated isoform of Cx43 initiated at the AUG codon at position 213 of Gja1 mRNA. Because residue 213 occurs at the end of the last transmembrane domain of Cx43, GJA1-20k is effectively the 20 kDa C-terminus tail of Cx43 as an independent protein. Previous investigators identified, in cells, that a critical role of GJA1-20k is to facilitate trafficking of full-length Cx43 gap junction hemichannels to the plasma membrane. To examine this phenomenon in vivo, a mutant mouse with a Gja1 point-mutation was generated that replaces the ATG (Methionine) at residue 213 with TTA (Leucine, M213L mutation). The result of M213L is that Gja1 mRNA and full-length Cx43 are still generated, yet the translation of Gja1-20k is significantly reduced. This report focuses on choosing the restriction enzyme site to develop a one amino acid mutated (Gja1M213L/M213L) mouse model. This protocol describes genetically modified mice by the CRISPR-Cas9 system and rapid genotyping by combining PCR and restriction enzyme treatments.

Introduction

The full-length Connexin 43 (Cx43) and the N-terminus truncated isoform, GJA1-20k, encoded by the same GJA1 mRNA but utilize different start codons1 to initiate translation. Cx43 translation occurs at the first AUG start codon, whereas GJA1-20k translation initiates at the AUG at residue 213. It was previously found that GJA1-20k has essential roles for full-length Cx43 trafficking, actin stabilization, and regulation of mitochondrial morphology in vitro1,2,3.

To understand the role of GJA1-20k in vivo, a GJA1-20k "knock-out" mouse model was generated that retained the ability to create full-length Cx43. The approach was to use the CRISPR-Cas9 system to substitute the single residue at 213 from a Methionine (M) to a Leucine (L) (Gja1M213L/M213L)4. An internal M to L mutation dramatically decreases the likelihood of internal translation occurring yet retains the translation and function of full-length protein4. Because the wild type (WT) and mutated allele have identical sizes and near-identical mRNA products, there is considerable difficulty in confirming genotype in the mice. DNA sequencing can identify the mutation but is too expensive and time-consuming for routine use. In general, several faster-genotyping methods have been established, such as Real-time Polymerase Chain Reaction (RT-PCR), minisequencing-ligation, high-resolution melting analysis, and tetra-primer amplification refractory mutation system PCR (ARMS-PCR)5,6,7,8. Yet these alternative methods require multiple steps, unique resources, and/or several specific primer sets which can induce non-specific PCR products.

This protocol introduces a detailed gene targeting and editing approach by CRISPR-Cas9 to create a single amino acid mutation, and rapid genotyping is presented to confirm the mutation. Genotype identification involves the creative use of restriction enzymes utilizing only a single set of primers to identify the target gene. Readers are referred to Reference4 to observe the profound electrophysiological effect of sudden cardiac death caused by a one residue Gja1M213L/M213L substitution mutation which still generates full-length protein yet fails to generate a smaller internally translated truncation isoform. This protocol will help make other mice models use a point mutation to decrease the internal translation of an isoform of interest while retaining the expression of the endogenous full-length protein.

Access restricted. Please log in or start a trial to view this content.

Protocol

`All animal care and study protocols were approved by the Institutional Animal Care and Use Committees of Cedars-Sinai Medical Center and the University of Utah. C57BL/6J female mice obtained from commercial sources at 8-9 weeks of age (see Table of Materials) were used for the experiments.

1. Preparation for gene targeting

  1. Select the guide target sequence around the targeted mutation site coding M213 using CRISPOR web algorithm4,9,10 (see Table of Materials).
    NOTE: A 20-base guide sequence (ATTCAGAGCGAGAGACACCA), in the opposite strand from the GJA1 coding sequence, with an MIT score11 of 62 was selected in which the potential cleavage site is located after 16 bases downstream of the codon to be mutated (ATG) (Figure 1; the whole crRNA sequence is shown in Table 1).
  2. Synthesize the crRNA and tracrRNA that interact with Cas9 as guide RNA12.
    NOTE: Although the MIT score of the guide RNA is 62, there is only one potential off-target mutation with four mismatches more than 12 bases away from the PAM. Therefore, this guide RNA is considered safe.
  3. Design a donor oligo complementary to the guide sequence to introduce a single amino acid substitution (ATG to TTA; M213L) with 60 and 48 bases homology arms in the 5'- and 3'-sides, respectively.
    NOTE: This donor oligo includes a point mutation for disruption of the PAM (AGG to ACG) by introducing a silent mutation (TCC to TCG; S217S) to avoid re-editing after CRISPR homology-directed repair (HDR)13 for the introduction of the intended mutations (Figure 1 and Table 1).
  4. Use NaCl (200 mM final concentration) to precipitate 10 µg of oligos to minimize salt carry-over into pronuclear microinjection buffer (10 mM of Tris-HCl, pH 7.5; 0.1 mM of EDTA, and 100 mM of NaCl without spermine and spermidine14).
    NOTE: Do not wash the DNA pellet with 70% ethanol as the pellet can be dissolved into the solution.
  5. Mix 50 ng/µL of donor oligo, 60 ng/µL of crRNA/tracrRNA mix (1:1 molar ratio) (from step 1.2), and 50 ng/µL of eSpCas9 protein (see Table of Materials) to make CRISPR mixture in final volume 20 µL (Table 2). Decrease the concentration of the donor oligo if high toxicity is observed (e.g., 25 ng/µL).

2. Induction of superovulation, harvesting eggs, pronuclear microinjection of CRISPR mix, and blastocyst screening

NOTE: This procedure follows a previously published general protocol14.

  1. Inject 5 IU of PMSG (pregnant mare's serum gonadotropin) (see Table of Materials) in 100 µL of sterile water to 5-10 mice at 8 weeks of age by an intraperitoneal approach at about 3:00 p.m. (day 1).
  2. Inject 5 IU of hCG (human chorionic gonadotropin) (see Table of Materials) in 100 µL of sterile water to the egg donors by an intraperitoneal approach 46-48 h after PMSG injection (day 3). Set up 1:1 breeding with stud males.
  3. Harvest fertilized eggs in M2 medium with hyaluronidase, wash three times in 100 µL of M2 medium around 10:00 a.m., then keep in mWM15 or KSOM16 medium (day 4) (see Table of Materials).
  4. Introduce the CRISPR mixture (step 1.3) into 1-cell stage embryos harvested from the mice by pronuclear microinjection14 in 100 µL of M2 covered with paraffin oil in a plastic dish on an inverted microscope with a contrast-enhancing optics in early to late afternoon (Video 1).
    NOTE: Pronuclear microinjection of the CRISPR mixture was performed on 1-cell stage embryos at 14-16 h postcoitum (p.c.). The injected embryos were cultured in a 5% CO2 incubator for a few hours and surgically transferred at 18-20 h p.c. into recipient ICR mice that had a copulation plug in the same morning.
  5. Transfer 20-30 2-cell embryos into each recipient to produce recombinant animals.
    NOTE: Follow the general protocol14 or culture those embryos in mWM or KSOM medium for 4 days to validate the efficiency and examine toxicity. Toxicity of the CRISPR mixture is acceptable when at least one-third of the injected embryos reach early to the fully expanded blastocyst stage with multiple recombinants among them. At the same time, more than 90% of unmanipulated embryos reach the same blastocyst stage in a parallel culture. Follow the step 2.6-2.9 for blastcyst screening which is not essential but can be done if preferred to quantify success rate of HDR.
  6. Individually pick up early to fully expanded blastocysts with 2 µL of culture medium using a plugged fine pipette tip with a micropipetter into single PCR tubes (day 8; Video 2).
  7. Lyse blastocysts in 8 µL of digestion mixture (same as step 3.2; see Table of Materials) and process at 75 °C for 10 min, 95 °C for 5 min, then cool down to 4 °C for storage. Use 2 µL of the lysate as the template for PCR in a total 15 µL PCR mixture (step 3).
  8. Examine the efficacy of the HDR by agarose gel electrophoresis17 of the PCR samples following restriction digestion with NlaIII (step 3-5).
  9. Confirm the status of targeted recombination by sequencing the 668 bp amplicon17 in the founders and subsequent progeny to confirm the integrity of the mutation.

3. DNA extraction

NOTE: Mice at postnatal day 10 were used for this experiment due to sudden death of GJA1-20k knock-out mouse around 2-4 weeks after birth4. A more general protocol also can be applied following previously published report18.

  1. Cut 1-3 mm of the toe or tail tip with clean scissors and transfer it to a 0.2 mL 8-Strip PCR tube. To avoid contamination among the toe or tail samples, use pre-cleaned scissors or one blade per mouse or clean prior to each sample using 70% ethanol or 10% bleach. If the tail bleeds post sampling, apply brief pressure with gauze to stop the bleed. Store the tail samples at -20 °C until the extraction for up to about a week.
  2. Add tissue lysis solution (see Table of Materials) in a 100 µL/tube and mix well, followed by spin-down with a tabletop mini-centrifuge (2,200 x g for 10 s at room temperature). Ensure the tail samples are submerged in the solution.
  3. Set the tubes onto a thermal cycler set by the following program; 75 °C for 10 min (tissue lysis), 95 °C for 5 min (inactivation), and 4 °C (holding). Store the tissue lysate at 4 °C for up to a week if PCRs cannot be performed immediately.

4. DNA amplification by PCR

  1. Prepare a PCR solution containing 5 µL of nuclease-free H2O, 0.75 µL of 10 µM forward and reverse Primers, and 7.5 µL of PCR master mix (see Table of Materials) per sample into new PCR tube (see Table 1 for primer sequences). If there are several samples, scale contents to aliquot 14 µL per tube.
  2. Add 1 µL of the tissue lysate to the PCR solution prepared in step 3.1. Be careful not to touch the tail.
  3. Mix well and spin down with a tabletop mini-centrifuge (2,200 x g for 10 s at room temperature).
  4. Set the tubes onto a thermal cycler set by the below-mentioned program. Store the PCR products at 4 °C for 1-2 months or ~1 year at -20 °C.
    ​NOTE: 95 °C for 3 min (step 1, Initial Denaturation), 95 °C for 15 s (step 2, Denaturation), 60 °C for 15 s (step 2, Annealing), 72 °C for 45 s (step 2, Extension), repeat step 2 for 35 cycles, 72 °C for 10 min (step 3, Final Extension), and 4 °C (step 4, Holding).

5. Incubation with restriction enzyme

  1. Prepare the enzyme solution containing 7 µL of nuclease-free H2O, 2 µL of 10x CutSmart buffer, and 1 µL of NlaIII restriction enzyme (see Table of Materials). If there are several samples, multiply each content to make the mixture and aliquot 10 µL per tube.
  2. Add 10 µL of PCR product obtained in step 3 to the enzyme solution per tube.
  3. Mix well and spin down with a tabletop mini-centrifuge (2,200 x g for 10 s at room temperature).
  4. Set the tubes onto a thermal cycler or heat block set by the below-mentioned program. Store the product after the incubation at 4 °C for 1-2 months or ~1 year at -20 °C.
    ​NOTE: 37 °C for 16 h (at least 2 h; short incubation time may result in insufficient cleavage) and 4 °C for holding.

6. DNA band detection

  1. Prepare a 1.5% agarose gel containing DNA gel stain for electrophoresis.
    1. Add 0.75 g agarose in 50 mL of 1x TAE buffer followed by mix and heat in microwave until agarose dissolves completely. After cooling down, add 5 µL of DNA stain and gently mix.
    2. Pour into the gel mold (25 mL per mold) and allow the gel to solidify. To obtain better resolution and separation, increase the agarose concentration to 2.5%-4% as needed.
  2. Load 10 µL of digested PCR product to the well. Mix 6x loading buffer, if necessary.
  3. Run the gel with 100 V for 35 min.
    NOTE: These parameters may need optimization.
  4. Image under UV light (302 nm wavelength).

Access restricted. Please log in or start a trial to view this content.

Results

The CRISPR/Cas9 gene-editing system produces an ATG to TTA mutation and a silent TCC to TCG mutation at 56,264,279 to 56,264,281 and at 56,264,291 to 56,264,293 on mouse chromosome 10, or at 869 to 871 and 881 to 883 on Gja1 mRNA, respectively. Those mutation results in a Methionine 213 to Leucine (M213L) mutation on GJA1 protein and the TTC to TTG mutation disrupts a nearby PAM sequence to avoid undesired gene edition (Figure 1). The details of the mutation are described in a previous repor...

Access restricted. Please log in or start a trial to view this content.

Discussion

A gene-modified mouse model is a common approach for understanding gene function. However, since the GJA1-20k internally translated isoform is translated from the same Gja1 mRNA as full-length Cx43, a creative strategy was devised to retain full-length Cx43 expression yet suppress GJA1-20k expression. The approach is based on a mutation of the internal start codon of GJA1-20k. With a single point mutation, M213 was switched to L on Gja1 mRNA, which succeeded in suppressing GJA1-20k expression but retain...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors have nothing to disclose.

Acknowledgements

The project was supported by National Institutes of Health grants (R01HL152691, R01HL138577, and R01HL159983) to RMS.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
0.2 mL 8-Strip PCR tubeThomas Scientific1148A28
0.5 M EDTA pH 8.0Invitrogen15575-038For pronuclear micorinjection buffer
10x CutSmart bufferNew England BiolabsB7204SDigestion buffer for NlaIII
1 M Tris-HCl pH 7.5Invitrogen15567-027For pronuclear micorinjection buffer
50x TAE BufferInvitrogen24710-030
96-well Thermal cyclerApplied BiosystemsModel # 9902
AgaroseSigma-AldrichA9539
C57BL/6JThe Jackson Laboratory664mouse strain
Chemidoc MP imaging systemBio-radTo take gel image by 302 nm UV light
eSpCas9 proteinMilliporeSigmaESPCAS9PRO-50UG
Gel Lading Dye Purple (6x)New England BiolabsB7024SLoading buffer for electrophoresis
Gloves
hCG (human chorionic gonadotropin)MilliporeSigma23-073-425G
HyaluronidaseMilliporeSigmaH3884-100MG
Image Lab softwareBio-radTo analyze gel image
Inverted stereo microscope whit plasDICZeissAxiovert A1
KAPA Mouse Genotyping KitsRoche DiagnosticsKK7352For tissue or cell lysis, DNA extraction, and PCR master mix
KSOMLifeGlobalZEKS-050embryo culture medium
Lab coart
M2 mediumMilliporeSigmaMR015D
NlaIIINew England BiolabsR0125STo digest PCR product
Nuclease-Free WaterAmbionAM9937To dilute reagents
Paraffin oilNacalai USA2613785
Plugged 20 μL fine pipette tipFisherScientific02-707-171To pick up blastocytes
PMSG (pregnant mare’s serum gonadotropin)ProSpec-TanyHOR-272
Sodium ChlorideInvitrogenAM9760GFor pronuclear micorinjection buffer
SYBR safe DNA Gel StainInvitrogenS33102To detect bands in gel
tracrRNADharmaconU-002000-120Guid RNA

References

  1. Smyth, J. W., Shaw, R. M. Autoregulation of connexin43 gap junction formation by internally translated isoforms. Cell Reports. 5 (3), 611-618 (2013).
  2. Basheer, W. A., et al. GJA1-20k arranges actin to guide Cx43 delivery to cardiac intercalated discs. Circulation Research. 121 (9), 1069-1080 (2017).
  3. Fu, Y., et al. Cx43 isoform GJA1-20k promotes microtubule dependent mitochondrial transport. Frontiers in Physiology. 8, 905(2017).
  4. Xiao, S., et al. Auxiliary trafficking subunit GJA1-20k protects connexin-43 from degradation and limits ventricular arrhythmias. Journal of Clinical Investigation. 130 (9), 4858-4870 (2020).
  5. Syvanen, A. C. From gels to chips: "minisequencing" primer extension for analysis of point mutations and single nucleotide polymorphisms. Human Mutation. 13 (1), 1-10 (1999).
  6. Han, Y., et al. Genome-wide SNP discovery in tetraploid alfalfa using 454 sequencing and high resolution melting analysis. BMC Genomics. 12, 1-11 (2011).
  7. Han, Y., Khu, D. M., Monteros, M. J. High-resolution melting analysis for SNP genotyping and mapping in tetraploid alfalfa (Medicago sativa L.). Molecular Breeding. 29 (2), 489-501 (2012).
  8. Peng, B. Y., et al. A novel and quick PCR-based method to genotype mice with a leptin receptor mutation (db/db mice). Acta Pharmacologica Sinica. 39 (1), 117-123 (2018).
  9. Haeussler, M., et al. Evaluation of off-target and on-target scoring algorithms and integration into the guide RNA selection tool CRISPOR. Genome Biology. 17 (1), 148(2016).
  10. Concordet, J. P., Haeussler, M. CRISPOR: Intuitive guide selection for CRISPR/Cas9 genome editing experiments and screens. Nucleic Acids Research. 46 (1), 242-245 (2018).
  11. Hsu, P. D., et al. DNA targeting specificity of RNA-guided Cas9 nucleases. Nature Biotechnology. 31 (9), 827-832 (2013).
  12. Jinek, M., et al. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 337 (6096), 816-821 (2012).
  13. Paquet, D., et al. Efficient introduction of specific homozygous and heterozygous mutations using CRISPR/Cas9. Nature. 533 (7601), 125-129 (2016).
  14. Behringer, R., Gertsenstein, M., Nagy, K., Nagy, A. Manipulating the Mouse Embryo: A Laboratory Manual. , (2014).
  15. Pomp, D., Critser, E. S., Rutledge, J. J. Lower sodium lactate in Whitten's medium improves in vitro developmental capacity of one-cell mouse embryos. Theriogenology. 29 (5), 1019-1025 (1988).
  16. Summers, M. C., McGinnis, L. K., Lawitts, J. A., Raffin, M., Biggers, J. D. IVF of mouse ova in a simplex optimized medium supplemented with amino acids. Human Reproduction. 15 (8), 1791-1801 (2000).
  17. Green, M. R. S. Molecular Cloning: A Laboratory Manual (Fourth Edition). , (2012).
  18. Koh, J. Y., Iwabuchi, S., Huang, Z., Harata, N. C. Rapid genotyping of animals followed by establishing primary cultures of brain neurons. Journal of Visualized Experiments. 95. (95), e51879(2015).
  19. Iyer, V., et al. No unexpected CRISPR-Cas9 off-target activity revealed by trio sequencing of gene-edited mice. PLoS Genetics. 14 (7), 1007503(2018).
  20. Nature Medicine. Keep off-target effects in focus. Nature Medicine. 24 (8), 1081(2018).
  21. Mayer, H. Optimization of the EcoRI-activity of EcoRI endonuclease. FEBS Letters. 90 (2), 341-344 (1978).
  22. Kozak, M. Point mutations close to the AUG initiator codon affect the efficiency of translation of rat preproinsulin in vivo. Nature. 308 (5956), 241-246 (1984).
  23. Kozak, M. Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes. Cell. 44 (2), 283-292 (1986).
  24. Basheer, W. A., et al. Stress response protein GJA1-20k promotes mitochondrial biogenesis, metabolic quiescence, and cardioprotection against ischemia/reperfusion injury. JCI Insight. 3 (20), 121900(2018).
  25. Shimura, D., et al. Protective mitochondrial fission induced by stress-responsive protein GJA1-20k. Elife. 10, 69207(2021).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

CRISPR-Cas9 Gene EditingInternal TranslationConnexin 43Gja1 Point MutationMouse Model GenerationPCR GenotypingRestriction Enzyme DigestionAgarose Gel ElectrophoresisOligo Donor PurificationGenome Editing Efficiency