Ultrasound-guided cell delivery around the site of myocardial infarction in mice is a safe, effective, and convenient way of cell transplantation.
A subscription to JoVE is required to view this content. Sign in or start your free trial.
Method Article
Ultrasound-guided cell delivery around the site of myocardial infarction in mice is a safe, effective, and convenient way of cell transplantation.
The key objective of cell therapy after myocardial infarction (MI) is to effectively enhance the cell grafted rate, and human induced pluripotent stem cell-derived cardiomyocytes (hiPSC-CMs) are a promising cell source for cardiac repair after ischemic damage. However, a low grafted rate is a significant obstacle for effective cardiac tissue regeneration after transplantation. This protocol shows that multiple hiPSC-CM ultrasound-guided percutaneous injections into an MI area effectively increase cell transplantation rates. The study also describes the entire hiPSC-CM culture process, pretreatment, and ultrasound-guided percutaneous delivery methods. In addition, the use of human mitochondrial DNA help detect the absence of hiPSC-CMs in other mouse organs. Lastly, this paper describes the changes in cardiac function, angiogenesis, cell size, and apoptosis at the infarcted border zone in mice 4 weeks after cell delivery. It can be concluded that echocardiography-guided percutaneous injection of the left ventricular myocardium is a feasible, relatively invasive, satisfactory, repeatable, and effective cellular therapy.
When acute MI occurs, myocardial cells in the infarcted area die quickly due to ischemia and hypoxia. Several inflammatory factors are released after cell death and rupture, while inflammatory cells infiltrate the infarcted site to cause inflammation1. Significantly, fibroblasts and collagen, both without contractility and electrical conductivity, replace the myocardial cells in the infarcted site to form scar tissue. Due to the limited regeneration capacity of cardiomyocytes in adult mammals, viable tissue formed after a large area of infarction is usually not adequate for maintaining sufficient cardiac output2. MI causes heart failure, and in severe cases of heart failure, patients can only rely on heart transplants or ventricular assist devices to maintain normal heart functions3,4.
After MI, the ideal treatment strategy is to replace the dead cardiomyocytes with newly formed cardiomyocytes, forming electromechanical coupling with healthy tissues. However, treatment options have typically adopted myocardial salvage rather than replacement. Currently, stem cell- and progenitor cell-based therapies are among the most promising strategies to promote myocardial repair after MI5. However, the transplantation of these cells has several issues, primarily the inability of adult stem cells to differentiate into cardiomyocytes and their short life span6.
The ethical issues related to the use of embryonic stem (ES) cells can be circumvented by iPSCs, which are a promising source of cells. In addition, iPSCs possess strong self-renewal capabilities and can differentiate into cardiomyocytes7. Studies have shown that hiPSC-CMs transplanted into the MI site can survive and form gap junctions with host cells8,9. However, because these transplanted cells are located in the microenvironment of ischemia and inflammation, their survival rate is extremely low10,11.
Several methods have been established to improve the survival rate of transplanted cells, such as hypoxia and heat shock pretreatment of transplanted cells12,13, genetic modification14,15, and the simultaneous transplantation of cells and capillaries16. Unfortunately, most methods are limited by complexity and high cost. Hence, the present study proposes a reproducible, convenient, relatively invasive, and effective hiPSC-CM delivery method.
Ultrasound-guided intramyocardial cell injection can be carried out with only a high-resolution small veterinary ultrasound machine and a microinjector, regardless of the site. Under ultrasound guidance, directly delivering cells under the xiphoid process from the pericardium into the myocardium in mice is a safe protocol that avoids liver and lung damage. This method can be combined simultaneously with other technologies to significantly improve the survival rate of transplanted cells.
Access restricted. Please log in or start a trial to view this content.
All animal experiments in this study were reviewed and approved by the ethics committee of the Second Xiangya Hospital of Central South University. See the Table of Materials for details regarding all the materials and equipment used in this protocol. The timelines for cell injection, imaging and euthansia are as follows: t0- induce infarction, t1 week- image and implant cells, t2 weeks- image and implant cells, t4 weeks- final imaging, euthanasia and tissue collection.
1. hiPSC culture, cardiomyocyte differentiation, and cell purification
2. Preparation of hiPSC-CMs and the establishment of mouse acute myocardial infarction model
3. hiPSC-CM injection under ultrasound guidance
4. Evaluation of heart function, fluorescence labeling, transplanted cell count, myocardial infarcted area, and organ human mitochondria detection in mice 30 days after left anterior descending branch ligation
(2)
× 100% (3)Access restricted. Please log in or start a trial to view this content.
Echocardiography for evaluation of the left ventricular function of the mice in each group revealed that the MI injuries were effectively reversed in the MD group (Figure 2A). Compared with the MI group, the SD group showed increased ejection fraction (EF) (from 30% to 35%; Figure 2B) and fraction shortening (FS) (from 18% to 22%; Figure 2C) after MI. However, it is even more crucial to note that multiple injections of the hiPSC-CMs...
Access restricted. Please log in or start a trial to view this content.
The critical steps of this study include hiPSC culture, cardiomyocyte differentiation, hiPSC-CM purification, and hiPSC-CM transplantation into the mouse myocardial infarction site. The key is to use cardiac ultrasound to transcutaneously guide treatment toward the infarct site at the edge of the infarction where hiPSC-CMs were injected into the area.
With the prolongation of culture time, the hiPSC-CM phenotype changes in morphology (larger cell size), structure (muscle, fibril density, arran...
Access restricted. Please log in or start a trial to view this content.
The authors have nothing to disclose.
This work was supported by the Major Research Plan of the National Natural Science Foundation of China (No. 91539111to JY), Key Project of Science and Technology of Hunan Province (No. 2020SK53420 to JY) and The Science and Technology Innovation Program of Hunan Province (2021RC2106 to CF).
Access restricted. Please log in or start a trial to view this content.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| Antibody | |||
| Cardiac troponin T | Abcam | ab8295 | |
| Donkey Anti-Mouse IgG H&L (Alexa Fluor 488) | Abcam | ab150105 | |
| Donkey Anti-Mouse IgG H&L (Alexa Fluor 555) | Abcam | ab150110 | |
| Donkey Anti-Rabbit IgG H&L (Alexa Fluor 488) | Abcam | ab150073 | |
| Donkey Anti-Rabbit IgG H&L (Alexa Fluor 555) | Abcam | ab150062 | |
| Human cardiac troponin T | Abcam | ab91605 | |
| Isolectin B4 | Vector | FL-1201 | |
| Sarcomeric alpha actinin | Abcam | ab9465 | |
| Wheat germ agglutinin | Thermo Fisher Scientific | W11261 | |
| Reagent | |||
| Accutase | Thermo Fisher Scientific | 00-4555-56 | |
| B27 Supplement(minus insulin) | Thermo Fisher Scientific | A1895601 | |
| B27 Supplement(serum free) | Thermo Fisher Scientific | 17–504-044 | |
| Bouin's solution | Thermo Fisher Scientific | SDHT10132 | |
| CHIR99021 | Selleck | CT99021 | |
| cyclosporin A | Medchemexpress | HY-B0579 | |
| DIRECT RED | Sigma-Aldrich | 365548-25G | |
| DMEM/F12 | Thermo Fisher Scientific | 11320033 | |
| DNeasy Blood & Tissue Kit | Qiagen | 69504 | |
| FAST GREEN FCF | Sigma-Aldrich | F7252-5G | |
| Glucose-free RPMI 1640 | Thermo Fisher Scientific | 11879020 | |
| IWR1 | Selleck | S7086 | |
| lactic acid | Sigma-Aldrich | L6661 | |
| Matrigel | BD Biosciences | BD356234 | |
| mTeSR1 | Stem Cell Technologies | 72562 | |
| O.C.T. Compound | SAKURA | 4583 | |
| Paraformaldehyde | Sigma-Aldrich | 158127 | |
| PowerUP SYBR Green MasterMix kit | Thermo Fisher Scientific | A25742 | |
| RPMI1640 | Thermo Fisher Scientific | 11875119 | |
| STEMdif Cardiomyocyte Freezing Medium/STEMdiff | Stem Cell Technologies | 5030 | |
| STEMdiff Cardiomyocyte Support Medium | Stem Cell Technologies | 5027 | |
| Triton X-100 | Sigma-Aldrich | T8787 | |
| ultrasound coupling agent | CARENT | 22396269389 | |
| Y-27632 | Selleck | S6390 | |
| Equipment and Supplies | |||
| Applied Biosystems | Thermo Fisher Scientific | 7500 Real-Time PCR | |
| cryostat | Leica | CM1950 | |
| fluoresence microscope | Olympus | IX83 | |
| fine anatomical scissors | Fine Science Tools | 15000-08 | |
| fine dissecting forceps | Fine Science Tools | 11255-20 | |
| Micro syringe | Hamilton | 7633 | |
| Small animal anesthesia machine | MATRX | VMR | |
| Ultra-high resolution small animal ultrasound imaging system | VisualSonics | Vevo 2100 | |
| Software | |||
| Statistical Product and Service Solutions | IBM | 21 | |
| Image J | NIH | 1.48 | |
| Human mitochondrial DNA primers | |||
| the forward primer sequence | CCGCTACCATAATCATCGCTAT | ||
| the reverse primer sequence | TGCTAATACAATGCCAGTCAGG |
Access restricted. Please log in or start a trial to view this content.