A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Detecting Wolbachia Strain wAlbB in Aedes albopictus Cell Lines

2K views

DOI:

10.3791/63662

June 1st, 2022

* These authors contributed equally

In This Article

Summary

Four methods were used to detect intracellular Wolbachia, which complemented each other and improved the detection accuracy of Wolbachia infection of Aedes albopictus-derived Aa23 and Aa23-T cured of native Wolbachia infection using antibiotics.

Abstract

As a maternally harbored endosymbiont, Wolbachia infects large proportions of insect populations. Studies have recently reported the successful regulation of RNA virus transmission using Wolbachia-transfected mosquitoes. Key strategies to control viruses include the manipulation of host reproduction via cytoplasmic incompatibility and the inhibition of viral transcripts via immune priming and competition for host-derived resources. However, the underlying mechanisms of the responses of Wolbachia-transfected mosquitoes to viral infection are poorly understood. This paper presents a protocol for the in vitro identification of Wolbachia infection at the nucleic acid and protein levels in Aedes albopictus (Diptera: Culicidae) Aa23 cells to enhance the understanding of the interactions between Wolbachia and its insect vectors. Through the combined use of polymerase chain reaction (PCR), quantitative PCR, western blot, and immunological analytical methods, a standard morphologic protocol has been described for the detection of Wolbachia-infected cells that is more accurate than the use of a single method. This approach may also be applied to the detection of Wolbachia infection in other insect taxa.

Introduction

The Asian tiger mosquito Aedes albopictus (Skuse) (Diptera: Culicidae), which is a key vector of dengue virus (DENV) in Asia and other parts of the world1, is a natural host of two types of the intracellular bacteria, Wolbachia (wAlbA and wAlbB), which are distributed throughout the germ line and somatic tissue2,3. The Aa23 cell line derived from A. albopictus embryos consists of at least two morphological cell types, both of which support infection4 and may be cured of native Wolbachia infection using antibiotics (Aa23-T). Given that Aa23 retains only wAlbB, it is a useful model for the study of host-endosymbiont interactions4,5,6.

Wolbachia is maternally transmitted and infects an estimated 65% of insect species8,9 and 28% of mosquito species10. It infects a variety of tissues and forms an intimate symbiotic relationship with the host, usually inducing cytoplasmic incompatibility (CI)11 and population replacement by manipulating the host reproductive system12,13. These host responses have been observed in natural populations of Drosophila simulans14 and in A. aegypti in a laboratory cage and field trial15. An important nonreproductive manipulation elicited by Wolbachia is induced host resistance to a variety of pathogens, including DENV, Chikungunya virus (CHIKV), and West Nile virus (WNV)16,17, that may be mediated by an improved innate immune system of the symbiont18,19, competition between Wolbachia and viruses for essential host resources20, and manipulation of host viral defense pathways21.

This protocol has been developed for studying these underlying mechanisms of Wolbachia-induced host antiviral responses. It uses four methods of detection of intracellular Wolbachia infection of Aa23 cells. These methods provide a strong theoretical basis for studies of intracellular Wolbachia infection of other host species. The first method, PCR-a powerful technique allowing the enzymatic amplification of specific regions of DNA without utilizing conventional cloning procedures-was used to detect Wolbachia DNA and determine the presence/absence of Wolbachia infection22. The second method measures Wolbachia DNA copy density using quantitative PCR (qPCR) for reliable detection and measurement of products generated during each PCR cycle that is directly proportionate to the amount of template before PCR23. The third method detects the presence of intracellular Wolbachia proteins, using western blot-one of the most powerful tools for detecting specific proteins in complex mixtures by combining the high separation power of electrophoresis, the specificity of antibodies, and the sensitivity of chromogenic enzymatic reactions. The final method is an immunofluorescence assay (IFA) that combines immunology, biochemistry, and microscopy to detect the Wolbachia surface protein (wsp) through an antigen-antibody reaction to confirm the cellular uptake of Wolbachia and determine its cellular localization.

This paper describes the four methods listed above to verify the existence of Wolbachia in the cells, which can be used to detect whether the exogenous Wolbachia was successfully transfected and the Wolbachia in the cell was cleared. After determining whether Wolbachia is present in the cells or not, a variety of different analyses can be performed, including genomics, proteomics, or metabolomics. This protocol demonstrates the detection of Wolbachia through Aa23 cells but can also be used in other cells.

Access restricted. Please log in or start a trial to view this content.

Protocol

1. Materials and reagents

  1. Use pyrogen-free solutions and media for cell culture (see the Table of Materials).
  2. Use ultrapure water to prepare all solutions.
  3. Be careful in selecting fetal bovine serum (FBS) for cell culture, following a lot-check process.
    NOTE: As FBS lots are subject to regular change, it is impossible to state the relevant catalog and lot numbers in this protocol.
  4. Select Aa23 cell strains derived from A. albopictus eggs, corresponding to Wolbachia-free Aa23-T.

2. Cell culture

  1. Prepare 25 cm2 cell culture flasks with 4 mL of Schneider's medium with 10% FBS.
  2. Incubate the flasks at 28 °C under a 5% CO2 atmosphere for 5 to 7 days7,24.
  3. Observe unstained Aa23 and Aa23-T cells in the flasks using light microscopy at 100x magnification (Figure 1).

3. DNA extraction

  1. Culture the cells for 5-7 days until 70-80% confluence per flask (step 2). Harvest the cells with manual pipetting from 1 mL of resuspended culture medium by centrifugation for 5 min at 100 × g in a microcentrifuge.
  2. Remove the supernatant by aspiration and store the resulting cell pellet at -20 °C.
  3. Resuspend the pellets in 0.40 mL of phosphate-buffered saline (PBS), place 50 µL of the solution in a microcentrifuge tube, add 5 µL of proteinase K (20 mg/mL), and incubate at 55 °C for 1 h. Finally, heat these tubes at 99 °C for 15 min to obtain the crude DNA and store it at -20 °C.

4. Detection of Wolbachia nucleic acid

  1. PCR analysis
    1. Perform PCR in a total reaction volume of 20 µL, containing 8 µL of ddH2O, 10 µL of Taq polymerase (see the Table of Materials), 1 µL of DNA template (from step 3), 0.5 µL of forward and reverse primers (10 µM): wsp81F (5' TGG TCC AAT AAG TGATGA AGAAAC 3') and wsp691R (5' AAA AAT TAA ACG CTA CTC CA 3')25, respectively.
    2. Use the following PCR conditions: initial denaturation at 95 °C for 5 min, followed by 35 cycles of denaturation at 94 °C, annealing at 55 °C, and extension at 72 °C; then, a final extension at 72 °C for 7 min.
    3. Detect the DNA on a 1% agarose gel (1% w/v agarose in PBS) using a gel imager.
  2. qPCR analysis
    1. Analyze the Wolbachia genome copy for three biological replicates (n = 6) from the extracted DNA (step 3) using wsp primers 183 F (5' AAGGAACCGAAGTTCATG 3') and QBrev R (5' AGTTGAGAGTAAAGTCCC 3')22, normalized with ribosomal protein S6 (RPS6) forward and reverse primers (5' GAAGTTGAACGTATCGTTTC 3' and 5' GAGATGGTCAGCGGTGATTT 3', respectively)3.
    2. Generate a standard curve for wAlbB and RPS6.
      1. Extract DNA from PMD-18T (a special vector for efficient cloning of PCR products (TA cloning)) recombinant plasmid containing wsp and rps6 gene fragments (Supplemental File) and measure the plasmid DNA concentration (see the Table of Materials).
      2. Convert the plasmid DNA concentration to copy number concentration using Eq (1).
        Plasmid copy number = DNA quantification equation; plasmid concentration to molecule count formula; educational use (1)
      3. Dilute the plasmid copy number from 101 to 108 with ultrapure water, and set 3 replicates for each concentration gradient.
      4. Perform qPCR amplification using TB Green and a real-time PCR system (see the Table of Materials), and record the results of each reaction. Use the Ct value to develop a standard curve. Analyze the DNA in a total reaction volume of 20 µL, comprising 7 µL of ddH2O, 10.4 µL of TB Green (see the Table of Materials), 1 µL of DNA template (provided by Step 3), and 0.8 µL of forward and reverse primers (10 µM). Use the following reaction conditions: initial denaturation at 95 °C for 5 min, followed by 40 cycles of denaturation at 95 °C for 10 s, and annealing at 60 °C for 35 s.
      5. Calculate the WSP and​ RPS6 gene copy numbers in the cells according to the established standard curve and the Wolbachia relative density by the copy number of wsp/RPS6. Analyze the data using an independent samples t-test.
  3. Western blot analysis of Wolbachia protein
    1. Protein extraction
      1. Collect 2 × 107 Aa23 and Aa23-T cells from the six-well plate (from step 2) in a microcentrifuge tube, wash them three times with PBS, and centrifuge them at 100 × g for 5 min at 4 °C.
      2. Prepare 1 mL lysates with RIPA lysis buffer (50 mM Tris (pH 7.4), 150 mM NaCl, 1%Triton X-100, 1% sodium deoxycholate, 0.1% sodium dodecyl sulfate [SDS], 2 mM sodium pyrophosphate, 25 mM β-glycerophosphate, 1 mM EDTA, 1 mM Na3VO4, 0.5 µg/mL leupeptin) and PMSF (final concentration 1 mM).
      3. Add 200 µL of lysis buffer to the cell pellet and maintain for 30 min on ice. Centrifuge the lysates at 12,000 × g for 10 min at 4 °C and remove the supernatant.
    2. Assay the wsp concentration of the supernatant using a bicinchoninic acid (BCA) protein assay kit (see the Table of Materials) following the manufacturer's instructions.
    3. Load equal amounts of protein on a 15% SDS-PAGE gel [10% distilled water; 50% (30% Acr-Bis (29:1), 38% 1 M Tris, pH 8.8; 1% (10% SDS), 1% (10% ammonium persulfate), 0.04% TEMED].
    4. Transfer the protein to nitrocellulose membranes, block the membranes with 5% skimmed milk for 2 h26,27 at room temperature, and then wash the membranes three times with TBST (1 mL of Tween 20 in 1 L of TBS) (see the Table of Materials).
    5. Incubate the membranes overnight at 4 °C with 100 µL of anti-wsp polyclonal antibody (prepared in-house, see Supplemental File)), prepared by diluting the primary antibody with 5% skimmed milk (1:12,000).
    6. Wash the primary antibody three times with TBST.
    7. Incubate the membranes in 100 µL of horseradish peroxidase (HRP)-conjugated secondary antibody on a shaker for 1 h at room temperature.
    8. Wash the membranes three times with TBST, and mix 20 µL of solution A (HRP Substrate Luminol Reagent) and 20 µL of solution B (HRP Substrate Peroxide Reagent) in the chemiluminescence detection kit at a ratio of 1:1. Immerse the entire membrane into the luminescence solution at the same time, and observe the signals using a multifunctional imaging system.
  4. Immunofluorescence localization of Wolbachia protein
    1. Incubate 5 × 105 Aa23 and Aa23-T cells at 28 °C on a Laser confocal Petri dish with a thickness of 0.17 mm at the bottom, under a 5% CO2 atmosphere for 3 to 4 days7,24. Wait until the cell is 60%-70% confluence and wash the cells three times with PBS.
    2. Fix the cells for 20 min at 4 °C in 1 mL of 4% (w/v) paraformaldehyde in PBS.
    3. Wash the fixed cells using PBST (0.2% v/v Triton X-100 in PBS) for 5 min and wash the cells again twice with PBS.
    4. Incubate the slides for 1 h at 37 °C in 1 mL of 3% (w/v) bovine serum albumin in PBS.
    5. Incubate the slides overnight in 100 µL of mouse anti-wsp polyclonal antibody (prepared in-house) and mouse serum (1:1,000 dilution in PBS) in a wet box (it can maintain humidity and prevent moisture from evaporating) at 4 °C.
    6. Remove the slides from the wet box and return them to room temperature; wash them three times with PBS and remove the PBS.
      NOTE: From step 4.4.7 onward, all operations must be protected from light.
    7. Incubate the slides with 100 µL of an Alexa Fluor 488-conjugated goat anti-mouse antibody (1:2,000 dilution in PBS) at 37 °C for 30 min.
    8. Incubate the sample slides with 50 µL of 4',6-diamidino-2-phenylindole (DAPI diluted in PBS to 10 µg/mL, binds strongly to DNA) at 37 °C for 5 min and then wash them three times with PBS.
    9. Observe the immunostaining under a confocal microscope.
      1. Turn on the power and the laser.
      2. Turn on the normal and mercury lamps of the microscope.
      3. Start the system and run the operation software. Put a drop of cedar oil on the sample slides, place the sample slides on the microscope stage, and move the stage to the appropriate position.
      4. Click the mercury lamp observation button in the software, open the mercury lamp shutter, and observe the sample under an inverted microscope to focus.
      5. Use the manual control panel to select green and blue fluorescence to take fluorescence photos under 100x magnification.
      6. Turn off the mercury lamp observation button and start acquiring images.
      7. To ensure good image quality, prescan by scan size (512 pixels x 512 pixels). Adjust the scan size to get clear images (1,024 pixels x 1,024 pixels).
      8. Carry out noise reduction if the background noise is too high.
      9. Stop scanning and save the images.
      10. Turn off the mercury lamp and lasers.
      11. Wipe the objective with 75% alcohol and lower the objective to the lowest position.
      12. Turn off the shutter and microscope power.
      13. After the instrument has cooled, cover it with the dust cover.

Access restricted. Please log in or start a trial to view this content.

Results

Before Wolbachia was detected, Aa23 and Aa23-T cells were observed under a light microscope to determine any morphological differences between the two cell lines. Aa23 and Aa23-T cells have at least two cell morphologies but no obvious morphological difference between the two cell types (Figure 1). Here, Aa23 cells were used as a model system to detect Wolbachia infection using four methods. Positive amplification of the Wolbachiawsp gene using the...

Access restricted. Please log in or start a trial to view this content.

Discussion

Detection of intracellular Wolbachia infection is essential for the study of Wolbachia-host interactions and the confirmation of successful transfection of cells with novel strains. In this protocol, four methods were used to successfully detect intracellular Wolbachia infection at the nucleic acid and protein levels. These four experimental methods corroborated and improved the detection accuracy of Wolbachia infection of cells.

PCR was used to detect the ...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors have no conflicts of interest to declare.

Acknowledgements

We thank Dr. Xin-Ru Wang from the University of Minnesota for insightful suggestions and guidance. This work was supported by a grant from the National Natural Science Foundation of China (No.81760374).

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
MicroscopeZeissSteREO Discovery V8
Petri dishFisher ScietificFB0875713
PipettePipetmanF167380P10
inSituX platform
Analysis softwareIn-house developed
Cerium doped yttrium aluminum garnetMSE SuppliesCe:Y3Al5O12, YAG single crystal substrates
Chip holderIn-house developed
Control softwareIn-house developed
Immersion oilCargille Laboratories16482Type A low viscosity 150 cSt
inSituX platformIn-house developed
IR light source Thorlabs IncorporatedLED1085LLED with a Glass Lens, 1085 nm, 5 mW, TO-18
Outer ring In-house developed
Pump lasers Thorlabs IncorporatedLD785-SE400785 nm, 400 mW, Ø9 mm, E Pin Code, Laser Diode
Raspberry PiRaspberry Pi Fundation
Retaining ringThorlabs IncorporatedSM1RRSM1 retaining ring for Ø1" lens tubes and mounts
Seedless quartz crystalUniversity Wafers, Inc.U01-W2-L-19051425.4 mm diameter Z-cut 0.05 mm thickness double side polish 8 mm on -X
ShimIn-house developed
X-ray beam stopIn-house developed

References

  1. Wiwatanaratanabutr, I., Kittayapong, P. I. Effects of crowding and temperature on Wolbachia infection density among life cycle stages of Aedes albopictus. Journal of Invertebrate Patholology. 102 (3), 220-224 (2009).
  2. Sinkins, S. P., Braig, H. R., O'Neill, S. L. Wolbachia superinfections and the expression of cytoplasmic incompatibility. Proceedings of Biologial Sciences. 261 (1362), 325-330 (1995).
  3. Dobson, S. L., et al. Wolbachia infections are distributed throughout insect somatic and germ line tissues. Insect Biochemistry and Molecular Biology. 29 (2), 153-160 (1999).
  4. O'Neill, S. L., et al. In vitro cultivation of Wolbachia pipientis in an Aedes albopictus cell line. Insect Molecular Biology. 6 (1), 33-39 (1997).
  5. Sinha, A., Li, Z., Sun, L., Carlow, C. K. S. Complete genome sequence of the Wolbachia wAlbB endosymbiont of Aedes albopictus. Genome Biology and Evoution. 11 (3), 706-720 (2019).
  6. Sinkins, S. P. Wolbachia and cytoplasmic incompatibility in mosquitoes. Insect Biochemistry and Molecular Biology. 34 (7), 723-729 (2004).
  7. Fallon, A. M. Cytological properties of an Aedes albopictus mosquito cell line infected with Wolbachia strain wAlbB. In Vitro Cellular Developmental Biology - Animals. 44 (5-6), 154-161 (2008).
  8. Hilgenboecker, K., Hammerstein, P., Schlattmann, P., Telschow, A., Werren, J. H. How many species are infected with Wolbachia?-A statistical analysis of current data. Microbiology Letters. 281 (2), 215-220 (2008).
  9. Werren, J. H., Baldo, L., Clark, M. E. Wolbachia: master manipulators of invertebrate biology. National Review of Microbiology. 6 (10), 741-751 (2008).
  10. Kittayapong, P., Baisley, K. J., Baimai, V., O'Neill, S. L. Distribution and diversity of Wolbachia infections in Southeast Asian mosquitoes (Diptera: Culicidae). Journal of Medical Entomology. 37 (3), 340-345 (2000).
  11. O'Neill, S. L., Hoffmann, A., Werren, J. Influential passengers: inherited microorganisms and arthropod reproduction. , Oxford University Press. (1997).
  12. McGraw, E. A., O'Neill, S. L. Beyond insecticides: new thinking on an ancient problem. National Review of Microbiology. 11 (3), 181-193 (2013).
  13. Bourtzis, K., et al. Harnessing mosquito-Wolbachia symbiosis for vector and disease control. Acta Tropica. 132, 150-163 (2014).
  14. Turelli, M., Hoffmann, A. A. Rapid spread of an inherited incompatibility factor in California Drosophila. Nature. 353 (6343), 440-442 (1991).
  15. Hoffmann, A. A., et al. Successful establishment of Wolbachia in Aedes populations to suppress dengue transmission. Nature. 476 (7361), 454-457 (2011).
  16. Walker, T., et al. The wMel Wolbachia strain blocks dengue and invades caged Aedes aegypti populations. Nature. 476 (7361), 450-453 (2011).
  17. Hughes, G. L., Koga, R., Xue, P., Fukatsu, T., Rasgon, J. L. Wolbachia infections are virulent and inhibit the human malaria parasite Plasmodium falciparum in Anopheles gambiae. PLoS Pathogens. 7 (5), 1002043(2011).
  18. Bian, G., Xu, Y., Lu, P., Xie, Y., Xi, Z. The endosymbiotic bacterium Wolbachia induces resistance to dengue virus in Aedes aegypti. PLoS Pathogens. 6 (4), 1000833(2010).
  19. Moreira, L. A., et al. A Wolbachia symbiont in Aedes aegypti limits infection with dengue, Chikungunya, and Plasmodium. Cell. 139 (7), 1268-1278 (2009).
  20. Caragata, E. P., et al. Dietary cholesterol modulates pathogen blocking by Wolbachia. PLoS Pathogens. 9 (6), 1003459(2013).
  21. Zhang, G., Hussain, M., O'Neill, S. L., Asgari, S. Wolbachia uses a host microRNA to regulate transcripts of a methyltransferase, contributing to dengue virus inhibition in Aedes aegypti. Proceedings of the National Academy of Sciences of the United States of America. 110 (25), 10276-10281 (2013).
  22. Tortosa, P., Courtiol, A., Moutailler, S., Failloux, A. B., Weill, M. Chikungunya-Wolbachia interplay in Aedes albopictus. Insect Molecular Biology. 16 (7), 677-684 (2008).
  23. Lu, P., Bian, G., Pan, X., Xi, Z. Wolbachia induces density-dependent inhibition to dengue virus in mosquito cells. PLoS Neglected Tropical Diseases. 6 (7), 1754(2012).
  24. Ghosh, A., Jasperson, D., Cohnstaedt, L. W., Brelsfoard, C. L. Transfection of Culicoides sonorensis biting midge cell lines with Wolbachia pipientis. Parasite Vectors. 12 (1), 483(2019).
  25. Zhou, W., Rousset, F., O'Neill, S. Phylogeny and PCR-based classification of Wolbachia strains using wsp gene sequences. The Royal Society Publishing. Proceedings B. 265 (1395), 509-515 (1998).
  26. Park, M. S., Takeda, M. Cloning of PaAtg8 and roles of autophagy in adaptation to starvation with respect to the fat body and midgut of the Americana cockroach, Periplaneta americana. Cell Tissue Research. 356 (2), 405-416 (2014).
  27. Geng, S. C., Li, X. L., Fang, W. H. Porcine circovirus 3 capsid protein induces autophagy in HEK293T cells by inhibiting phosphorylation of the mammalian target of rapamycin. Journal of Zhejiang University Science B. 21 (7), 560-570 (2020).
  28. Taylor, S. C., Laperriere, G., Germain, H. Droplet digital PCR versus qPCR for gene expression analysis with low abundant targets: from variable nonsense to publication quality data. Scientific Reports. 7 (1), 2409(2017).
  29. Kosea, H., Karr, T. L. Organization of Wolbachia pipientis in the Drosophila fertilized egg and embryo revealed by an anti-Wolbachia monoclonal antibody. Mechanisms of Development. 51 (2-3), 275-288 (1995).
  30. Ye, Y. H., et al. Wolbachia reduces the transmission potential of dengue-infected Aedes aegypti. PLoS Neglected Tropical Diseases. 9 (6), (2015).
  31. Jensenius, M., et al. Comparison of immunofluorescence, Western blotting, and cross-adsorption assays for diagnosis of African tick bite fever. Clinical and Diagnostic Laboratory Immunology. 11 (4), 786-788 (2004).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Wolbachia DetectionAedes Albopictus CellsWolbachia InfectionPolymerase Chain ReactionQuantitative PCRWestern BlotImmunofluorescence AssayCytoplasmic IncompatibilityViral Transmission ControlEndosymbiont Identification