Method Article

CRISPR Gene Editing Tool for MicroRNA Cluster Network Analysis

2.7K views

āø±

DOI:

10.3791/63704

āø±

April 25th, 2022

In This Article

Summary

This protocol describes a high-throughput clustered regularly interspaced short palindromic repeats (CRISPR) gene editing workflow for microRNA cluster network analysis that allows the rapid generation of a panel of genetically modified cell lines carrying unique miRNA cluster member deletion combinations as large as 35 kb within a single experiment.

Abstract

MicroRNAs (miRNAs) have emerged as important cellular regulators (tumor suppressors, pro-oncogenic factors) of cancer and metastasis. Most published studies focus on a single miRNA when characterizing the role of small RNAs in cancer. However, ~30%Ā of human miRNA genes are organized in clustered units that are often co-expressed, indicating a complex and coordinated system of noncoding RNA regulation. A clearer understating of how clustered miRNA networks function cooperatively to regulate tumor growth, cancer aggressiveness, and drug resistance is required before translating noncoding small RNAs to the clinic.

The use of a high-throughput clustered regularly interspaced short palindromic repeats (CRISPR)-mediated gene editing procedure has been employed to study the oncogenic role of a genomic cluster of seven miRNA genes located within a locus spanning ~35,000 bp in length in the context of prostate cancer. For this approach, human cancer cell lines were infected with a lentivirus vector for doxycycline (DOX)-inducible Cas9 nuclease grown in DOX-containing medium for 48 h. The cells were subsequently co-transfected with synthetic trans-activating CRISPR RNA (tracrRNA) complexed with genomic site-specific CRISPR RNA (crRNA) oligonucleotides to allow the rapid generation of cancer cell lines carrying the entire miRNA cluster deletion and individual or combination miRNA gene cluster deletions within a single experiment.

The advantages of this high-throughput gene editing system are the ability to avoid time-consuming DNA vector subcloning, the flexibility in transfecting cells with unique guide RNA combinations in a 24-well format, and the lower-cost PCR genotyping using crude cell lysates. Studies using this streamlined approach promise to uncover functional redundancies and synergistic/antagonistic interactions between miRNA cluster members, which will aid in characterizing the complex small noncoding RNA networks involved in human disease and better inform future therapeutic design.

Introduction

Better research tools are needed to investigate the contribution of noncoding RNAs in human disease. MiRNA dysregulation is often observed in human disorders such as cancer when comparing the expression profiles of these small noncoding RNAs in the tissues and body fluids (e.g., blood, urine) of cancer patients versus noncancer, healthy individuals, employing microarrays, quantitative real-time PCR (qRT-PCR), and next-generation deep sequencing technologies1,2. Recent work has characterized a large subset of these miRNAs as tumor suppressor, oncogenic, and metastasis factors that control tumor formation, disease progression, and drug resistance. Experimental overexpression and/or downregulation/loss of miRNAs result in functional and pleiotropic consequences in the cell, reflecting the wide range of cancer-associated activities these noncoding RNAs coordinate - growth, apoptosis, differentiation, chromatin remodeling, angiogenesis, epithelial to mesenchymal (EMT) and MET transitions, metabolism, and immune response3.

MiRNAs are encoded as single genes or reside in genomic clusters, which are transcribed in the nucleus and extensively processed before generating the biologically mature, single-stranded ~22 nucleotide (nt) miRNA species localized in the cytoplasm4. These small RNAs exert their effects post-transcriptionally and act as negative gene regulators that bind to messenger RNA (mRNA) targets in a sequence-specific manner to bring the catalytic RNA-induced silencing complex (RISC) to the mRNA site, resulting in mRNA degradation and/or a block in protein translation. MiRNAs are an extremely abundant class of noncoding RNAs in animal systems, and 2,654 mature miRNAs exist in the human genome (miRBase release 22.1)5. MiRNAs typically associate with incomplete complementarity to their mRNA targets4. Therefore, a single miRNA can regulate tens to hundreds of distinct mRNA targets and functionally impact a large range of biological pathways. To add to the complexity of miRNA-based mechanisms, a single mRNA can be regulated by multiple, distinct miRNAs. It is, thus, challenging to investigate how miRNA dysregulation disrupts the body's homeostatic balance and leads to human malignancy.

The majority of published studies have focused on a single miRNA when characterizing their role in disease events. However, ~30%Ā of human miRNA genes are organized in clustered units (typically ~10 kilobases [kb]) that are often transcribed in the same orientation and co-expressed, indicating a coordinated and complex system of noncoding RNA regulation6. The largest polycistronic human miRNA cluster is the 14q32 cluster comprising 54 miRNA precursors. One of the most well-studied clustered miRNA units associated with human cancers is the miR-17-92 polycistronic cluster comprised of miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1, and miR-92-1 residing within intron 3 of the noncoding RNA, c13orf25. The miR-17-92 cluster is frequently amplified in hematopoietic malignancies and overexpressed in solid tumors and has established oncogenic roles in promoting cell cycle progression, apoptosis, and angiogenesis7. In addition, the tumor suppressive miR-15a and miR-16-1 cluster located within the intron of the noncoding gene Leu2 is often deleted in leukemias and downregulated in a large range of cancers, functioning to block tumor growth by targeting the antiapoptotic gene BCL2 and additional cell cycle progression genes8. The miR-888 cluster is elevated in patients with high-grade prostate cancer and consists of seven miRNA genes (miR-892c, -890, -888, -892a, -892b, -891b, and -891a) located on human chromosome Xq27.39,10.

The miR-888 cluster maps within the HPCX1 locus (Hereditary Prostate Cancer, X-linked 1) spanning Xq27-2, which was identified by linkage analysis of hereditary prostate cancer family pedigrees11,12,13,14,15,29. Functional characterization of individual miR-888 clustered members using conventional miRNA misexpression tools - miRNA mimics and antisense inhibitors - indicated that these miRNAs play overlapping roles in regulating prostate tumor growth and invasion9,10. However, these experimental methods do not lend themselves easily to studying how multiple miR-888 clustered members act synergistically or antagonistically in a noncoding RNA network to control tissue homeostasis and cancer progression. This described streamlined protocol using high-throughput CRISPR gene editing technology is modified to molecularly dissect miRNA clusters associated with human cancers (e.g., miR-888 cluster) to bridge this knowledge gap.

Bacterial CRISPR and CRISPR-associated (cas) genes mediate adaptive immunity against bacteriophages16. The discovery of this ancient procaryotic surveillance system was quickly adapted as an efficient scientific tool to easily target any desired genomic locus and make DNA sequence alterations within a large range of animal systems and cell types both in vitro and in vivo16,17. This technique holds great promise as an effective method to interrogate miRNA networks in the context of human disease. To this end, this high-throughput CRISPR gene editing protocol to study the miR-888 cluster spanning ~35 kb on human chromosome X in immortalized human prostate cancer cell lines (LNCaP, PC3-ML) is constructed to interrogate how cluster members coordinate cancer progression pathways. This approach can be applied to characterizing any miRNA cluster and allows investigators to rapidly generate human cell lines carrying the entire miRNA cluster deletion and individual and combination miRNA gene cluster deletions within a single experiment.

In this procedure, stable cell lines are established carrying a doxycycline (DOX)-inducible lentiviral expression system that enables the investigator to control Streptococcus pyogenes CRISPR-associated endonuclease Cas9 (csn1) gene expression through the constitutive DOX-inducible promoter TRE3G. The Tet-On 3G bipartite system involves a constitutive human elongation factor 1 alpha (hEF1alpha) promoter to drive the transcription of both the Tet-On 3G gene and the blasticidin resistance gene (BlastR) as a bicistronic transcript. The Tet-On 3G transactivator protein only binds to the TRE3G promoter in the presence of DOX, resulting in robust Cas9 transcription. In the absence of DOX, there is no or very minimal basal Cas9 expression. Therefore, the investigator can induce high Cas9 protein production in cells grown in media supplemented with DOX during the CRISPR gene editing steps and control for rapid CAS9 protein clearance upon DOX withdrawal.

This protocol also describes the design of synthetic CRISPR RNA (crRNA) oligonucleotides targeting regions flanking the entire miRNA cluster, individual miRNA hairpin (premiRNA) regions, and/or subsets of miRNA genes within the cluster. Each designed crRNA contains a unique 5'-terminal 20 nt guide sequence (complementary to the genomic sequence of interest to be targeted), followed by an invariant 22 nt S. pyogenes repeat sequence (5'-XXXXXXXXXXXXXXXXXXXX-GUUUUAGAGCUAUGCUGUUUUG-3') that enables base-pairing with the universal trans-activating CRISPR RNA (tracrRNA) oligonucleotides18. Together, the annealed crRNA and tracrRNA (mixed 1:1 ratio) function as the guide RNA for this protocol (Figure 1A). In each experiment, two synthetic guide RNAs are transfected into DOX-induced cells to associate and escort the bacterial Cas9 protein to the genomic DNA sites (5' and 3') flanking the miRNA cluster region targeted for removal (Figure 1B).

A protospacer adjacent motif (PAM) sequence (5'-NGG-3' for wild type S. pyogenes Cas9) must be present in the cell genome and located immediately adjacent to the 20 nt DNA sequence targeted by the guide RNA17. The PAM sequence serves as a binding signal and positions the catalytic region of the endonuclease Cas9 enzyme on the targeted genomic DNA site, subsequently leading to directed, double-stranded (ds) DNA cleavage located ~3 nt upstream of the PAM. The cell's DNA repair machinery repairs the cleaved DNA ends, which can result in perfect ligation, but often nonhomologous end joining (NHEJ) occurs, causing small insertions or deletions (indels) at the repair site. Since miRNAs are noncoding genes often located within intergenic and intronic regions, these indels carry a low risk of creating unwanted nonsense/missense mutations.

By employing synthetic RNA oligonucleotides (annealed crRNA and tracrRNA, 1:1 molar ratio) encoding for the guide RNA complex in these experiments, this gene knockout strategy avoids time-consuming DNA vector subcloning and allows for huge flexibility in transfecting unique guide RNA combinations to cells in a 24-well format. Preparation of crude cell lysates for PCR genotype screening also avoids expensive and time-consuming DNA purification methods, while allowing for streamlined single colony cell line generation and phenotypic analysis. Indeed, this high-throughput CRISPR gene editing protocol has been used successfully to transfect cultured prostate cancer cell lines (LNCaP, PC3-ML) with 32 unique guide RNA combinations in a single experiment and generate knockout lines carrying deletions for the entire ~35 kb miR-888 cluster region; smaller deletion combinations for miR-888 cluster members belonging to the miR-743 and miR-891a families; as well as deletions for individual miRNA members within the miR-888 cluster. Studies like these will provide a clearer understating of how clustered miRNAs function cooperatively to regulate tumor growth, aggressiveness, and drug resistance before translating miRNAs to the clinic as therapeutic and diagnostic tools.

Access restricted. Please log in or start a trial to view this content.

Protocol

1. Preparation for CRISPR gene editing and guide RNA design to generate miRNA cluster knockout cell lines

  1. Create a DNA file containing the complete genomic sequence of the miRNA cluster region of interest (intergenic, intronic) and at least 1 kB of surrounding genomic regions using a DNA sequence annotation software program19.
    1. Use a feature editing tool in the created DNA file to mark the targeted miRNA cluster locus (intergenic, intronic) and each individual miRNA hairpin sequence belonging to the miRNA cluster, as well as notating other nearby coding and noncoding genes and/or regulatory features5,20,21,22.
    2. Ensure the miRNA regions targeted for deletion do not inadvertently disrupt nearby protein-coding genes, noncoding genes, or important regulatory DNA elements.
      NOTE: Consider the genomic complexity (e.g., chromosome duplications/fusions) of the cell line used in this protocol.
  2. Design synthetic crRNAs targeting 20 nt of genomic DNA sequence flanking the entire miRNA cluster, individual miRNA hairpin (pre-miRNA) regions, and/or subsets of miRNA genes within the cluster using a bioinformatic guide RNA design software tool (e.g.,23). Ensure the appropriate Cas9 enzyme is notated in the guide RNA design tool (i.e., S. pyogenes Cas9).
    NOTE: The synthesized crRNA will contain this unique 5'-terminal 20 nt guide sequence (complementary to DNA target) followed by an invariant 22 nt S. pyogenes repeat sequence to allow base-pairing with the synthesized universal tracrRNA oligonucleotide. Annealed together, they will function as the guide RNA in this protocol.
    1. Referencing the created DNA file (Step 1.1.), enter ~150 nt of DNA sequence residing immediately upstream (5') or downstream (3') of the miRNA hairpin/cluster locus targeted for deletion into the bioinformatic guide RNA design software tool23.
      NOTE: The design tool will identify unique 20 nt sequences for crRNA oligonucleotide design that reside immediately adjacent to the PAM sequence (on the nontargeted DNA strand) (e.g., S. pyogenes Cas9 PAM sequence NGG). Provided below is an example of crRNA design targeting a site immediately upstream (5') of the mir-891a gene locus (specifically 5A(891a) discussed in the representative results section and Table 1).
      1. Open the guide RNA design software tool23.
      2. Enter the name 5A(891a) in the Enter Name window.
      3. In the Enter a DNA sequence window, enter 150 nt of genomic sequence residing immediately upstream (5') of the mir-891a precursor gene: 5'-AAGAAAATATACATGCTGATAGTTACACAGG
        TTGTGAATAGTAAATTAGTATGTCATTTATTT
        TAGGTATTCAATGTTGCATAGTCATATTATA
        ATTACGTAGCTTCTTTGTTTTTTTCTAGGTT
        CCCAAAGAGTCTACAAATGTTGTCT-3'
      4. Check the box marked Enable Specificity Check to exclude off-targeting sites detected computationally by the program. Choose the appropriate organism (i.e., Human [Homo sapiens]).
      5. Specify the correct Cas9 enzyme PAM employed for the studies, in this case, Streptococcus pyogenes Cas9-PAM:NGG, to generate the following default settings: PAM relative to target: After; Repeat Sequence: GUUUUAGAGCUAUGCUGUUUUG; Relative to Guide: 3; Target sequence length: 20; Cut relative to target 5' start: Sense 17 Anti-sense 17.
      6. Click on the Next button to view the results for synthetic crRNA synthesis.
        NOTE: In this example, the suggested crRNA to be synthesized will recognize the DNA target ATACATGCTGATAGTTACAC and will be located adjacent to PAM:AGG.
    2. Reference the DNA file (created in Step 1.1.) to determine the best candidate crRNA 20 nt target sequences that reside closest to the miRNA locus to be deleted and possess the highest specificity for the intended genomic target.
      1. Use computational off-targeting analysis tools to evaluate the candidate crRNA specificity and predict potential off-targeting sites in genomic loci unrelated to the targeted miRNA cluster region of interest (e.g.,24,25,26,27).
      2. Record potential off-targeting results for later reference when genotyping single-colony CRISPR clonal cell lines by PCR (Step 4.2.6.).
        NOTE: The extent of sequence complementarity shared between the designed crRNA oligonucleotide and the genomic target sequence will dictate how selectively the Cas9 enzyme cleaves the genome at that locus. Since the guide RNA anneals to the genomic target in a 3' to 5' direction, mismatches at the 5' end of the DNA target sequence (the first 8-10 bases) will often block Cas9-mediated cleavage. If the genomic target sequence shares homology with another genomic locus, except within the first eight bases of the DNA sequence, this guide RNA is predicted to have a low chance of off-targeting at this site.
      3. Design four unique crRNAs for each targeted miRNA locus: two designed crRNAs to target complementary DNA sequences immediately 5' of the miRNA hairpin/cluster (5'A, 5'B) and two designed crRNAs to target complementary DNA sequences immediately 3' of the miRNA hairpin/cluster (3'A, 3'B).
        NOTE: When performing the CRISPR transfections (in Section 3), four possible 5' and 3' guide RNA pair combinations (5'A + 3'A; 5'A + 3'B; 5'B + 3'A; 5'B + 3'B) will be tested for each targeted miRNA locus to increase the probability of generating successful miRNA locus deletions in a single experiment.
      4. Use a feature editing tool in the created DNA file (Step 1.1.) to mark the DNA target sequence (with adjacent PAM) for each designed crRNA to be synthesized.
  3. Design and synthesize PCR primers (forward, reverse) flanking the targeted miRNA cluster regions for genotyping CRISPR cell lines (and label the primers in the created DNA file).
    1. For genotyping cell lines carrying small genomic deletions for closely clustered or individual miRNAs, design PCR primers (forward, reverse) residing approximately 150 bp on each side of the Cas9 cleavage site/knockout region that will enable detection of both the wildtype (~600 bp) and knockout (~300 bp) DNA fragments in a single PCR reaction via gel electrophoresis.
    2. For genotyping cell lines carrying large genomic deletions for miRNA precursor combinations or the entire miRNA cluster, again design PCR primers (forward, reverse) residing approximately 150 bp on each side of the Cas9 cleavage/knockout site. Note that, if the targeted miRNA cluster deletion spans >4 kb in length, the PCR reaction will likely only detect the smaller (~300 bp) knockout DNA fragment but not the wildtype DNA fragment. Therefore, design additional PCR primers (forward, reverse) that can detect the presence or absence of internal miRNA cluster genes to aid the screening processĀ and validate for homozygous knockout cell lines.

2. Generation of stable lentiviral cell lines carrying the DOX-inducible Cas9 expression cassette

NOTE: Perform all cell culture and virus work in a certified biosafety hood using BSL2 procedures and aseptic technique.

  1. Determine the appropriate cell line type for the CRISPR studies and preferred growth media.
    NOTE: This protocol was developed for human prostate cancer cell lines LNCaP (preferred medium: RPMI, 10% fetal bovine serum [FBS]) and PC3-ML (preferred medium: DMEM, 10% FBS).
  2. Perform a blasticidin "death" curve to determine the optimal drug concentration to select for lentivirus-infected cells carrying the blasticidin resistance gene cassette (Step 2.3.).
    1. Plate cells into 11 wells of a 24-well plate and grow at 37 °C, 5% CO2 in the preferred medium until approximately 75% confluent.
    2. Dilute the blasticidin (working stock 1 mg/mL) in the preferred medium with a final concentration ranging from 0, 1, to 10 µg/mL and diluted in 1 µg/mL increments.
    3. Label the wells of the seeded 24-well plate from 1 to 11. Remove the growth medium from the wells and replace with the appropriate blasticidin concentrations.
    4. Change the medium with the appropriate blasticidin concentrations every other day for 7-10 days.
    5. Examine the cells daily during the time course and determine the minimum blasticidin concentration required to kill all the cells within 5-7 days.
      NOTE: A blasticidin "kill" curve will need to be performed for each specific cell line employed for the CRISPR gene editing experiments.
  3. Infect the cells with lentivirus carrying the DOX-inducible Cas9 expression cassette and perform blasticidin selection using the optimal concentration determined in Step 2.2.
    1. In three wells of a 6-well plate, seed 5 Ɨ 104 cells per well and grow in the preferred medium at 37 °C, 5% CO2 overnight (ON).
    2. The next day, thaw the lentivirus expression vector for DOX-inducible Cas9 (Lenti-iCas9) on ice. Gently mix (do not vortex virus particles).
      NOTE: Store the lentivirus in aliquots at -80 °C to avoid multiple freeze/thaw cycles, which will decrease viral titers and infection efficiency.
    3. Calculate the volume needed to transduce 5 Ɨ 104 cells with virus at a multiplicity of infection of 0.3 (MOI = 0.3) based on the viral titer concentration.
    4. Pipet the appropriate virus volume into 250 µL (per well) of serum-free and antibiotic-free preferred medium supplemented with 0.8 µg/mL hexadimethrine bromide. Mix gently.
      NOTE: Hexadimethrine bromide is a cationic polymer found to increase viral adsorption and infection efficiency.
    5. Remove the medium. Add the 250 µL of prepared transduction medium with Lenti-iCas9 virus (MOI = 0.3) to the cells and incubate ON at 37 °C, 5% CO2. (Shorten the incubation time to 4-6 h if the cells exhibit virus-related toxic effects.)
    6. Replace the medium with fresh preferred medium and allow the cells to recover for 1-2 days.
    7. Perform blasticidin selection on the infected cells for 10-14 days using the optimal blasticidin concentration derived from the "kill" curve described in Step 2.2.
      1. In parallel, grow the uninfected cells in medium with the optimal blasticidin concentration to be used as a positive control for viral selection.
    8. Change the medium supplemented with the optimal blasticidin concentration every 3 days during the selection time course to remove dead cells.
      NOTE: Only cells that survive blasticidin selection will have integrated the lentiviral vector.
    9. Expand the blasticidin-selected Lenti-iCas9 cell lines.
      NOTE: Record the cell passage number upon each expansion.
      1. Freeze a portion of the Lenti-iCas9 cells in preferred medium supplemented with 10% dimethyl sulfoxide (DMSO) for long-term cryovial storage.
      2. Analyze a portion of the Lenti-iCas9 cells by western blot9Ā to identify the cell line exhibiting the most robust DOX-inducible Cas9 protein levels (see Step 2.3.).
  4. Perform a doxycycline concentration curve on newly established Lenti-iCas9 cell lines to determine the optimal conditions for Cas9 protein induction.
    1. Set up four independent 6-well plates for each cell line tested to perform this DOX concentration time course. Plate 5 Ɨ 104 cells per well of each 6-well plate and grow at 37 °C, 5% CO2 in the preferred medium for 24 h.
    2. Dilute DOX (working stock 1 mg/mL) in the preferred medium with a final DOX concentration curve ranging from 0, 50, 100, 150, 250 to 500 ng/mL.
    3. Label the wells of each seeded 6-well plate from 1 to 6. Remove the medium and replace with the appropriate DOX concentrations. Grow plates 1-4 until the following time points: 24 h, 48 h, and 72 h DOX induction; and 120 h post DOX withdrawal (initially 72 h DOX-induced).
    4. Harvest the wells of the plate at each time point using appropriate methods (e.g., trypsinization). Store the cell pellets at -80 °C. Process the cell pellets in RIPA buffer for lysate isolation and Cas9 western blot analysis.
      1. Run 40 µg of cell lysate for each sample of the DOX-induction time course using a denaturing 4%-12% Bis-Tris gel and transfer the proteins to an immunoblot membrane.
      2. Hybridize the immunoblot membrane with a primary antibody against Cas9 to detect the 160 kDa protein. Normalize Cas9 levels using a housekeeping gene such as GAPDH (37 kDa).
    5. Based on the western blot results, determine the optimal DOX concentration to induce Cas9 in the Lenti-iCas9 cell lines.
      NOTE: This time course will also reveal how tightly Cas9 expression is regulated upon 120 h post DOX removal.
    6. Establish single-cell colonies for the Lenti-iCas9 cell lines showing robust Cas9 protein expression to optimize the CRISPR transfections (in Section 3).

3. Performing CRISPR reactions by Cas9 induction and synthetic guide RNA transfection of cells using a high-throughput format

NOTE: A workflow diagram is shown in Figure 1.

  1. On paper, map out the crRNA pair combinations that will be transfected into each well of a 24-well plate targeting the entire miRNA cluster, various clustered miRNA gene combinations, as well as individual miRNA cluster members.
    1. On the map, label four wells per targeted miRNA locus. Have each well represent a transfection reaction, with two unique crRNAs positioned 5' and 3' of the desired miRNA knockout genomic locus and the tracrRNA (annealed 1:1 molar ratio).
    2. Ensure that each of the four labeled wells represents a unique crRNA pair for transfection (e.g., 5'A + 3'A; 5'A + 3'B; 5'B + 3'A; 5'B + 3'B).
      NOTE: The design of two 5' crRNAs and two 3' crRNAs flanking each targeted miRNA locus (Section 1) enables the generation of four possible 5' and 3' guide RNA pairs in the transfection reaction.
  2. Plate the Lenti-iCas9 cell line at 5 x 104 cells/well of a 24-well plate in the preferred medium containing the optimized DOX concentration (determined in Step 2.4.). Grow the cells for 24-48 h at 37 °C, 5% CO2 to induce Cas9 protein expression.
  3. Transfect the Lenti-iCas9 cells with the prepared 5' and 3' guide RNAs.
    1. Reconstitute the synthesized crRNA and tracrRNA oligonucleotides with nuclease-free water to a stock concentration of 10 µM. Store at -80 °C long term.
    2. Label four 1.5 mL microcentrifuge tubes per targeted miRNA locus based on the experimental map designed in Step 3.1., representing the four possible 5' and 3' crRNA pair combinations (5'A + 3'A; 5'A + 3'B; 5'B + 3'A; 5'B + 3'B).
    3. In each tube, mix a 1:1 molar ratio of tracrRNA and unique crRNAs (5' and 3') together to form the 2 µM guide RNA complex using the following reaction (final volume of 10 µL):
      1. Add 2.5 µL of tracrRNA (10 µM stock), 1.25 µL of the 5' positioned crRNA (10 µM stock), 1.25 µL of the 3' positioned crRNA (10 µM stock), and 5 µL of 10 mM TRIS-HCL pH 7.5 to a 1.5 mL centrifuge tube. Microcentrifuge for 30 s at 16,000 Ɨ g to mix. Incubate at room temperature (RT) for 5 min.
    4. To each tube, add 40 µL of reduced serum medium (e.g., Opti-MEM) to the 10 µL of guide RNA complex reaction (50 µL total volume). Mix gently by pipetting up and down.
    5. In a clean 1.5 mL centrifuge tube, mix 2 µL of the transfection reagent28 (see NOTE 3.3.5.1.) and 48 µL of reduced serum medium (e.g., Opti-MEM, final volume of 50 µL) gently by pipetting up and down. Incubate at RT for 5 min.
      1. Prepare a master mix of the transfection reagent by multiplying the reagent (2 µL) and reduced serum medium (e.g., Opti-MEM, 48 µL) amounts by the number of wells to be transfected, plus 10% extra volume to account for slight pipetting inaccuracies.
        NOTE: Select a transfection reagent that is optimized for small RNA and CRISPR RNA oligonucleotide transfections, as well as for the cell line type28.
    6. To each tube containing the 50 µL of guide RNA mix (from Step 3.3.4.), add the 50 µL of the diluted transfection reagent (from Step 3.3.5.). Pipet the mixture slowly up and down once to mix. Incubate at RT for 20 min.
    7. Add 400 µL of antibiotic-free medium supplemented with DOX (optimal concentration) to each tube containing the 100 µL of the guide RNA/transfection mix. Pipet gently to mix.
  4. Remove the medium from the DOX-induced Lenti-iCas9 cells (Step 3.2.). Add 500 µL of media/DOX/guide RNA/transfection mix based on the 24-well plate experimental map (Step 3.1.). Incubate the transfected cells for 48 h at 37 °C, 5% CO2.
  5. Replace the medium with the fresh preferred medium without DOX (to clear Cas9 protein from the cells). Allow the cells to recover for another 24-48 h at 37 °C, 5% CO2.
  6. Harvest the transfected cells (trypsinization) and prepare for genotyping and single-cell dilutions.
    NOTE: Cells represent a mixed population containing transfected CRISPR gene-edited and untransfected wild-type cells. This step will determine the efficiency of CRISPR editing before investing time/resources in single-cell colony expansion.
    1. Wash the cells 1x with 1 mL of phosphate-buffered saline (PBS). Incubate the cells in 100 µL of trypsin for 5 min at 37 °C, 5% CO2 and transfer the cells to a clean 1.5 mL centrifuge tube containing 1 mL of medium.
    2. Invert to mix and microcentrifuge the cells for 5 min at 200 Ɨ g at 20 °C. Remove the medium and resuspend the cell pellet in 1 mL of PBS.
    3. Microcentrifuge the washed cells for 5 min at 200 Ɨ g at 20 °C. Remove the PBS and resuspend the cell pellet in 150 µL of the preferred medium.
  7. Determine the cell number per microliter of the 150 µL of resuspended cells using a hemocytometer or automated cell counting instrument.
  8. Separate the 150 µL of resuspended cells into three parts.
    1. Freeze 1/3 of transfected cells (50 µL) in medium plus 10% DMSO (final volume of 150 µL) in cryovials for future expansion/long-term storage.
    2. Transfer 1/3 of transfected cells (50 µL) into a clean 0.2 mL PCR tube for genotyping.
      1. Microcentrifuge the cells for 5 min at 200 Ɨ g at 4 °C and remove the medium.
      2. Resuspend the cell pellet in 100 µL of PBS.
      3. Microcentrifuge the cells for 5 min at 200 Ɨ g at 4 °C and remove the PBS. Store mixed-population cell pellets long term at -80 °C.
      4. Process the cell pellet for genotyping using the workflow in Section 4.
    3. Prepare the final 1/3 of the cells (50 µL) for dilution and plating in a 96-well plate format to generate single-cell colonies.
      1. Based on the cell count in Step 3.7., calculate the dilutions required to achieve 10, 5, 2, and 1 cell(s) in 100 µL of medium per well of a 96-well plate.
      2. Using a 12-channel multi-pipettor and a sterile reagent reservoir, add 100 µL of diluted cells per well to two rows of the plate (24 wells total) for each dilution (10, 5, 2, or 1 cell per well). Allow 4-6 weeks for the cells to grow to confluency for single-cell colony expansion. Observe the cells weekly under a light microscope and note if the colonies represent single- or multiple-cell colonies.
      3. Collect ~10-15 single-cell colonies for genotyping (Section 4). Identify at least three independent, knockout, single-cell colony lines for each targeted miRNA locus. Retain wild-type single-cell lines as controls.
        NOTE: The screening number will depend on the cell line type and the impact of miRNA knockout phenotype on cell growth/viability.

4. PCR genotyping of CRISPR cell lines using crude cell lysates

  1. Harvest individual, single-cell colonies from near-confluent wells of a 96-well plate.
    NOTE: The removal of medium/PBS described in these steps can be performed manually using a vacuum aspirator in the biosafety cabinet, but be careful to avoid cross-contamination. Use a new sterile "yellow" 200 µL pipetman tip for each well of the 96-well plate when aspirating, in which each exchanged yellow tip is firmly placed at the end of a sterile glass pasture pipette attached to the vacuum aspirator.
    1. Wash the wells 1x with 100 µL of PBS. Aspirate the PBS.
    2. Add 50 µL of trypsin and incubate for 2-5 min at 37 °C, 5% CO2.
    3. Gently pipet up and down and transfer the resuspended cells into a 1.5 mL centrifuge tube containing 1 mL of medium.
    4. Invert to mix and gently pellet the cells in a microcentrifuge for 5 min at 200 Ɨ g at 20 °C.
    5. Remove the medium and add 1 mL of PBS. Gently flick the tube to disrupt the pellet and invert several times to mix.
    6. Microcentrifuge for 5 min at 200 Ɨ g at 20 °C to pellet the cells.
    7. Remove the PBS and resuspend the pellet in 300 µL of fresh PBS.
    8. Split the 300 µL sample into two parts.
      1. Transfer 200 µL of the cells (2/3 of the pellet) to a well of a 24-well plate containing 1 mL of the preferred medium. Once the genotype is validated, use these cells to expand the CRISPR-mediated knockout cell lines for functional analysis.
      2. Transfer 100 µL of the cells (1/3 of the pellet) to a 0.2 mL PCR tube. Microcentrifuge for 5 min at 3,000 x g at 4 °C. Remove the PBS. Store the pellet at -80 °C.
  2. Prepare crude cell lysates for genotyping and sequence analysis using the PCR primers designed in Step 1.3. Include the cell lysates prepared from untransfected cells in these experiments to use as wild-type positive controls.
    1. Resuspend the cell pellet in 4 µL of 5x DNA polymerase buffer (see the Table of Materials, final concentration 1x), 1 µL of Proteinase K (20 ng/mL stock), 1 µL of RNase A (10 ng/mL stock), and nuclease-free water up to a total volume of 20 µL.
    2. Lyse the cells in a thermocycler using a PCR program: 56 °C for 30 min and 96 °C for 5 min. Store the cell lysates at -20 °C.
    3. Perform a PCR reaction using the designed PCR primers (forward, reverse) that flank the guide RNA 5' and 3' guide RNA targeted sites (Table 1).
      NOTE: The DNA polymerase buffer and thermocycler conditions will depend on the Taq DNA polymerase enzyme used for the PCR reaction. This protocol was optimized for a Phusion HF DNA Polymerase.
      1. Set up the PCR reaction mix on ice: 5 µL of 5x DNA polymerase buffer, 0.5 µL of forward PCR primer (10 µM stock), 0.5 µL of reverse PCR primer (10 µM stock), 0.5 µL of 10 mM dNTPs, 0.25 µL of DNA Polymerase, 1-4 µL of cell lysate, and nuclease-free water up to a total volume of 25 µL.
      2. Run the PCR reaction in a thermocycler using the program: 98 °C for 3 min, and 35 cycles of 98 °C for 10 s, 62 °C for 15 s, 72 °C for 15 s, and then 72 °C for 10 min. Hold for 4 °C. See NOTE 4.2.3. above.
    4. Load the PCR products onto a 1% agarose gel for electrophoresis analysis.
    5. Extract DNA from the isolated PCR fragments of the predicted molecular size for the knockout (and wild-type) genotypes. Prepare the samples for DNA sequencing.
    6. Validate that the CRISPR reaction was successful and perform DNA sequencing of the isolated PCR fragments to identify the Cas9 cleavage site and confirm miRNA locus deletion.
      1. Isolate at least three independent knockout cell lines for each miRNA locus targeted by CRISPR. Retain wild-type (and heterozygous) cell lines to use as controls in downstream functional studies.
      2. Perform qRT-PCR or northern blot analysis to confirm that the knockout cell lines do not express mature miRNA for the deleted locus.
        NOTE: Whole-genome sequencing (WGS) is the most definitive method to validate CRISPR gene editing and off-targeting.
      3. Test for CRISPR off-targeting effects by PCR, which were predicted computationally (Step 1.2.3.)24,25,26,27.
      4. If extensive single-cell colony screening only results in heterozygous genotypes, repeat the guide RNA transfection in the single-cell heterozygous lines.
        NOTE: Inability to obtain homozygous knockout cell lines could indicate lethal effects due to miRNA loss or inherent genomic complexity (e.g., chromosome duplications/fusions) of the parental cell line that require further analysis.

Access restricted. Please log in or start a trial to view this content.

Results

This high-throughput CRISPR deletion protocol was successfully employed using transfection of Cas9-inducible LNCaP and PC3-ML human cancer cell lines with synthetic oligonucleotide guide RNAs targeting the miR-888 cluster, which were studied in the context of prostate cancer. The miR-888 cluster was initially identified in an expression profiling screen as being elevated in prostate cancer patients with high-grade disease compared to low-grade and noncancer patients9,1...

Access restricted. Please log in or start a trial to view this content.

Discussion

This CRISPR gene editing procedure allows the investigator to quickly generate an entire panel of cell lines carrying unique miRNA cluster deletion combinations. The transfection of synthetic guide RNAs composed of 5' and 3' genomic site-specific crRNAs annealed with synthetic tracrRNA (1:1 molar ratio) in this protocol avoids time-consuming plasmid vector subcloning and allows for a more flexible and high-throughput experimental design using a 24-well format. The generation of cell lines carrying a DOX-inducible...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors have no conflicts of interest to disclose.

Acknowledgements

PC3-ML cell lines were kindly provided by Mark Stearn (Drexel University College of Medicine). Justin Toxey aided in PCR genotyping. This work was supported by a Breedan Adams Foundation Grant, a Ryan Translational Research Fund, and a Commonwealth Health Research Board Grant (CHRB-274-11-20) to AE-K.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
0.2 mL PCR tubes, flat capFisher14-230-225Plasticware
1.5 mL Microcentrifuge TubesSeal-Rite1615-5500Plasticware
24-well tissue culture plateCorning CostarĀ 09761146Plasticware
5x Phusion HF BufferThermo ScientificF-518LPCR reagent, genotyping
6-well tissue culture plateFisherFB012927Plasticware
96-well tissue culture plateFalcon08-772-2CPlasticware
Anti-CRISPR-Cas9 antibody [7A9-3A3], Mouse monoclonalAbCamab191468Western blot reagent; 160 kDa; dilution 1:200
Antibiotic-Antimycotic (100x)Gibco15240062Tisuue culture reagent
BLAST nucleotide search engineNational Center for Biotechnology InformationNAFreeware; website: blast.ncbi.nlm.nih.gov
Blasticidin S, Hydrochloride, Streptomyces griseochromogenesCalbiochemCAS 589205CRISPR reagent; Chemical, Working stock = 1 mg/mL in water
Countess 3 Automated Cell CounterInvitrogenA50298Equipment; Cell counter
Cryogenic tubesThermo Scientific50001012Plasticware
Dharmacon CRISPR Design ToolHorizon Discovery Ltd.NAFreeware; website: horizondiscovery.com/en/ordering-and-calculation-tools/crispr-dna-region-designer
DharmaFECT siRNA Transfection Reagent #2Dharmacon, Inc.T-2002-02Transfection reagent; LNCaP and PC3-ML cell lines
Dimethyl sulfoxide (DMSO)FisherĀ BP231100Tisuue culture reagent
DMEM Medium with L-Glutamine, 4.5g/L Glucose and Sodium PyruvateCorningMT10013CVTisuue culture reagent; Media for PC3-ML cells
Doxycycline Hydrochloride, Ready Made SolutionSigma-AldrichD3072-1MLCRISPR reagent; Chemical, Working stock = 1 mg/mL stock in water
DPBS, no calcium, no magnesiumGibco14190144Tisuue culture reagent
Edit-R CRISPR-Cas9 Synthetic tracrRNA, 20 nmol, designedDharmacon, Inc.U-002005-20CRISPR reagent; Universal tracrRNA oligonucleotides
Edit-R Modified Synthetic crRNA,
desalted/deprotected, 2 nmol
Dharmacon, Inc.crRNA-460XXXCRISPR reagent; Designed crRNA oligonucleotides
EditR Inducible Lentiviral hEF1aBlastCas9 Nuclease Particles, 50 μL, 107 TU/mLDharmacon, Inc.VCAS11227CRISPR reagent; Lenti-iCas9; Doxycycline-inducible lentiviral Streptococcus pyogenes Cas9 vector system
Ensembl genomic viewerEnsemblNAFreeware; website: [ensembl.org] Use: Genome browser to identify a nucleotide seuqnces containing the miRNA cluster and surrounding gene/regulatory sequences.
GAPDH Antibody (FL-335), rabbit polyclonalSanta Cruz Biotechnologysc25778Western blot reagent; 37 kDa; dilution 1:500
Gel/PCR DNA Fragment Extraction KitIBI ScientificIB47010Nucleic acid gel electrophoresis reagent
Gibco Fetal Bovine Serum, certifiedGibco16000044Tisuue culture reagent
Hexadimethrine bromideMilliporeSigmaH9268CRISPR reagent; Chemical, Working stock = 0.8 mg/mL
Immobilon-FL PVDF MembraneMilliporeSigmaIPFL10100Western blot reagent; nitrocellulose
Intercept (TBS) Blocking BufferLI-COR927-60001Western blot reagent
IRDye 680RD Goat anti-Mouse IgG Secondary AntibodyLI-COR926-68070Western blot reagent
IRDye 800CW Goat anti-Rabbit IgG Secondary AntibodyLI-COR926-32211Western blot reagent
MicrocentrifugeEppendorfĀ 5425 RPlasticware
miRBase microRNA viewermiRBaseNAFreeware; website: [mirbase.org] Use: Borowser lists all annotated miRNA hairpins, mature miRNA sequences and associated clustered miRNAs mapping within 10 kb.
NuPAGE 4 to 12%, Bis-Tris, 1.0 mm, Mini Protein Gel, 10-wellInvitrogenNP0321BOXWestern blot reagent
Odyssey CLx Imaging SystemLI-CORCLxEquipment; Western blot imaging
Opti-MEM Reduced Serum MediumGibco31985062Transfection reagent
Owl D2 Wide-Gel Electrophoresis SystemOwlD2-BPEquipment; Nucleic acid gel electrophoresis system
PCR Primers, designed (single-stranded DNA oligonucleotides)Integrated DNA TechnologyNAPCR reagent, genotyping
Phusion High-Fidelity DNA Polymerase (2 U/µL)Thermo ScientificF530SPCR reagent, genotyping
RIPA Lysis Buffer 10xMilliporeSigma20-188Western blot reagent
Proteinase K Solution (20 mg/mL), RNA gradeInvitrogen25530049PCR reagent, genotyping
RNase A, DNase and protease-free (10 mg/mL)Thermo ScientificEN0531PCR reagent, genotyping
RPMI 1640 MediumGibcoMT10041CVTisuue culture reagent; Media for LNCaP cells
SnapGene ViewerSnap GeneNAFreeware; website: [snapgene.com]Ā Use: DNA sequence annotation software program to create a DNA file for gRNA design and whichĀ  highlights the miRNA cluster locus (intergenic, intronic), each individual miRNA hairpin sequence belonging to the miRNA cluster, and other nearby coding and non-coding genes and/or regulatory features
TrypLE Select Enzyme (1x), no phenol redGibco12563029Tisuue culture reagent; Recombinant trypsin
UltraPure AgaroseInvitrogen16500100Nucleic acid gel electrophoresis reagent
Veriti 96-Well Fast Thermal CyclerThermoFisher Scientific4375305Equipment
XCell SureLock Mini-Cell Electrophoresis SystemInvitrogenEI0001Equipment; Protein gel electrophoresis system

References

  1. Hasegawa, T., Lewis, H., Esquela-Kerscher, A. Translating MicroRNAs to the Clinic. Laurence, J. , Academic Press. 329-369 (2017).
  2. Lewis, H., Esquela-Kerscher, A. Systems Biology of Cancer. Thiagalingam, S. , Cambridge University Press. Ch. 9 134-153 (2015).
  3. Esquela-Kerscher, A., Slack, F. J. Oncomirs - microRNAs with a role in cancer. Nature Reviews Cancer. 6 (4), 259-269 (2006).
  4. Breving, K., Esquela-Kerscher, A. The complexities of microRNA regulation: mirandering around the rules. The International Journal of Biochemistry & Cell Biology. 42 (8), 1316-1329 (2010).
  5. Griffiths-Jones, S., Saini, H. K., van Dongen, S., Enright, A. J. miRBase: tools for microRNA genomics. Nucleic Acids Research. 36, Database issue 154-158 (2008).
  6. Kabekkodu, S. P., et al. Clustered miRNAs and their role in biological functions and diseases. Biological Reviews. 93 (4), 1955-1986 (2018).
  7. Xiang, J., Wu, J. Feud or friend? The role of the miR-17-92 cluster in tumorigenesis. Current Genomics. 11 (2), 129-135 (2010).
  8. Aqeilan, R. I., Calin, G. A., Croce, C. M. miR-15a and miR-16-1 in cancer: discovery, function and future perspectives. Cell Death & Differentiation. 17 (2), 215-220 (2010).
  9. Hasegawa, T., et al. Characterization and evidence of the miR-888 cluster as a novel cancer network in prostate. Molecular Cancer Research. , (2018).
  10. Lewis, H., et al. miR-888 is an expressed prostatic secretions-derived microRNA that promotes prostate cell growth and migration. Cell Cycle. 13 (2), 227-239 (2014).
  11. Xu, J., et al. Evidence for a prostate cancer susceptibility locus on the X chromosome. Nature Genetics. 20 (2), 175-179 (1998).
  12. Schleutker, J., et al. A genetic epidemiological study of hereditary prostate cancer (HPC) in Finland: frequent HPCX linkage in families with late-onset disease. Clinical Cancer Research. 6 (12), 4810-4815 (2000).
  13. Farnham, J. M., Camp, N. J., Swensen, J., Tavtigian, S. V., Albright, L. A. Confirmation of the HPCX prostate cancer predisposition locus in large Utah prostate cancer pedigrees. Human Genetics. 116 (3), 179-185 (2005).
  14. Brown, W. M., et al. Hereditary prostate cancer in African American families: linkage analysis using markers that map to five candidate susceptibility loci. British Journal Of Cancer. 90 (2), 510-514 (2004).
  15. Bochum, S., et al. Confirmation of the prostate cancer susceptibility locus HPCX in a set of 104 German prostate cancer families. Prostate. 52 (1), 12-19 (2002).
  16. Doudna, J. A., Charpentier, E. Genome editing. The new frontier of genome engineering with CRISPR-Cas9. Science. 346 (6213), 1258096(2014).
  17. Adli, M. The CRISPR tool kit for genome editing and beyond. Nature Communications. 9 (1), (2018).
  18. Jinek, M., et al. A programmable dual-RNA guided DNA endonuclease in adaptive bacterial immunity. Science. 337 (6096), 816-821 (2012).
  19. SnapGeneĀ® software (from Insightful Science; available at snapgene.com). , Available from: https://www.snapgene.com (2022).
  20. Ensembl Release 104 genome browser (from EMBL-EBI). , Available from: https://www.ensembl.org (2022).
  21. Howe, K. L., et al. Ensembl 2021. Nucleic Acids Research. 49, 884-891 (2021).
  22. miRBase: the microRNA database, Release 22.1 (from Griffiths-Jones laboratory). , Available from: https://www.mirbase.org (2022).
  23. Dharmacon CRISPR Design Tool (from Dharmacon). , Available from: https://www.horizondiscovery.com/en/ordering-and-calculation-tools/crispr-dna-region-designer (2022).
  24. Tools for Guide Design and Off-Target Prediction (MIT CRISPR Design Tool from the Zhang Lab). , Available from: http://crispr.mit.edu (2022).
  25. Sangsu Bae, J. P., Kim, J. -S. Cas-OFFinder (from Sangsu Bae, Jeongbin Park, Jin-Soo Kim). , Available from: http://www.rgenome.net/cas-offinder/ (2022).
  26. Off-Spotter (Venetia Pliatsika & Isidore Rigoutsos of the Jefferson Computational Medicine Center). , Available from: https://cm.jefferson.edu/Off-Spotter/ (2022).
  27. Bao, X. R., Pan, Y., Lee, C. M., Davis, T. H., Bao, G. Tools for experimental and computational analyses of off-target editing by programmable nucleases. Nature Protocols. 16 (1), 10-26 (2021).
  28. Dharmacon DharmaFECT Transfection Reagent Cell Type Guide. Choose Dharmacon DharmaFECT 1, 2, 3, or 4 for optimal transfection of siRNA or miRNA reagents. , Available from: https://horizondiscovery.com/-/media-Files/Horizon/resources/Selection-guides/dharmafect-cell-type-guidelines.pdf (2022).
  29. Baffoe-Bonnie, A. B., et al. A major locus for hereditary prostate cancer in Finland: localization by linkage disequilibrium of a haplotype in the HPCX region. Human Genetics. 117 (4), 307-316 (2005).
  30. Zhang, R., Peng, Y., Wang, W., Su, B. Rapid evolution of an X-linked microRNA cluster in primates. Genome Research. 17 (5), 612-617 (2007).
  31. Ohnuki, Y., Marnell, M. M., Babcock, M. S., Lechner, J. F., Kaighn, M. E. Chromosomal analysis of human prostatic adenocarcinoma cell lines. Cancer Research. 40 (3), 524-534 (1980).
  32. Beheshti, B., Karaskova, J., Park, P. C., Squire, J. A., Beatty, B. G. Identification of a high frequency of chromosomal rearrangements in the centromeric regions of prostate cancer cell lines by sequential giemsa banding and spectral karyotyping. Molecular Diagnosis. 5 (1), 23-32 (2000).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Tags

Noncoding RNA NetworksCancer Cell LinesCas9 Protein InductionPCR GenotypingGuide RNA DesignLentiviral TransfectionSingle Cell ColoniesGel Electrophoresis

Related Articles