A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Lentiviral Mediated Delivery of shRNAs to hESCs and NPCs Using Low-cost Cationic Polymer Polyethylenimine (PEI)

2.7K views

DOI:

10.3791/63953

May 24th, 2022

In This Article

Summary

Using the low-cost cationic polymer polyethylenimine (PEI), we produced lentiviral particles for stable expression of shRNAs in H9 human embryonic stem cells (hESCs) and transiently transduced H9-derived neural progenitor cells (NPCs) at high efficiency.

Abstract

The current protocol describes the use of lentiviral particles for the delivery of short hairpin RNAs (shRNAs) to both human embryonic stem cells (hESCs) as well as neural progenitor cells (NPCs) derived from hESCs at high efficiency. Lentiviral particles were generated by co-transfecting HEK293T cells using entry vectors (carrying shRNAs) along with packaging plasmids (pAX and pMD2.G) using the low-cost cationic polymer polyethylenimine (PEI). Viral particles were concentrated using ultracentrifugation, which resulted in average titers above 5 x 107. Both hESCs and NPCs could be infected at high efficiencies using these lentiviral particles, as shown by puromycin selection and stable expression in hESCs, as well as transient GFP expression in NPCs. Furthermore, western blot analysis showed a significant reduction in the expression of genes targeted by shRNAs. In addition, the cells retained their pluripotency as well as differentiation potential, as evidenced by their subsequent differentiation into different lineages of CNS. The current protocol deals with the delivery of shRNAs; however, the same approach could be used for the ectopic expression of cDNAs for overexpression studies.

Introduction

Human embryonic stem cells (hESCs) derived from the blastocyst inner cell mass are pluripotent and can be differentiated into different cell types depending upon external factors under in vitro conditions1,2. In order to fully harness the potential of hESCs, it is imperative to have rapid and reliable gene delivery methods for these cells. Conventionally, the techniques used can be broadly classified into two types: nonviral and viral gene delivery systems3,4. The more frequently used nonviral gene delivery systems are lipofection, electroporation, and nucleofection. Nonviral delivery systems are advantageous because of fewer insertion mutations and an overall decrease in immunogenicity5,6. However, these methods result in low transfection efficiency and a short duration of transient gene expression, which is a major limitation for long-term differentiation studies7. Electroporation results in better transfection efficiencies compared to lipofection; however, it results in more than 50% cell death8,9,10. Using nucleofection, the cell survival and transfection efficiency can be improved by combining lipofection and electroporation, but the approach needs cell-specific buffers and specialized equipment and, thus, becomes quite costly for scaled-up applications11,12.

In contrast, viral vectors have shown improved transfection efficiencies, as well as overall low cytotoxicity, following transduction. In addition, the genes delivered are stably expressed and, hence, make this method ideal for long-term studies13. Among the most commonly used viral vectors for gene delivery into hESCs are lentiviral vectors (LVS), which can give more than 80% transduction efficiency using high titer viral particles14,15. Lipofection and CaPO4 precipitation are amongst the most commonly used methods to transiently transfect HEK293T cells or its derivatives with gene transfer vectors along with packaging plasmids to yield lentiviral particles16. Although lipofection results in good transfection efficiency and low cytotoxicity, the technique is hampered by its cost, and scaling up to get high titer lentiviral particles would be very costly. CaPO4 precipitation results in relatively similar transfection efficiencies to those obtained using lipofection. Although cost-effective, CaPO4 precipitation results in significant cell death following transfections, which makes it difficult to standardize and to avoid batch-to-batch variations17. In this scenario, developing a method that gives high transfection efficiency, low cytotoxicity, and cost-effectiveness is crucial for the production of high titer lentiviral particles to be used in hESCs.

Polyethylenimine (PEI) is a cationic polymer that can transfect HEK293T cells at high efficiency without much cytotoxicity and has a negligible cost compared to lipofection-based methods18. In this situation, PEI can be used for scaled-up applications of high titer LVS production through the concentration of lentiviral particles from culture supernatants using various techniques. The presented article describes the use of PEI to transfect HEK293T cells and lentiviral vector concentration using ultracentrifugation through a sucrose cushion. Using this method, we regularly obtain titers well above 5 x 107 IU/mL with low batch-to-batch variations. The method is simple, straight-forward, and cost-effective for scaled-up applications for gene delivery to hESCs and hESCs-derived cells.

Access restricted. Please log in or start a trial to view this content.

Protocol

1. Transfection of HEK293T cells using either PEI or Lipofectamine 3000 reagent

  1. Culture HEK293T cells in DMEM + 10% FBS + 1x penicillin/streptomycin at 37 °C in a humidified incubator with an atmosphere of 5% CO2 and 21% O2 until they are 90% confluent before seeding for transfection. Use a relatively low passage number of cells for high titer virus production (ideally less than P30).
  2. Seed 4 x 106 cells in 10 mL of complete growth medium in a 100 mm tissue culture plate and grow overnight in a humidified tissue culture incubator with an atmosphere of 5% CO2 and 21% O2.
  3. For each transfection, dilute plasmid DNA (1 mg/mL stocks) in 1 mL of serum free DMEM media in 1.5 mL centrifuge tubes using the following ratio of entry and packaging plasmids:
    Entry vector = 10 µg
    psPAX2.0 = 7.5 µg
    pMD2.G = 5 µg
  4. Vortex for 10 s and spin the tube at 10,000 x g for 30 s at room temperature to collect.
  5. Add 70 µL of (1 mg/mL stock solution) PEI to the tube, and vortex and spin briefly as described above to collect. The volume of PEI used is based on a 1:3 ratio of total DNA (µg):PEI (µg).
  6. For lipofectamine-based transfection, dilute the above vectors in 500 µL of serum-free DMEM media containing 45 µL of reagent P supplied in the kit and incubate at room temperature for 5 min.
  7. Dilute 70 µL of reagent L supplied in the kit using 500 µL of serum-free DMEM media and incubate at room temperature for 5 min.
  8. Combine the contents of both tubes and incubate the tubes at room temperature for 20 min to allow complex formation.
  9. Add dropwise 1 mL of DNA/PEI or 1 mL of DNA/lipofectamine complexes to the plate containing cells and incubate for 6 h at 37 °C in a humidified incubator with an atmosphere of 5% CO2 and 21% O2.
  10. After 6 h, change to fresh complete growth media (10 mL) and return the cells back to the humidified incubator with an atmosphere of 5% CO2 and 21% O2.

2. LVS collection and ultracentrifugation

  1. After 2 days of transfection, collect the virus-containing media and overlay the cells again with 10 mL of fresh complete growth media.
  2. After 3 days of transfection, collect the virus-containing media and combine it with the virus-containing media collected at the 2 day time point.
  3. Centrifuge the viral supernatant at 2,000 x g for 10 min at 4 °C to pellet cellular debris.
  4. Filter the supernatant using a 0.45 µm pore size low protein binding filter (either PES or SFCA) and store at 4 °C until ready for ultracentrifugation. The filtered supernatant containing lentiviral particles can be stored at 4 °C for 5 days without a significant loss in viral titers.
  5. Sterilize the ultracentrifuge tubes holding cups by washing them with 70% ethanol for 10 min, air dry, close, and keep at 4 °C.
  6. Add 36 mL of filtered media containing lentiviral particles to a sterile ultracentrifuge tube.
  7. Fill 5 mL of a sterile stripette with 4 mL of sterile 20% sucrose solution (prepared in PBS) and dispense it right to the bottom of the ultracentrifuge tube (UC) containing LVS. It is important that the sucrose solution is not mixed with the media and makes a gradient at the bottom of the tube.
  8. Balance all the ultracentrifuge tubes using serum-free DMEM media, place in the cold ultracentrifuge tube holding cups, and close the lids.
  9. Spin the tubes at 125,000 x g for 2 h at 4 °C.
  10. After the spin, carefully discard the supernatant by inverting the contents of the tube in a container containing bleach without disturbing the pellet. Mark the pellet if visible.
  11. Place the ultracentrifuge tube in a 50 mL sterile tube and add 200 µL of sterile DPBS exactly at the top of the pellet. Keep at 4 °C overnight undisturbed.
  12. The following day, gently mix by pipetting up and down 40x.
  13. Briefly spin at 13,000 x g in a tabletop centrifuge to pellet any debris.
  14. Transfer the supernatant to a new tube and aliquot the virus preparation as 20 µL aliquots. Store at −80 °C.
  15. Set aside 5 µL of the preparation for viral titer measurements.

3. LVS titer measurement for pLKO.1-based vectors

  1. Determine the titer of lentiviral particles by using a qPCR following the manufacturer's recommendations.
  2. For a standard curve, prepare five 10-fold serial dilutions of Standard Control DNA (provided in the kit) by diluting 5 µL of DNA into 45 µL of nuclease-free H2O in each step. Use dilutions of 1:100 to 1:100,000 to generate a standard curve.
  3. Set up reactions on ice in duplicates in the following manner:
    2x qPCR master mix        10 µL
    Primer mix                          2 µL
    Sample or standard DNA   2 µL
    Nuclease-free H2O            6 µL
  4. Perform qPCR using the cycling conditions mentioned in the manual of the kit for a total of 35 cycles.
  5. Plot cycle threshold (Ct) values on the Y-axis vs. virus titer on the X-axis.
  6. Generate a logarithmic regression using four standard control DNA dilutions (1:100 to 1:100,000) to determine the unknown virus sample titer using a trendline equation.

4. LVS titer measurement for pll3.7-based vectors

  1. Seed 1 x 105 HEK293T cells in each well of a P12-well plate in 1 mL of complete growth media 24 h before infections.
  2. Supplement the media with 8 µg/mL polybrene and add 1 mL into each sterile 1.5 mL tube.
  3. Dilute the viral particles by using 4 µL, 2 µL, 1 µL, 0.5 µL, and 0.1 µL of concentrated lentiviral particles in each of the 1 mL of polybrene-containing media.
  4. Replace the media from HEK293T cells with the media containing indicated amounts of lentiviral particles along with 8 µg/mL polybrene and incubate for 24 h at 37 °C in a humidified incubator with an atmosphere of 5% CO2 and 21% O2.
  5. The next day, change to fresh media and continue the culture for 72 h at 37 °C in a humidified incubator with an atmosphere of 5% CO2 and 21% O2.
  6. After 72 h, wash the cells with PBS, trypsinize at 37 °C according to the manufacturer's protocol, and resuspend in 1 mL of PBS.
  7. Perform FACS cell sorting using a cell sorter, following the manufacturer's recommendations. Set the gate to 0% GFP positive cells using non-infected HEK293T cells and count 50,000 events for each sample to determine the percentage of positive cells for each viral dilution.
  8. Use only the volumes of lentiviral particles that give %GFP positive cells in the range of 2%-20% to calculate the titer of lentiviral particles.

5. Infection of hESCs and stable selection

  1. Wash the cells with 2 mL of PBS growing in each well of a 6-well cell culture multiwell plate.
  2. Detach the cells from the cell culture plate using 1 mL of 1x cell dissociation reagent by incubation at 37 °C for 5 min.
  3. Collect the cells in DMEM/F12 media and centrifuge at 1,500 x g for 5 min at room temperature to collect the cell pellet.
  4. Aspirate, resuspend the cells in 1 mL, and count using a hemocytometer.
  5. Make a cell suspension with 2 x 105 cells/mL of complete growth media containing mTeSR1 supplemented with 10 ng/mL basic fibroblast growth factor (bFGF), penicillin/streptomycin (P/S), and 10 µM ROCK Inhibitor (RI).
  6. Seed 1 x 105 cells on 50x diluted complete basement membrane matrix-coated P24-well plates in 500 µL of complete growth media and culture the cells at 37 °C in a humidified incubator with an atmosphere of 5% CO2 and 21% O2.
  7. The following day, infect hESCs at a multiplicity of infection (MOI) of 10 with 8 µg/mL polybrene and incubate at 37 °C for 8 h.
  8. After 8 h, replace the virus-containing media with fresh growth media (-RI) and continue the culture until the cells are 90% confluent.
  9. Start puromycin selection (0.8 µg/mL) when the cells reach 90% confluency, which is usually 48-72 h post infection.
  10. After selection is complete (usually 4-6 days), split the stable cells (1:4) and expand the cells for cryopreservation and further analysis.

6. Transduction of H9-derived neural progenitor cells (NPCs)

NOTE: NPCs were derived from H9 cells using a dual-Smad inhibition protocol, as described previously19.

  1. Briefly, treat H9 cells with cell dissociation reagent at 37 °C for 5 min to generate single cells and resuspend in complete growth media containing mTeSR1 supplemented with 10 ng/mL basic fibroblast growth factor (bFGF), penicillin/streptomycin (P/S), and 10 µM ROCK Inhibitor (RI). Seed on 1:50 diluted Matrigel-coated 6-well cell culture dishes at a density of 60,000 cells/cm2 (day 0).
  2. Initiate differentiation when the cells reach 95%-100% confluency by changing to 100% KSR media containing LDN193189 (200 nM), and SB431542 (10 µM) (day1).
  3. On day 2, change the media again with 100% KSR supplemented with LDN193189 (200 nM), SB431542 (10 µM), and XAV939 (5 µM).
  4. On day 4 of differentiation, switch to a mixture of KSR medium (75%) and N2 medium (25%) with LDN193189 (200 nM), SB431542 (10 µM), and XAV939 (5 µM).
  5. From day 6 to day 12, gradually switch the media to 100% N2 supplemented with LDN193189 (200 nM), SB431542 (10 µM), and XAV939 (5 µM) by increasing the N2 media 25% each day and changing the media after every 2 days.
  6. Culture day 12 NPCs in N2:B27 media supplemented with 20 ng/mL bFGF.
  7. Seed 2 x 105 cells in each well of a 1:50 diluted complete basement membrane matrix-coated P6-plate in 2 mL of NPCs culture media and incubate to allow the cells to attach.
  8. The next day, infect the cells with lentiviral particles at an MOI 6 in the presence of 8 µg/mL polybrene.
  9. After 8 h, replace the virus-containing media with fresh NPC growth media.
  10. The next day, repeat the infections and change the media at 8 h.
  11. Keep the cells in culture for 72 h before harvesting for further analysis.

Access restricted. Please log in or start a trial to view this content.

Results

Following gene transfer, high viability of hESCs is inevitably required. Despite the efforts and optimization of protocols to reduce cell death following electroporation of hESCs, more than 50% cell death is still observed after electroporation of these cells, along with low transfection efficiency20. Lentiviral mediated gene transfer not only results in high efficiency of gene transfer but also demonstrates high levels of cell viability following transduction. The results below present two approa...

Access restricted. Please log in or start a trial to view this content.

Discussion

The ability to genetically modify stem cells for study or clinical purposes is limited both by technology and the basic understanding of the biology of hESCs. Techniques that have shown significant potential in mouse ESCs, like lipofection and electroporation, are not highly efficient for hESCs, which are notoriously difficult for gene delivery by conventional methods20. This notion has led to not only the optimization of existing techniques but also the development of novel methods for increased ...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors declare that there is no conflict of interest.

Acknowledgements

This work was supported by research grants from the United Arab Emirates University (UAEU), grant # 31R170 (Zayed Center for Health Sciences) and # 12R010 (UAEU-AUA grant). We thank Prof Randall Morse (Wadsworth Center, Albany, NY) for helping us to edit the manuscript for style and grammar.

All data are available upon request.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
2-MercaptoethanolInvitrogen31350010
38.5 mL, Sterile + Certified Free Open-Top Thinwall Ultra-Clear TubesBeckman CoulterC14292
AccutaseStem Cell Technologies7920
bFGF Recombinant humanInvitrogenPHG0261
Bovine serum albumin FRAC VInvitrogen15260037
Corning Matrigel Basement Membrane Matrix, LDEV-freeCorning354234
CyclopamineStem Cell Technologies72074
DMEM mediaInvitrogen11995073
DMEM Nutrient mix F12 Invitrogen11320033
DPBS w/o: Ca and MgPAN BiotechP04-36500
Fetal bovie serumInvitrogen10270106
GAPDH (14C10) Rabbit mAb AntibodyCST2118S
Gentle Cell Dissociation ReagentStem Cell Technologies7174
HyClone Non Essential Amino Acids (NEAA) 100X SolutionGE healthcareSH30238.01
L Glutamine, 100X Invitrogen2924190090
L2HGDH Polyclonal antibodyProteintech15707-1-AP
L2HGDH shRNAMacrogenSeq: CGCATTCTTCATGTGAGAAAT
Lipofectamine 3000 kitThermo FisherL3000001
mTesR1 complete mediaStem Cell Technologies85850
Neurobasal medium 1X CTSInvitrogenA1371201
Neuropan 2 Supplement 100xPAN BiotechP07-11050
Neuropan 27 Supplement 50xPAN BiotechP07-07200
Penicillin streptomycin SOLInvitrogen15140122
pLKO.1 TRC vectorAddgene10878
pLL3.7 vector Addgene11795
pMD2.GAddgene12259
Polybrene infection reagentSigmaTR1003- G
Polyethylenimine, branchedSigma408727
psPAX2.0Addgene12260
PurmorphamineTocris4551/10
PuromycinInvitrogenA1113802
ROCK inhibitor Y-27632
dihydrochloride 
Tocris1254
SB 431542Tocris1614/10
Trypsin .05% EDTA Invitrogen25300062
XAV 939Tocris3748/10

References

  1. Thomson, J. A., et al. Embryonic stem cell lines derived from human blastocysts. Science. 282 (5391), 1145-1147 (1998).
  2. Reubinoff, B. E., Pera, M. F., Fong, C. Y., Trounson, A., Bongso, A. Embryonic stem cell lines from human blastocysts: Somatic differentiation in vitro. Nature Biotechnology. 18 (4), 399-404 (2000).
  3. Strulovici, Y., Leopold, P. L., O'Connor, T. P., Pergolizzi, R. G., Crystal, R. G. Human embryonic stem cells and gene therapy. Molecular Therapy. 15 (5), 850-866 (2007).
  4. Kane, N., McRae, S., Denning, C., Baker, A. Viral and nonviral gene delivery and its role in pluripotent stem cell engineering. Drug Discovery Today. Technologies. 5 (4), 105(2008).
  5. Li, S. D., Huang, L. Nonviral is superior to viral gene delivery. Journal of Controlled Release. 123 (3), 181-183 (2007).
  6. Mastrobattista, E., Bravo, S. A., vander Aa, M., Crommelin, D. J. Nonviral gene delivery systems: From simple transfection agents to artificial viruses. Drug Discovery Today. Technologies. 2 (1), 103-109 (2005).
  7. Cao, F., et al. Comparison of gene-transfer efficiency in human embryonic stem cells. Molecular Imaging and Biology. 12 (1), 15-24 (2010).
  8. Mohr, J. C., de Pablo, J. J., Palecek, S. P. Electroporation of human embryonic stem cells: Small and macromolecule loading and DNA transfection. Biotechnology Progress. 22 (3), 825-834 (2006).
  9. Sukhorukov, V. L., et al. Surviving high-intensity field pulses: Strategies for improving robustness and performance of electrotransfection and electrofusion. The Journal of Membrane Biology. 206 (3), 187-201 (2005).
  10. Floch, V., et al. Cationic phosphonolipids as non viral vectors for DNA transfection in hematopoietic cell lines and CD34+ cells. Blood Cells, Molecules and Diseases. 23 (1), 69-87 (1997).
  11. Lakshmipathy, U., et al. Efficient transfection of embryonic and adult stem cells. Stem Cells. 22 (4), 531-543 (2004).
  12. Siemen, H., et al. Nucleofection of human embryonic stem cells. Stem Cells and Development. 14 (4), 378-383 (2005).
  13. Zhang, X., Godbey, W. T. Viral vectors for gene delivery in tissue engineering. Advanced Drug Delivery Reviews. 58 (4), 515-534 (2006).
  14. Ma, Y., Ramezani, A., Lewis, R., Hawley, R. G., Thomson, J. A. High-level sustained transgene expression in human embryonic stem cells using lentiviral vectors. Stem Cells. 21 (1), 111-117 (2003).
  15. Gropp, M., et al. Stable genetic modification of human embryonic stem cells by lentiviral vectors. Molecular Therapy. 7 (2), 281-287 (2003).
  16. Tan, E., Chin, C. S. H., Lim, Z. F. S., Ng, S. K. HEK293 cell line as a platform to produce recombinant proteins and viral vectors. Frontiers in Bioengineering and Biotechnology. 9, 796991(2021).
  17. Merten, O. W., Hebben, M., Bovolenta, C. Production of lentiviral vectors. Molecular Therapy: Methods & Clinical Development. 3, 16017(2016).
  18. Lungwitz, U., Breunig, M., Blunk, T., Göpferich, A. Polyethylenimine-based nonviral gene delivery systems. European Journal of Pharmaceutics and Biopharmaceutics. 60 (2), 247-266 (2005).
  19. Parween, S., et al. Higher O-GlcNAc levels are associated with defects in progenitor proliferation and premature neuronal differentiation during in-vitro human embryonic cortical neurogenesis. Frontiers in Cellular Neuroscience. 11, 415(2017).
  20. Weissinger, F., et al. Gene transfer in purified human hematopoietic peripheral-blood stem cells by means of electroporation without prestimulation. Journal of Laboratory and Clinical Medicine. 141 (2), 138-149 (2003).
  21. Cui, Y., et al. Targeting transgene expression to antigen-presenting cells derived from lentivirus-transduced engrafting human hematopoietic stem/progenitor cells. Blood. 99 (2), 399-408 (2002).
  22. Yu, X., et al. Lentiviral vectors with two independent internal promoters transfer high-level expression of multiple transgenes to human hematopoietic stem-progenitor cells. Molecular Therapy. 7 (6), 827-838 (2003).
  23. Sweeney, N. P., Vink, C. A. The impact of lentiviral vector genome size and producer cell genomic to gag-pol mRNA ratios on packaging efficiency and titre. Molecular Therapy - Methods & Clinical Development. 21, 574-584 (2021).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Lentiviral DeliveryshRNA TransfectionHuman Embryonic Stem CellsNeural Progenitor CellsPolyethylenimine TransfectionHEK293T CellsUltracentrifugationViral Particle ConcentrationWestern BlotGFP Expression