Lentiviral Mediated Delivery of shRNAs to hESCs and NPCs Using Low-cost Cationic Polymer Polyethylenimine (PEI)

Summary

Using the low-cost cationic polymer polyethylenimine (PEI), we produced lentiviral particles for stable expression of shRNAs in H9 human embryonic stem cells (hESCs) and transiently transduced H9-derived neural progenitor cells (NPCs) at high efficiency.

Abstract

The current protocol describes the use of lentiviral particles for the delivery of short hairpin RNAs (shRNAs) to both human embryonic stem cells (hESCs) as well as neural progenitor cells (NPCs) derived from hESCs at high efficiency. Lentiviral particles were generated by co-transfecting HEK293T cells using entry vectors (carrying shRNAs) along with packaging plasmids (pAX and pMD2.G) using the low-cost cationic polymer polyethylenimine (PEI). Viral particles were concentrated using ultracentrifugation, which resulted in average titers above 5 x 10⁷. Both hESCs and NPCs could be infected at high efficiencies using these lentiviral particles, as shown by puromycin selection and stable expression in hESCs, as well as transient GFP expression in NPCs. Furthermore, western blot analysis showed a significant reduction in the expression of genes targeted by shRNAs. In addition, the cells retained their pluripotency as well as differentiation potential, as evidenced by their subsequent differentiation into different lineages of CNS. The current protocol deals with the delivery of shRNAs; however, the same approach could be used for the ectopic expression of cDNAs for overexpression studies.

Introduction

Human embryonic stem cells (hESCs) derived from the blastocyst inner cell mass are pluripotent and can be differentiated into different cell types depending upon external factors under in vitro conditions^1,2. In order to fully harness the potential of hESCs, it is imperative to have rapid and reliable gene delivery methods for these cells. Conventionally, the techniques used can be broadly classified into two types: nonviral and viral gene delivery systems^3,4. The more frequently used nonviral gene delivery systems are lipofection, electroporation, and nucleofection. Nonviral delivery systems are advantageous because of fewer insertion mutations and an overall decrease in immunogenicity^5,6. However, these methods result in low transfection efficiency and a short duration of transient gene expression, which is a major limitation for long-term differentiation studies⁷. Electroporation results in better transfection efficiencies compared to lipofection; however, it results in more than 50% cell death^8,9,10. Using nucleofection, the cell survival and transfection efficiency can be improved by combining lipofection and electroporation, but the approach needs cell-specific buffers and specialized equipment and, thus, becomes quite costly for scaled-up applications^11,12.

In contrast, viral vectors have shown improved transfection efficiencies, as well as overall low cytotoxicity, following transduction. In addition, the genes delivered are stably expressed and, hence, make this method ideal for long-term studies¹³. Among the most commonly used viral vectors for gene delivery into hESCs are lentiviral vectors (LVS), which can give more than 80% transduction efficiency using high titer viral particles^14,15. Lipofection and CaPO₄ precipitation are amongst the most commonly used methods to transiently transfect HEK293T cells or its derivatives with gene transfer vectors along with packaging plasmids to yield lentiviral particles¹⁶. Although lipofection results in good transfection efficiency and low cytotoxicity, the technique is hampered by its cost, and scaling up to get high titer lentiviral particles would be very costly. CaPO₄ precipitation results in relatively similar transfection efficiencies to those obtained using lipofection. Although cost-effective, CaPO₄ precipitation results in significant cell death following transfections, which makes it difficult to standardize and to avoid batch-to-batch variations¹⁷. In this scenario, developing a method that gives high transfection efficiency, low cytotoxicity, and cost-effectiveness is crucial for the production of high titer lentiviral particles to be used in hESCs.

Polyethylenimine (PEI) is a cationic polymer that can transfect HEK293T cells at high efficiency without much cytotoxicity and has a negligible cost compared to lipofection-based methods¹⁸. In this situation, PEI can be used for scaled-up applications of high titer LVS production through the concentration of lentiviral particles from culture supernatants using various techniques. The presented article describes the use of PEI to transfect HEK293T cells and lentiviral vector concentration using ultracentrifugation through a sucrose cushion. Using this method, we regularly obtain titers well above 5 x 10⁷ IU/mL with low batch-to-batch variations. The method is simple, straight-forward, and cost-effective for scaled-up applications for gene delivery to hESCs and hESCs-derived cells.

Protocol

1. Transfection of HEK293T cells using either PEI or Lipofectamine 3000 reagent

1. Culture HEK293T cells in DMEM + 10% FBS + 1x penicillin/streptomycin at 37 °C in a humidified incubator with an atmosphere of 5% CO₂ and 21% O₂ until they are 90% confluent before seeding for transfection. Use a relatively low passage number of cells for high titer virus production (ideally less than P30).
2. Seed 4 x 10⁶ cells in 10 mL of complete growth medium in a 100 mm tissue culture plate and grow overnight in a humidified tissue culture incubator with an atmosphere of 5% CO₂ and 21% O_2.
3. For each transfection, dilute plasmid DNA (1 mg/mL stocks) in 1 mL of serum free DMEM media in 1.5 mL centrifuge tubes using the following ratio of entry and packaging plasmids:
   Entry vector = 10 µg
   psPAX2.0 = 7.5 µg
   pMD2.G = 5 µg
4. Vortex for 10 s and spin the tube at 10,000 x g for 30 s at room temperature to collect.
5. Add 70 µL of (1 mg/mL stock solution) PEI to the tube, and vortex and spin briefly as described above to collect. The volume of PEI used is based on a 1:3 ratio of total DNA (µg):PEI (µg).
6. For lipofectamine-based transfection, dilute the above vectors in 500 µL of serum-free DMEM media containing 45 µL of reagent P supplied in the kit and incubate at room temperature for 5 min.
7. Dilute 70 µL of reagent L supplied in the kit using 500 µL of serum-free DMEM media and incubate at room temperature for 5 min.
8. Combine the contents of both tubes and incubate the tubes at room temperature for 20 min to allow complex formation.
9. Add dropwise 1 mL of DNA/PEI or 1 mL of DNA/lipofectamine complexes to the plate containing cells and incubate for 6 h at 37 °C in a humidified incubator with an atmosphere of 5% CO₂ and 21% O_2.
10. After 6 h, change to fresh complete growth media (10 mL) and return the cells back to the humidified incubator with an atmosphere of 5% CO₂ and 21% O_2.

2. LVS collection and ultracentrifugation

1. After 2 days of transfection, collect the virus-containing media and overlay the cells again with 10 mL of fresh complete growth media.
2. After 3 days of transfection, collect the virus-containing media and combine it with the virus-containing media collected at the 2 day time point.
3. Centrifuge the viral supernatant at 2,000 x g for 10 min at 4 °C to pellet cellular debris.
4. Filter the supernatant using a 0.45 µm pore size low protein binding filter (either PES or SFCA) and store at 4 °C until ready for ultracentrifugation. The filtered supernatant containing lentiviral particles can be stored at 4 °C for 5 days without a significant loss in viral titers.
5. Sterilize the ultracentrifuge tubes holding cups by washing them with 70% ethanol for 10 min, air dry, close, and keep at 4 °C.
6. Add 36 mL of filtered media containing lentiviral particles to a sterile ultracentrifuge tube.
7. Fill 5 mL of a sterile stripette with 4 mL of sterile 20% sucrose solution (prepared in PBS) and dispense it right to the bottom of the ultracentrifuge tube (UC) containing LVS. It is important that the sucrose solution is not mixed with the media and makes a gradient at the bottom of the tube.
8. Balance all the ultracentrifuge tubes using serum-free DMEM media, place in the cold ultracentrifuge tube holding cups, and close the lids.
9. Spin the tubes at 125,000 x g for 2 h at 4 °C.
10. After the spin, carefully discard the supernatant by inverting the contents of the tube in a container containing bleach without disturbing the pellet. Mark the pellet if visible.
11. Place the ultracentrifuge tube in a 50 mL sterile tube and add 200 µL of sterile DPBS exactly at the top of the pellet. Keep at 4 °C overnight undisturbed.
12. The following day, gently mix by pipetting up and down 40x.
13. Briefly spin at 13,000 x g in a tabletop centrifuge to pellet any debris.
14. Transfer the supernatant to a new tube and aliquot the virus preparation as 20 µL aliquots. Store at −80 °C.
15. Set aside 5 µL of the preparation for viral titer measurements.

3. LVS titer measurement for pLKO.1-based vectors

1. Determine the titer of lentiviral particles by using a qPCR following the manufacturer's recommendations.
2. For a standard curve, prepare five 10-fold serial dilutions of Standard Control DNA (provided in the kit) by diluting 5 µL of DNA into 45 µL of nuclease-free H₂O in each step. Use dilutions of 1:100 to 1:100,000 to generate a standard curve.
3. Set up reactions on ice in duplicates in the following manner:
   2x qPCR master mix        10 µL
   Primer mix                          2 µL
   Sample or standard DNA   2 µL
   Nuclease-free H₂O            6 µL
4. Perform qPCR using the cycling conditions mentioned in the manual of the kit for a total of 35 cycles.
5. Plot cycle threshold (Ct) values on the Y-axis vs. virus titer on the X-axis.
6. Generate a logarithmic regression using four standard control DNA dilutions (1:100 to 1:100,000) to determine the unknown virus sample titer using a trendline equation.

4. LVS titer measurement for pll3.7-based vectors

1. Seed 1 x 10⁵ HEK293T cells in each well of a P12-well plate in 1 mL of complete growth media 24 h before infections.
2. Supplement the media with 8 µg/mL polybrene and add 1 mL into each sterile 1.5 mL tube.
3. Dilute the viral particles by using 4 µL, 2 µL, 1 µL, 0.5 µL, and 0.1 µL of concentrated lentiviral particles in each of the 1 mL of polybrene-containing media.
4. Replace the media from HEK293T cells with the media containing indicated amounts of lentiviral particles along with 8 µg/mL polybrene and incubate for 24 h at 37 °C in a humidified incubator with an atmosphere of 5% CO₂ and 21% O₂.
5. The next day, change to fresh media and continue the culture for 72 h at 37 °C in a humidified incubator with an atmosphere of 5% CO₂ and 21% O₂.
6. After 72 h, wash the cells with PBS, trypsinize at 37 °C according to the manufacturer's protocol, and resuspend in 1 mL of PBS.
7. Perform FACS cell sorting using a cell sorter, following the manufacturer's recommendations. Set the gate to 0% GFP positive cells using non-infected HEK293T cells and count 50,000 events for each sample to determine the percentage of positive cells for each viral dilution.
8. Use only the volumes of lentiviral particles that give %GFP positive cells in the range of 2%-20% to calculate the titer of lentiviral particles.

5. Infection of hESCs and stable selection

1. Wash the cells with 2 mL of PBS growing in each well of a 6-well cell culture multiwell plate.
2. Detach the cells from the cell culture plate using 1 mL of 1x cell dissociation reagent by incubation at 37 °C for 5 min.
3. Collect the cells in DMEM/F12 media and centrifuge at 1,500 x g for 5 min at room temperature to collect the cell pellet.
4. Aspirate, resuspend the cells in 1 mL, and count using a hemocytometer.
5. Make a cell suspension with 2 x 10⁵ cells/mL of complete growth media containing mTeSR1 supplemented with 10 ng/mL basic fibroblast growth factor (bFGF), penicillin/streptomycin (P/S), and 10 µM ROCK Inhibitor (RI).
6. Seed 1 x 10⁵ cells on 50x diluted complete basement membrane matrix-coated P24-well plates in 500 µL of complete growth media and culture the cells at 37 °C in a humidified incubator with an atmosphere of 5% CO₂ and 21% O_2.
7. The following day, infect hESCs at a multiplicity of infection (MOI) of 10 with 8 µg/mL polybrene and incubate at 37 °C for 8 h.
8. After 8 h, replace the virus-containing media with fresh growth media (-RI) and continue the culture until the cells are 90% confluent.
9. Start puromycin selection (0.8 µg/mL) when the cells reach 90% confluency, which is usually 48-72 h post infection.
10. After selection is complete (usually 4-6 days), split the stable cells (1:4) and expand the cells for cryopreservation and further analysis.

6. Transduction of H9-derived neural progenitor cells (NPCs)

NOTE: NPCs were derived from H9 cells using a dual-Smad inhibition protocol, as described previously¹⁹.

1. Briefly, treat H9 cells with cell dissociation reagent at 37 °C for 5 min to generate single cells and resuspend in complete growth media containing mTeSR1 supplemented with 10 ng/mL basic fibroblast growth factor (bFGF), penicillin/streptomycin (P/S), and 10 µM ROCK Inhibitor (RI). Seed on 1:50 diluted Matrigel-coated 6-well cell culture dishes at a density of 60,000 cells/cm² (day 0).
2. Initiate differentiation when the cells reach 95%-100% confluency by changing to 100% KSR media containing LDN193189 (200 nM), and SB431542 (10 µM) (day1).
3. On day 2, change the media again with 100% KSR supplemented with LDN193189 (200 nM), SB431542 (10 µM), and XAV939 (5 µM).
4. On day 4 of differentiation, switch to a mixture of KSR medium (75%) and N2 medium (25%) with LDN193189 (200 nM), SB431542 (10 µM), and XAV939 (5 µM).
5. From day 6 to day 12, gradually switch the media to 100% N2 supplemented with LDN193189 (200 nM), SB431542 (10 µM), and XAV939 (5 µM) by increasing the N2 media 25% each day and changing the media after every 2 days.
6. Culture day 12 NPCs in N2:B27 media supplemented with 20 ng/mL bFGF.
7. Seed 2 x 10⁵ cells in each well of a 1:50 diluted complete basement membrane matrix-coated P6-plate in 2 mL of NPCs culture media and incubate to allow the cells to attach.
8. The next day, infect the cells with lentiviral particles at an MOI 6 in the presence of 8 µg/mL polybrene.
9. After 8 h, replace the virus-containing media with fresh NPC growth media.
10. The next day, repeat the infections and change the media at 8 h.
11. Keep the cells in culture for 72 h before harvesting for further analysis.

Results

Following gene transfer, high viability of hESCs is inevitably required. Despite the efforts and optimization of protocols to reduce cell death following electroporation of hESCs, more than 50% cell death is still observed after electroporation of these cells, along with low transfection efficiency²⁰. Lentiviral mediated gene transfer not only results in high efficiency of gene transfer but also demonstrates high levels of cell viability following transduction. The results below present two approa...

Discussion

The ability to genetically modify stem cells for study or clinical purposes is limited both by technology and the basic understanding of the biology of hESCs. Techniques that have shown significant potential in mouse ESCs, like lipofection and electroporation, are not highly efficient for hESCs, which are notoriously difficult for gene delivery by conventional methods²⁰. This notion has led to not only the optimization of existing techniques but also the development of novel methods for increased ...

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
2-Mercaptoethanol	Invitrogen	31350010
38.5 mL, Sterile + Certified Free Open-Top Thinwall Ultra-Clear Tubes	Beckman Coulter	C14292
Accutase	Stem Cell Technologies	7920
bFGF Recombinant human	Invitrogen	PHG0261
Bovine serum albumin FRAC V	Invitrogen	15260037
Corning Matrigel Basement Membrane Matrix, LDEV-free	Corning	354234
Cyclopamine	Stem Cell Technologies	72074
DMEM media	Invitrogen	11995073
DMEM Nutrient mix F12	Invitrogen	11320033
DPBS w/o: Ca and Mg	PAN Biotech	P04-36500
Fetal bovie serum	Invitrogen	10270106
GAPDH (14C10) Rabbit mAb Antibody	CST	2118S
Gentle Cell Dissociation Reagent	Stem Cell Technologies	7174
HyClone Non Essential Amino Acids (NEAA) 100X Solution	GE healthcare	SH30238.01
L Glutamine, 100X	Invitrogen	2924190090
L2HGDH Polyclonal antibody	Proteintech	15707-1-AP
L2HGDH shRNA	Macrogen		Seq: CGCATTCTTCATGTGAGAAAT
Lipofectamine 3000 kit	Thermo Fisher	L3000001
mTesR1 complete media	Stem Cell Technologies	85850
Neurobasal medium 1X CTS	Invitrogen	A1371201
Neuropan 2 Supplement 100x	PAN Biotech	P07-11050
Neuropan 27 Supplement 50x	PAN Biotech	P07-07200
Penicillin streptomycin SOL	Invitrogen	15140122
pLKO.1 TRC vector	Addgene	10878
pLL3.7 vector	Addgene	11795
pMD2.G	Addgene	12259
Polybrene infection reagent	Sigma	TR1003- G
Polyethylenimine, branched	Sigma	408727
psPAX2.0	Addgene	12260
Purmorphamine	Tocris	4551/10
Puromycin	Invitrogen	A1113802
ROCK inhibitor Y-27632 dihydrochloride	Tocris	1254
SB 431542	Tocris	1614/10
Trypsin .05% EDTA	Invitrogen	25300062
XAV 939	Tocris	3748/10