A subscription to JoVE is required to view this content. Sign in or start your free trial.

Summary

In this work, a rapid, sensitive, and portable detection method for Candidatus Liberibacter asiaticus based on recombinase polymerase amplification combined with CRISPR-Cas12a was developed.

Abstract

The early detection of Candidatus Liberibacter asiaticus (CLas) by citrus growers facilitates early intervention and prevents the spread of disease. A simple method for rapid and portable Huanglongbing (HLB) diagnosis is presented here that combines recombinase polymerase amplification and a fluorescent reporter utilizing the nuclease activity of the clustered regularly interspaced short palindromic repeats/CRISPR-associated 12a (CRISPR-Cas12a) system. The sensitivity of this technique is much higher than PCR. Furthermore, this method showed similar results to qPCR when leaf samples were used. Compared with conventional CLas detection methods, the detection method presented here can be completed in 90 min and works in an isothermal condition that does not require the use of PCR machines. In addition, the results can be visualized through a handheld fluorescent detection device in the field.

Introduction

Huanglongbing (HLB) is one of the most problematic citrus diseases worldwide¹. HLB is caused by the phloem-colonizing and fastidious bacteria Candidatus Liberibacter spp., including Candidatus Liberibacter asiaticus (CLas), Ca. L. africanus, and Ca. L. americanus². The most prevalent HLB-associated species in China and the USA is CLas, which is transmitted by Asian citrus psyllids (Diaphorina citri) or through grafting³. After being infected by CLas, citrus trees demonstrate growth decline until death². The common symptoms of citrus leaves infected with CLas are blotchy mottle, green islands (small circular dark green dots), raised corky veins on thicker and leathery leaves, and nonuniform yellowing shoots². In addition, fruits infected with CLas appear small and lopsided².

Since no citrus variety is resistant to HLB and there is no therapeutic cure for HLB, the prevention of HLB requires the quarantine and isolation of CLas-positive citrus trees^2,3. Therefore, early detection is critical for monitoring and quarantine to prevent the spread of CLas and minimize economic losses³. In addition, sensitive CLas detection is needed due to the low titer of CLas in plants during the early stage of infection³. In China, CLas detection is usually conducted by certain certified test centers. However, the detection process usually takes at least 1 week, and the detection fee is expensive. Therefore, to help monitor the HLB incidence

Various technologies have been applied to diagnose HLB^4,5,6,7,8,9. Polymerase chain reaction (PCR) and quantitative PCR (qPCR) are the most used tools for CLas detection due to their high sensitivity and specificity^4,5. However, those technologies rely heavily on expensive instruments and highly skilled personnel. In addition, several isothermal amplification methods, such as loop-mediated isothermal amplification (LAMP), have been developed as attractive alternatives to conventional PCR methods due to their simplicity, rapidity, and low cost^8,9,10. However, it is challenging to apply them to accurately detect CLas due to the non-specific amplification signals, which may cause false-positive results.

RNA-guided CRISPR/Cas (clustered regularly interspaced short palindromic repeats/CRISPR-associated) endonuclease-based nucleic acid detection has been developed as a next-generation molecular diagnostics technology owing to its high sensitivity, specificity, and reliability^11,12,13,14. These CRISPR/Cas diagnostics technologies rely on the collateral nuclease activity of Cas proteins to cleave single-stranded DNA (ssDNA) modified with a fluorescent reporter and a fluorescence quencher at each end of the oligonucleotides, as well as a fluorescence detection device to capture the released fluorescent reporter^11,12. The nuclease activity of several Cas effectors activated by the CRISPR RNA (crRNA) target duplex can indiscriminately cleave the surrounding non-target ssDNA¹¹. CRISPR-Cas12a (also called Cpf 1), a class 2 type V-A CRISPR/Cas system, demonstrates several advantages compared with Cas9, such as a lower mismatch tolerance and greater specificity¹³. The Cas12a/crRNA system has been applied for the sensitive and specific detection of the nucleic acids of human pathogens and phytopathogens^{14,15,16,17,18}. Therefore, utilizing the Cas12a/crRNA system should enable the accurate and sensitive detection of the nucleic acid of CLas.

Cas12a alone is not theoretically sensitive enough to detect low levels of nucleic acids. Therefore, to improve its detection sensitivity, CRISPR-Cas12a detection is typically combined with an isothermal amplification step^14,15. Recombinase polymerase amplification (RPA) enables sensitive and rapid isothermal DNA amplification in a temperature range from 37 °C to 42 °C¹⁹.

A detection platform called DETECTR (DNA Endonuclease Targeted CRISPR Trans Reporter) that combines the DNase activity of Cas12a with RPA and a fluorescence readout has been recently devised¹² and has been shown to detect nucleic acid with higher sensitivity²⁰. Furthermore, the fluorescence signal emitted from the positive samples can be observed through a handheld fluorescence detection device in the field.

Since we amplified DNA with RPA, designed crRNA targeting the five-copy nrdB (ribonucleotide reductase β– subunit) gene specific to CLas²¹, and employed the DNase activity of the Cas12a protein, we called this CLas detection method CLas-DETECTR. Compared with existing CLas detection methods, CLas-DETECTR is fast, accurate, sensitive, and deployable.

Protocol

1. Construction of the CLas-DETECTR

NOTE: The construction of CLas-DETECTR is a four-step process: solution preparation, citrus total DNA isolation, isothermal DNA amplification, and result visualization. The schematic of the CLas-DETECTR assay is illustrated in Figure 1A.

1. Solution preparation
   1. Prepare buffer A: 20 mM NaOH in 6% PEG 200. For 100 mL, add 113 mg of NaOH and 6 g of PEG 200 into 80 mL of H₂O in a bottle. Incubate the bottle in a water bath at 60 °C until all the PEG 200 is dissolved. Then, add H₂O to a volume of 100 mL.
   2. Prepare solution B: For each reaction, add 10 μL of RPA buffer, 0.8 μL of F-RPA-RNRf, 0.8 μL of R-RPA-RNRr, and 3.9 μL of ddH₂O to a final volume of 15.5 μL.
      NOTE: F-RPA-RNRf and R-RPA-RNRr are the primers used in the assay against the nrdB gene. See Table 1 for the sequence.
   3. Prepare solution C: For each reaction, add 1 μL of ssDNA reporter, 3 μL of NEB buffer 3.1, 1 μL of crRNA, 4 μL of Cas12a, and 11 μL of ddH₂O to a final volume of 20 μL.
      NOTE: If there are many samples to detect, make a large volume of solution B and solution C, and aliquot later.
2. Citrus total DNA isolation
   NOTE: To save time and make this method suitable for field CLas detection, the alkaline polyethylene glycol (PEG)-based approach was used to obtain crude plant extracts for DNA amplification^22,23
   1. Citrus leaves were used in this protocol. First, punch five leaf discs from a leaf. Next, put the leaf discs into a 1.5 mL microcentrifuge tube, and add 200 μL of buffer A.
      NOTE: In the field, clean the leaves first if there is dust covering them. The leaf discs can be clipped using the lid of the 1.5 mL tube to avoid cross-contamination. Other citrus tissues, such as roots, stems, fruits, and flowers, can also be used in this protocol.
   2. Grind the leaf disks manually until smooth with a plastic rod.
   3. Leave the tube undisturbed for 10 min. Then, use the supernatant for DNA amplification.
      NOTE: The assay can be paused here, and the crude plant extracts that were extracted by the alkaline-PEG method can be stored at −20 °C for at least 1 year. The Newhall sweet orange (Citrus sinensis Osbeck var. Newhall) trees shown in the video were grown in a pot filled with a mix of 9/3/1 (v/v/v) peat soil/vermiculite/perlite and maintained in a glasshouse located in the campus of Gannan Normal University, Jiangxi, China. The HLB-infected trees were inoculated by grafting with CLas-positive Newhall buds. The HLB-infected and HLB-uninfected trees were confirmed by PCR. CLas was detected using the primer pair (F-RPA-RNRf/R-RPA-RNRr) targeting the CLas-specific marker gene nrdB. On the other side, characteristic HLB symptoms, blotchy mottle, and yellowing leaves can be found on CLas-positive but not on CLas-negative trees.
3. Isothermal DNA amplification
   1. Add 1 μL of the supernatant from step 1.2.3 and 1 μL of MgOAc (14 mM final concentration) into solution B and mix well.
   2. In the lab, incubate them in a simple incubator at 37 °C for 15 min.
      NOTE: In the field, hold the tubes in hand for 15 min. It is also suggested to incubate tubes in a simple incubator at 37 °C for 15 min if the conditions allow.
4. Results visualization
   1. Add 10 μL of the mixture from step 1.3.2 into solution C and mix well.
   2. Incubate them in a 37 °C incubator for 60 min.
   3. Wear goggles and observe the green fluorescence signal released from the ssDNA reporter labeled with 5’ 6-Fluorescein at 5’ and the fluorescence quencher at 3’ through a handheld fluorescent detection device (excitation wavelength: 440 nm, emission wavelength: 500 nm).
      NOTE:green fluorescence signal can last several days, it is better to
      CAUTION: The light emitted by the fluorescence detection device is harmful to the eyes. Make sure to wear goggles before observing the results.

2. Specificity test

NOTE: To test the specificity of CLas-DETECTR, the rhizosphere bacterium Agrobacterium tumefaciens GV3101, Xanthomonas citri subsp. citri (Xcc), and Burkholderia stabilis strain 1440 isolated in the lab²⁴ were subjected to the CLas-DETECTR test. 

NOTE: Candidatus Liberibacter (CLas) cannot be cultured. One can only obtain CLas DNA from the extraction of genomic DNA from citrus tissues infected with CLas. Xcc is the causal agent of another important citrus disease, citrus canker. Burkholderia stabilis strain 1440 is an anti-Xcc bacterium isolated in the lab. Therefore, pure strains for all these three bacteria were used

1. Extract the bacterial genomic DNA (gDNA) using a bacterial genomic DNA extraction kit following the manufacturer’s protocol. Use water as a negative control.
2. Perform PCR using 0.2 mL PCR tube strips with optical caps in a 25 μL reaction mixture containing 1 μL of F-RPA-RNRf, 1 μL of R-RPA-RNRr, 12.5 μL of Ex Taq Version 2.0 plus dye, 1 μL of DNA template, and 9.5 μL of H₂O.
   1. Use the following thermal cycling reaction conditions: 1 min at 98 °C; followed by 35 cycles of 10 s at 98 °C, 30 s at 55 °C, 15 s at 72 °C; then 10 min at 72 °C; and hold at 16 °C.
   2. Run the PCR products on 1% agarose gel at 120 V for 15 min.
3. Perform qPCR in a 20 μL reaction mixture containing 0.8 μL of F-RPA-RNRf, 0.8 μL of R-RPA-RNRr, 10 μL of 2x TB Green Premix Ex Taq II (Tli RNaseH Plus), 1 μL of the DNA template, and 7.4 μL of H₂O.
   1. Use the following thermal cycling reaction conditions: 30 s at 95 °C; followed by 45 cycles of 5 s at 95 °C and 32 s at 60 °C; and then a melt curve stage of 15 s at 95 °C, 1 min at 60 °C, and 15 s at 95 °C.
   2. Include three technical repeats in each repeat.
4. Perform the CLas-DETECTR method following steps 1.1–1.4.

3. Sensitivity comparison

1. To test the sensitivity of CLas DETECTR, detect a series of CLas DNA fragment dilutions using PCR, CLas-DETECTR, and qPCR, as described above.
2. Amplify a DNA segment with a length of 1,060 bp from nrdB using the primer set F-RNR and R-RNR in a 100 μL reaction mixture containing 4 μL of F-RNR, 4 μL of R-RNR, 50 μL of PrimeSTAR Max Premix, 2 μL of DNA template, and 40 μL of H₂O, following the thermal cycling reaction conditions (30 s at 98 °C; followed by 35 cycles of 10 s at 98 °C, 15 s at 55 °C, 30 s at 72 °C; then 10 min at 72 °C; and hold at 16 °C).
   NOTE: The nrdB (ribonucleotide reductase β- subunit) gene is specific to CLas²¹. One can easily obtain the nrdB amplicon from CLas-positive citrus gDNA using the primer set F-RNR and R-RNR. The primer set F-RNR and R-RNR amplifies a 1,060 bp nrdB fragment, while the primer set F-RPA-RNR and R-RPA-RNR amplifies a 104 bp fragment of the nrdB gene, which is the part of the 1,060 bp nrdB fragment.
3. Purify the PCR products with a DNA gel extraction kit following the manufacturer’s manual.
4. Dilute the PCR products containing the nrdB amplicons with sterilized ddH₂O.
5. Calculate the copy number of the nrdB gene using commercially available online DNA copy number and dilution calculator.
6. Prepare DNA dilutions containing 2.01 × 10⁶ copies/μL, 2.01 × 10⁵ copies/μL, 2.01 × 10⁴ copies/μL, 2.01 × 10³ copies/μL, 2.01 × 10² copies/μL, 2.01 × 10¹ copies/μL, 2.01 × 10⁰ copies/μL, and 2.01 × 10⁻¹ copies/μL of CLas DNA fragment.

4. Sample detection

NOTE: After the specificity and sensitivity test, the CLas-DETECTR method was used to detect the presence of CLas in the field leaf samples collected from Newhall sweet orange trees grown in the germplasm resource nursery on the campus of Gannan Normal University, Jiangxi, China. A qPCR was performed to verify the results.

1. Test a total of 15 trees. Use water as a negative control.
2. Perform the CLas-DETECTR and qPCR methods as described above.
   NOTE: Due to the uneven distribution characteristics of CLas in citrus, leaves showing HLB symptoms were collected as a priority. If a tree looked healthy, the leaves were collected randomlyCLas-DETECTR system works correctly.

Representative Results

Here, we have described a portable platform, CLas-DETECTR, combing the RPA and CRISPR-Cas12a systems to diagnose HLB in the field. The schema of CLas-DETECTR is illustrated in Figure 1A.

When leaf samples from the HLB-infected and HLB-uninfected Newhall trees (Figure 1B), for which the presence of CLas was confirmed by PCR (Figure 1C), were subjected to the CLas-DETECTR test, a green fluorescence signal was seen in the HLB-infected sample but not in the HLB-uninfected sample and negative control (Figure 1D).

We determined the specificity of CLas-DETECTR using nucleic acids extracted from other bacteria. The primer set of F-RPA-RNRf and R-RPA-RNRr used in the CLas-DETECTR assay was also used in PCR and qPCR. A band could be seen in the agarose gel electrophoresis when amplified using CLas-positive citrus leaf gDNA but not other bacterial gDNA in the PCR assays (Figure 2A). In the qPCR assays, the average threshold cycle (Ct) value of CLas was 24 ± 0.7, while the average Ct values of A. tumefaciens GV3101, Xcc, and B. stabilis strain 1440 were 38 ± 0.7, 39 ± 1.4, and 39 ± 0.7, respectively (Figure 2B). Usually, the result is considered negative when the Ct value is higher than 38. These results demonstrate that the F-RPA-RNRf and R-RPA-RNRr primer pair are specific to CLas. In the CLas-DETECTR assay, only CLas gDNA demonstrated green fluorescence signals; the gDNA extracted from A. tumefaciens GV3101, Xcc, and B. stabilis strain 1440 did not (Figure 2C), which means CLas-DETECTR can detect CLas specifically.

We also tested the sensitivity of CLas-DETECTR using a series of CLas DNA dilutions. PCR could detect 2.01 × 10² copies/μL (Figure 3A). On the other hand, CLas-DETECTR could detect 2.01 × 10⁰ copies/μL, which suggests that this is viable as a sensitive field diagnostic (Figure 3B). The qPCR could detect 2.01 × 10⁻¹ copies/μL, but the Ct value was higher than 36 (Figure 3C). Therefore, CLas-DETECTR is two orders of magnitude more sensitive than traditional PCR and one order of magnitude less sensitive than qPCR when diluted amplicons are used (Figure 3).

Finally, we examined the feasibility of CLas-DETECTR for field samples and compared its sensitivity with qPCR, an established, sensitive nucleic acid detection approach²¹. Usually, a Ct value of CLas detection by qPCR higher than 36 means the CLas concentration is less than 2.01 × 10⁻¹ copies/μL, which is a very low concentration (Figure 3C). Among the 15 samples, the Ct value of samples 1, 2, 3, 4, 8, 10, 13, and 14 detected by qPCR were less than 36, and apparent green fluorescence signals were observed (Figure 4). On the other hand, when the Ct values of samples 6, 7, 9, 12, and 15 detected by qPCR were undetermined, no green fluorescence signals were observed (Figure 4). Furthermore, weak green fluorescence signals were observed when the Ct values of sample 5 and sample 11 detected by qPCR were higher than 36 (Figure 4). The results suggest that our platform is a rapid, robust, and sensitive tool for HLB diagnosis in the field.

No	Name		Sequence (5' to 3')
1	crRNA1-nrdB		rUrArArUrUrUrCrUrArCrUrArArGrUrGrUrArGrArUrUrGrCrArUrArGrGrCrGrArUrUrUrCrGrArGrGrArG
2	ssDNA-FQ		FAM-TTTATTT-BHQ1
3	F-RPA-RNRf		AAAAGTCGCACCATGCTCCATGAAGCTACC
4	R-RPA-RNRr		TGTTCACATGAGGGAGCATTTAACCCCACGAA
5	F-RNR		ATGGCAAATAACACAGGATTAAGCCC
6	R-RNR		TTAATCCCATTTCAACCCTGCTCC

Table 1: Nucleic acid used in this study. The ssDNA-FQ is single-stranded DNA labeled with 5’ 6-FAM (Fluorescein) at 5’ and the fluorescence quencher Black Hole Quencher 1 (BHQ1) at 3’. Abbreviations: F = fluorescent reporter; Q = fluorescence quencher.

Figure 1: Design and validation of the CLas-DETECTR. (A) Schematic of the CLas-DETECTR assay. Step 1: Prepare buffer A containing 20 mM NaOH in 6% PEG 200 for quick gDNA extraction; solution B containing 10 μL of RPA buffer, 0.8 μL of F-RPA-RNRf, 0.8 μL of F-RPA-RNRr, and 3.9 μL of ddH₂O in each reaction for isothermal DNA amplification; solution C containing 1 μL of ssDNA reporter, 3 μL of NEB buffer 3.1, 1 μL of crRNA targeting nrdB, 4 μL of Cas12a, and 11 μL of ddH₂O in each reaction for fluorescent reporter release. Step 2: Five leaf discs punched from leaves were used to extract the citrus total DNA with 200 μL of buffer A. Step 3: The CLas-specific nucleic acids were amplified using the primers F-RPA-RNRf and R-RPA-RNRr targeting the CLas-specific marker gene nrdB in solution B with 1 μL of supernatant from step 2 and 1 μL of MgOAc at 37 °C for 15 min. Step 4: Solution C with 10 μL of the mixture from step 3 was incubated at 37 °C for 60 min, and the green fluorescence signal was observed through a handheld fluorescent detection device. The ssDNA-FQ  was labeled with 5’ 6-FAM (Fluorescein) at 5’ and a fluorescence quencher Black Hole Quencher 1 (BHQ1) at 3’. Abbreviations: F = fluorescent reporter; Q = fluorescence quencher. (B) The HLB-infected tree (left) shows blotchy mottle and yellow leaves, but the HLB-uninfected tree (right) looks green. (C) The presence of CLas was confirmed using the primer pair F-RPA-RNRf and R-RPA-RNRr. (D) The HLB-infected sample demonstrates green fluorescence signals, while the HLB-uninfected and H₂O do not in the CLas-DETECTR assay. Please click here to view a larger version of this figure.

Figure 2: Testing the specificity of the CLas-DETECTR. (A) Agarose gel electrophoresis of the PCR results, (B) the Ct value of the qPCR results, and (C) the CLas-DETECTR results amplified with the primer pair of F-RPA-RNRf and R-RPA-RNRr using gDNA extracted from CLas-positive Newhall leaves and three other bacteria. Again, H₂O served as a negative control. M: DNA ladder; gDNA extracted from CLas-positive Newhall leaves (1), Agrobacterium tumefaciens GV3101 (2), Xanthomonas citri subsp. citri (Xcc, 3), and Burkholderia stabilis strain 1440 isolated in our lab (4). The Ct value represents the average Ct value of three technical repeats ± standard error. Please click here to view a larger version of this figure.

Figure 3: Sensitivity comparison of CLas-DETECTR with PCR and qPCR. Detection analysis of a series of specific CLas DNA amplicon dilutions using (A) PCR, (B) CLas-DETECTR, and (C) qPCR. (A) From 25 μL of the PCR products, 5 μL were loaded into the gel. (B) The pictures were captured with a smartphone camera through protective goggles under the light emitted by a handheld fluorescent detection device (excitation wavelength: 440 nm, emission wavelength: 500 nm). The same primers were used in all the assays. The purified PCR products with a length of 1,060 bp amplified with the primer set F-RNR and R-RNR targeting the CLas-specific nrdB gene were diluted using H2O into concentrations of 2.01 × 106 copies/μL (1), 2.01 × 105 copies/μL (2), 2.01 × 104 copies/μL (3), 2.01 × 103 copies/μL (4), 2.01 × 102 copies/μL (5), 2.01 × 101 copies/μL (6), 2.01 × 100 copies/μL (7), and 2.01 × 10−1 copies/μL (8). H2O served as a negative control. M: DNA ladder. Please click here to view a larger version of this figure.

Figure 4: CLas detection using field samples. CLas in 15 leaf samples collected from Newhall sweet orange trees was tested by CLas-DETECTR and qPCR assays described above. Please click here to view a larger version of this figure.

Discussion

This study presents a rapid and portable method to detect CLas named CLas-DETECTR, which combines the RPA and CRISPR-Cas12a systems. The workflow is illustrated in Figure 1. CLas-DETECTR detects CLas with specificity and sensitivity (Figure 2 and Figure 3). Furthermore, using Newhall leaf samples, CLas-DETECTR detects CLas with the same sensitivity as qPCR (Figure 4). Notably, the detection results can be directly visualized through a handheld portable device independent of laboratory-based instruments, which is critical for real-time HLB diagnosis.

There are several important considerations to the protocol. First, cross-contamination should be strictly avoided in the sampling process, as CLas-DETECTR is as sensitive as qPCR. The reaction reagents must not be exposed to intense sunlight. All the steps must be followed precisely to achieve optimum results. A positive control, a plasmid containing CLas-specific gene fragments, should be included to ensure that the CLas-DETECTR system works correctly in the field. Finally, all the CLas-related experimental waste should be treated as a biohazard and autoclaved before disposal.

If no fluorescence signals are detected for the positive control, inhibitors may exist in the reaction mixture, and the reagents need to be changed. Otherwise, if the fluorescence is too weak to distinguish, incubation time can be extended longer incubation time may lead to false positives.

The existing CLas detection methods require expensive PCR machines, fixed operation sites, and trained personnel. However, the method presented here allows HLB to be diagnosed accurately and sensitively in the field by a wide range of people, including citrus growers.

However, CLas-DETECTR has some limitations. First, citrus samples cannot be directly used in the protocol, and the citrus gDNA needs to be extracted. Second, a simple incubator is required for the RPA and the activation of the nuclease activity of Cas12a for consistent results. Third, the results need to be visualized through a handheld fluorescent detection device. Although lateral flow strips could be employed to show the results directly, this would increase

Leaf samples were tested in this protocol. In the future, CLas-DETECTR could be applied to detect the presence of CLas in periwinkles and psyllid samples. In addition, by changing the crRNA and primers, this molecular diagnostic technology could also be used for other citrus diseases, such as citrus canker, citrus decay virus, and citrus leaf fragmentation virus. While we are working on CLas-DETECTR, this approach has also been used to detect CLas in parallel by others²⁵.

Materials

AxyPrep DNA Gel Extraction Kit	Corning	09319KE1	China
Bacterial Genomic DNA Extraction Kit	Solarbio	D1600	China
EnGen LbCas12a	TOLOBIO	32104-01	China
Ex Taq Version 2.0 plus dye	TaKaRa	RR902A	China
Handheld fluorescent detection device	LUYOR	3415RG	China
Hole puncher	Deli	114	China
Magnesium acetate, MgOAc	TwistDx	TABAS03KIT	UK
NaOH	SCR	10019718	China
NEB buffer 3.1	NEB	B7203	USA
PCR strip tubes	LABSELECT	PST-0208-FT-C	China
PEG 200	Sigma	P3015	USA
PrimeSTAR Max DNA Polymeras	TaKaRa	R045A	China
Quick-Load Purple 1 kb Plus DNA Ladder	New England Biolabs	N0550S	USA
TB Green Premix Ex Taq II (Tli RNaseH Plus)	TaKaRa	RR820B	China
TwistAmp Basic	TwistDx	TABAS03KIT	UK