Method Article

Generation of Retinal Organoids from Healthy and Retinal Disease-Specific Human-Induced Pluripotent Stem Cells

4.7K views

DOI:

10.3791/64509

December 9th, 2022

 ,  ,  ,  ,  , 

Corresponding Authors: Indumathi Mariappan <indumathi@lvpei.org>

* These authors contributed equally

In This Article

Summary

This protocol describes an efficient method of differentiating hiPSCs into eye field clusters and generating neuro-retinal organoids using simplified culture conditions involving both adherent and suspension culture systems. Other ocular cell types, such as the RPE and corneal epithelium, can also be isolated from mature eye fields in retinal cultures.

Abstract

Pluripotent stem cells can generate complex tissue organoids that are useful for in vitro disease modeling studies and for developing regenerative therapies. This protocol describes a simpler, robust, and stepwise method of generating retinal organoids in a hybrid culture system consisting of adherent monolayer cultures during the first 4 weeks of retinal differentiation till the emergence of distinct, self-organized eye field primordial clusters (EFPs). Further, the doughnut-shaped, circular, and translucent neuro-retinal islands within each EFP are manually picked and cultured under suspension using non-adherent culture dishes in a retinal differentiation medium for 1-2 weeks to generate multilayered 3D optic cups (OC-1M). These immature retinal organoids contain PAX6+ and ChX10+ proliferating, multipotent retinal precursors. The precursor cells are linearly self-assembled within the organoids and appear as distinct radial striations. At 4 weeks after suspension culture, the retinal progenitors undergo post-mitotic arrest and lineage differentiation to form mature retinal organoids (OC-2M). The photoreceptor lineage committed precursors develop within the outermost layers of retinal organoids. These CRX+ and RCVRN+ photoreceptor cells morphologically mature to display inner segment-like extensions. This method can be adopted for generating retinal organoids using human embryonic stem cells (hESCs) and induced pluripotent stem cells (iPSCs). All steps and procedures are clearly explained and demonstrated to ensure replicability and for wider applications in basic science and translational research.

Introduction

The retina is a light-sensitive tissue present at the back of the vertebrate eye that converts light signals into nerve impulses by a biochemical phenomenon known as the photo-transduction pathway. The initial nerve impulses generated in the photoreceptor cells of the retina get transduced to other retinal interneurons and retinal ganglion cells (RGCs) and reach the visual cortex of the brain, which helps in image perception and visual response.

According to the World Health Organization (WHO), an estimated 1.5 million children are blind, of which 1 million are in Asia. Inherited Retinal Dystrophy (IRD) is a major blinding disease that affects 1 in 4,000 individuals worldwide1,2,3, while the prevalence of blindness associated with age-related macular degeneration (AMD) ranges from 0.6%-1.1% in developing countries4. IRDs are caused by inherited genetic defects in over 300 different genes involved in retinal development and function5. Such genetic changes result in the disruption of normal retinal functions and gradual degeneration of retinal cells, namely the photoreceptor cells and the retinal pigmented epithelium (RPE), thus leading to severe vision loss and blindness. Enormous progress has been made in other blinding conditions involving the cornea, lens, etc. However, retinal dystrophies and optic nerve atrophies do not have any proven therapy to date. Since an adult human retina does not have stem cells6, alternate sources such as embryonic stem cells (ESCs) and patient-derived induced pluripotent stem cells (iPSCs) can provide an unlimited supply of desired cell types and hold a great promise for developing complex tissue organoids required for in vitro disease modeling studies and for developing regenerative therapies7,8,9,10.

Several years of retinal research have led to a better understanding of molecular events that orchestrate early retinal development. Most protocols to generate retinal cells and 3D organoids from PSCs aim to recapitulate these developmental events in vitro, by culturing the cells in a complex cocktail of growth factors and small molecules to modulate the known biological processes in a stepwise manner. The retinal organoids thus generated are comprised of major retinal cells: retinal ganglion cells (RGCs), interneurons, photoreceptors, and retinal pigmented epithelium (RPE)11,12,13,14,15,16,17,18,19. Despite successful attempts at modeling IRDs using retinal organoids, the requirement for the complex cocktail of growth factors and small molecules during differentiation and the relatively low efficiency of retinal organoid generation poses a major challenge with most protocols. They majorly include the formation of embryoid bodies, followed by their stepwise differentiation into retinal lineages using complex culture conditions at different stages of in vitro development20,21,22.

Here, a simplified and robust method of developing complex 3D neuro-retinal organoids from healthy control and retinal disease-specific hiPSCs is reported. The protocol described here utilizes direct differentiation of near-confluent hiPSC cultures without needing embryoid body formation. Also, the complexity of culture medium is simplified, making it a cost-effective and reproducible technique that can be easily adopted by new researchers. It involves a hybrid culture system consisting of adherent monolayer cultures during the first 4 weeks of retinal differentiation till the emergence of distinct, self-organized eye field primordial clusters (EFPs). Further, the circular neuro-retinal islands within each EFP are manually picked and grown in suspension cultures for 1-2 weeks to prepare multilayered 3D retinal cups or organoids consisting of PAX6+ and CHX10+ proliferating neuro-retinal precursors. Extended culture of retinal organoids in 100 µM Taurine-containing medium for a further 4 weeks resulted in the emergence of RCVRN+ and CRX+ photoreceptor precursors and mature cells with rudimentary inner segment-like extensions.

Protocol

All experiments involving hiPSCs were carried out aseptically, in adherence to the standard laboratory practices, ethical and biosafety guidelines, and with the approvals of regulatory bodies such as the Institutional Ethics Committee (IEC), Institutional Committee for Stem Cell Research (IC-SCR), and Institutional Bio-Safety Committee (IBSC).

1. Preparation of iPSC culture and retinal differentiation medium and reagents

  1. iPSC culture and maintenance medium
    1. Culture and maintain the normal hiPSC line23 (hiPSC-F2-3F1) and a CRISPR edited, RB1-/- hiPSC line (LVIP15-RB1-CS3, with biallelic, frameshift deletion of 10 bp within the exon 18 of the human RB1 gene) in Essential 8 medium on matrigel-coated (basement membrane matrix coated; see Table of Materials) culture plates under feeder-free culture conditions.
      NOTE: This protocol can be made totally xeno-free by replacing the basement membrane matrix with the recombinant vitronectin (VTN-N) coating. Prepare complete Essential 8 medium by adding 50x Essential 8 supplement (supplied with the Essential 8 medium kit; see Table of Materials) and 100 U/mL Penicillin-Streptomycin solutions. Alternately, the hiPSCs can also be cultured using the complete mTeSR1 medium.
  2. Cell Dissociation Solution (1x CDS)
    1. For an enzyme-free dissociation and passaging of human iPSCs, prepare the CDS containing 0.5 mM EDTA, pH 8.0, and 30 mM NaCl in 1x Dulbecco's phosphate-buffered saline (DPBS) (see Table of Materials).
    2. To prepare 100 mL of 1x CDS, add 100 µL of 0.5M EDTA and 1 mL of 3 M NaCl stock solutions to 99 mL of 1x DPBS, mix well, and filter sterilize using a 0.22 µm filter.
  3. Differentiation Induction Medium (DIM)
    1. Prepare DIM using DMEM-F12 Basal medium supplemented with 10% Knockout Serum Replacement (KOSR), 1x Non-Essential Amino Acid (NEAA), 2 mM GlutaMax, 100 U/mL Penicillin-Streptomycin, 200 µM L-Ascorbic acid, and 1% N2 supplement (see Table of Materials).
  4. Retinal Differentiation Medium (RDM)
    1. Prepare RDM using DMEM-F12 Basal medium supplemented with 10% Knockout Serum (KOSR), 1x Non-Essential Amino Acid (NEAA), 2 mM GlutaMax, 100 U/mL Penicillin-Streptomycin, 200 µM L-Ascorbic acid, and 2% B27 supplement (with vitamin A) (see Table of Materials).
  5. Extracellular matrix-coated cell culture surfaces
    1. Thaw the hESC-qualified basement membrane matrix overnight in an ice bucket, preferably inside a fridge at 4-8 °C. Dilute the thawed 100x matrix stock (5 mL) at a ratio of 1:5 by adding 20 mL of ice-cold DMEM-F12 basal medium and mix by gentle swirling to prepare a 20x stock solution.
      1. Prepare 0.5 mL aliquots on ice using pre-chilled pipette tips and sterile microcentrifuge tubes. Label the vials as 20x stocks and store them frozen in a -80 °C freezer for up to 6 months.
    2. For coating the cell culture surfaces (culture dishes or 6-well plates), thaw an aliquot of 20x matrix on ice and dilute it at a ratio of 1:20 using ice-cold DMEM-F12 basal medium to prepare 10 mL of 1x matrix coating solution, which is sufficient to coat a 100 mm dish or a 6-well plate (1.5 mL/well).
      NOTE: Prechill the pipettes/microtips by aspirating ice-cold and sterile DPBS before handling the matrix solution. Thawing and all handling of the matrix must be done on ice, using pre-chilled pipettes/microtips to avoid polymerization and gelling at room temperatures.
    3. Add 1.5 mL of 1x matrix coating solution to each well of a 6-well plate, gently swirl the plate to ensure even coating, and incubate the plates at 37 °C in a 5% CO2 incubator. Leave the plates undisturbed for a minimum of 1 h to ensure uniform coating of the matrix on the culture surfaces.
    4. Prior to seeding the cells, aspirate out the coating solution using a 5 mL sterile pipette and discard the liquid waste. Add fresh culture medium immediately (2 mL/well of a 6-well plate) and seed the cells at a density of 150,000-200,000 cells/well. Do not let the plates dry during handling.
      NOTE: Alternately, recombinant vitronectin (VTN-N) coating at a final concentration of 0.5 µg/mL can be used for a xeno-free culture protocol.

2. Establishing human iPSC cultures

  1. Thawing and revival of hiPSCs
    1. Coat one well of a 6-well plate with 1x membrane matrix solution. Incubate at 37 °C for 1 h to allow polymerization and uniform coating of the culture surface.
    2. After 1 h of incubation, remove the coating solution and add 1 mL of prewarmed complete Essential 8 medium containing 10 µM of Rho-kinase inhibitor, Y-27632 (1 µL/mL of 10 mM stock; see Table of Materials), before reviving the cells.
    3. Remove an hiPSC cryovial stock (1 x 106 cells/vial) from the liquid nitrogen container. Quickly thaw the cryovial in a 37 °C water bath with gentle swirling.
      NOTE: Do not thaw the vial completely; note down the passage number, surface sterilize the vial, and wipe it dry using a lint-free swab containing 70% isopropyl alcohol.
    4. Using a sterile 1 mL pipette tip, aspirate the cryovial contents into a fresh 15 mL tube consisting of 2 mL of prewarmed complete Essential 8 medium without Y-27632. Centrifuge the tube at 1,000 x g for 4 min at room temperature. Discard the supernatant.
    5. Resuspend the cell pellet in 1.0 mL of complete Essential 8 medium containing 10 µM Y-27632.
    6. Add this cell suspension onto the matrix-coated surfaces without disturbing the matrix by dispensing it along the walls. Rock the plate gently crosswise to ensure the even distribution of cells.
    7. Incubate the plates at 37 °C in a 5% CO2 incubator to allow the cells to adhere and start proliferating.
    8. After 12-24 h, replace the spent medium and maintain the cultures in prewarmed complete Essential 8 medium without Y-27632.
    9. Change the culture medium every 24 h and passage the cultures once they reach 70%-80% confluence.
      NOTE: A split ratio of 1:6 is routinely followed for hiPSC cultures and is passaged at regular intervals of 3-4 days.
  2. Passaging and plating of hiPSCs to initiate retinal lineage differentiation
    1. Aspirate the spent medium from 70%-80% confluent human iPSC cultures in 6-well plates.
    2. Add 1 mL of CDS (step 1.2) to each well and incubate at 37 °C for 5-7 min until the cells round up. Carefully remove the CDS, taking care not to detach the cells, and add 2 mL of fresh Essential 8 medium and gently triturate using a pipette.
    3. Collect the cell suspension from one well of a 6-cell plate into a 15 mL centrifuge tube and spin the tube at 1,000 x g for 4 min at room temperature. Discard the supernatant.
    4. Resuspend the cell pellet in 1.2 mL of Essential 8 medium and dispense 200 µL of the cell 200μL of the cell suspension (1:6 split ratio) into each well of a matrix-coated 6-well plate containing 1.5 mL of iPSC culture medium containing 10 µM Y-27632, as described in step 1.5.
    5. After 12-24 h, replace the spent medium and maintain the cultures in prewarmed complete Essential 8 medium without Y-27632.
    6. Change the culture medium every 24 h till the cultures reach 70%-80% confluence.

3. Differentiation of hiPSCs into eye fields and retinal lineage

NOTE: A schematic outline of the differentiation process is shown in Figure 1.

  1. Initiate the differentiation procedure once the hiPSC cultures reach 70%-80% confluence.
  2. On day 0, change the hiPSC maintenance medium to DIM (step 1.3) containing 1 ng/mL bFGF and 1 ng/mL Noggin. Add 2.0 mL of medium per well of a 6-well plate and maintain the cells at 37 °C in a 5% CO2 incubator.
    NOTE: Gradual withdrawal of bFGF induces the differentiation of PSCs, and the addition of increasing concentrations of Noggin (inhibitor of several BMPs) during the initial stages induces ectodermal lineage differentiation and neuralization11,12 and blocks the mesoderm and endoderm commitment. Alternatively, Noggin can be replaced by LDN193189. Unlike the dual SMAD inhibition strategy reported earlier20,21, this protocol does not require the addition of Activin or SB-431542.
  3. On day 1, change the spent medium and add DIM containing 1 ng/mL bFGF and 10 ng/mL Noggin. Add 2.0 mL per well of a 6-well plate. Incubate and maintain the cells at 37 °C in a 5% CO2 incubator.
  4. On day 2-3, remove the spent medium and add DIM containing only 10 ng/mL Noggin. Add 2.0 mL per well of a 6-well plate and change the medium every 24 h. Incubate and maintain the cells at 37 °C in a 5% CO2 incubator.
    NOTE: Always pre-warm the culture medium to 30-37 °C before use. Excess floaters and dead cells may be observed in early differentiation cultures. Under such conditions, wash the cultures once with 1x DPBS and add the retinal differentiation medium. Sterility tests on the spent medium can be done weekly or as required.
  5. On day 4, remove the spent medium and add the RDM (step 1.4). Add 2.0 mL per well of a 6-well plate and continue to maintain the cultures in RDM at 37 °C in a 5% CO2 incubator, with a fresh medium change every day.
    NOTE : Alternately, the PSCs can be grown as suspension cultures from day 1-3, in non-adherent and round-bottomed 96-well plates, at a cell density of 5 x 103 cells/100 µL/well to form embryoid bodies (EBs) under identical culture conditions in DIM. Well-formed EBs on day 4 can be plated onto matrix-coated plates containing RDM and are allowed to adhere, proliferate, and differentiate as described below.
  6. At around day 14-18, observe the cultures under a microscope at 10x magnification for the emergence of neural rosette-like domains consisting of early eye field progenitors (Figure 2B).
  7. At around day 21-28 (3-4 weeks), observe cultures under a microscope at 4x and 10x magnification to observe the emergence of self-organized, distinct EFPs, with a central island of circular 3D neuro-retinal structures surrounded by contiguous outgrowths of neuro epithelium and ocular surface epithelium (Figure 2C,D).
    ​NOTE: About 20-30 EFPs can be observed per well of a 6-well plate of a normal hiPSC retinal differentiation culture. This number can vary with other disease-specific hiPSC lines, based on their genetic background and retinal lineage differentiation potential.

4. Harvesting of retinal organoids

  1. Flame pulling of glass Pasteur pipettes for manual picking of retinal cups.
    NOTE: Use autoclaved and sterile glass Pasteur pipettes for eye field picking.
    1. Switch on a Bunsen burner. Take a sterile Pasteur pipette and hold the base in one hand and the capillary tip in the other. Flame sterilize and heat the region near the middle of the capillary tip, with rotational movements until the glass becomes pliable. Then move away from the flame and pull outward swiftly to create a fine capillary tip with a closed lumen.
    2. Hold the fine tip horizontally in front of the flame and quickly pass it through the flame in an outward motion to create a smooth hook or an L-shaped capillary tip.
    3. Use the smooth outer curvature zone of the capillary hook as a fine scoop to gently lift and detach the intact neuro-retinal cups from the EFP clusters.
      NOTE: The smooth angle of the glass capillary hook neither causes damage to the cells nor creates scratches on culture surfaces. This simple tool can also be effectively used for individual hiPSC colony splitting in grid patterns and for passaging them as small cell clusters during clonal expansion.
  2. Culture and maintenance of retinal cups to generate 3D retinal organoids.
    1. At day 25-30, add 4.0 mL of prewarmed retinal differentiation medium in a low-attachment 60 mm dish before preparing for the harvest of neuro-retinal cups.
    2. Work under a stereo microscope at 0.63x-4.5x magnification to observe and manually pick well-formed neuro-retinal cups from individual EFPs.
      NOTE: The appearance of pigmented RPE cell outgrowths helps in the easy identification of EFPs and the centrally placed neuro-retinal cups. The retinal cups appear as doughnut-shaped, circular, and translucent 3D structures, with clear radial striations, formed by the linearly arranged and self-assembled retinal stem cells, as opposed to the tightly packed and spherical or irregular clusters formed by the CNS neurons or the neural crest cells23.
    3. Use the flame-pulled Pasture pipette hooks to gently nudge and scoop out the central neuro-retinal island within individual EFPs.
    4. Set a 1 mL micropipette to aspirate 100 µL and use 1 mL microtips with wide bore openings to aspirate and transfer the floating retinal cups into the fresh, low-adherent culture dishes prepared in step 4.2.1.
      NOTE: Using tips with a smaller bore size and higher suction pressure may cause shearing and affect the integrity of retinal cups. The approximate dimensions of the retinal cups are about 1-2 mm in diameter.
    5. Maintain the retinal cups in RDM as non-adherent suspension cultures and incubate them at 37 °C in a 5% CO2 incubator.
    6. Day 30-45: Change the medium daily by gently tilting the dish and allowing the retinal cups to settle for about 30 s. Follow a partial feeding method, removing half volumes of spent medium and replacing with equal volumes of fresh medium.
      NOTE: Avoid repeated aspiration and transfers to prevent any damage to the retinal cups. After 1-2 weeks of suspension culture, the retinal cups slightly grow in size (1-3 mm) and develop into self-organized 3D retinal organoids (OC-1M) comprising of linearly arranged, early neuro-retinal progenitors expressing PAX6 and CHX10 (Figure 3Bi).
    7. Day 45-60: Culture the retinal organoids for a further 4 weeks in RDM containing 100 µM Taurine (see Table of Materials) to support better survival and lineage differentiation of neuro-retinal progenitors and the development of mature retinal cell type (OC-2M).
      NOTE: About 70%-80% of the retinal or optic cups picked from EFPs remain intact, retain their lamination, and develop into mature retinal organoids after 4 weeks of suspension culture (OC-2M).
    8. Check that the mature retinal organoids at 4 weeks of suspension culture show the emergence of RCVRN+ and CRX+ photoreceptor precursors and mature cells with a rudimentary inner segment-like extension in the outermost cell layers, thus recapitulating the normal retinal development and maturation process in vitro (Figure 3Bii).
      NOTE: After removing neuro-retinal cups, the differentiation cultures can be continuously maintained in RDM. The proximal epithelial outgrowths surrounding the neuro-retina contain retinal pigmented epithelial (RPE) cell precursors, which further expand and mature to form pigmented RPE monolayers with typical cobblestone morphology (Figure 4). The distal outgrowths predominantly consist of ocular surface epithelium that contributes to the lens and cornealepithelium. Desired cell types can be harvested from different zones of EFP outgrowths and enriched further to establish pure cultures.

5. Characterization of retinal organoids

  1. Morphological and molecular characterization
    1. Observe the adherent EFPs and floating retinal organoids under a phase-contrast microscope at 4x and 10x magnification and document their morphology and dimensions.
    2. Collect about 20 retinal organoids at different stages of maturation (steps 4.2.3-4.2.6) into 1.5 mL microcentrifuge tubes using wide bore 1,000 µL tips. Let the organoids settle at the bottom and aspirate out the medium. Wash the cups with 1x PBS.
    3. Remove the excess PBS and add 1.0 mL of TRIzol reagent (see Table of Materials). Incubate at room temperature for 5 min. Homogenize the tissue using a tube pestle and triturate using a 1.0 mL pipette.
    4. Prepare total RNA by following the standard reagent method of RNA isolation and purification, as per the manufacturer's instructions (see Table of Materials).
    5. Check the RNA quality on the agarose gel and quantify it using the NanoDrop Spectrophotometer (see Table of Materials).
    6. Convert 1-2 µg of total RNA into cDNA using the reverse transcriptase enzyme as per the manufacturer's instructions (see Table of Materials). See Table 1 for a list of gene-specific primers.
    7. Briefly, prepare the RNA-primer master mix in 10 µL of total volume as mentioned in Table 2 and incubate the tube at 65 °C for 5 min in a thermal cycler. Transfer the tube from the thermal cycler to ice for 2 min.
    8. Meanwhile, prepare the master mix 2 with the reagents mentioned in Table 3. Add this master mix to the RNA-primer mix tube prepared in step 5.1.7. Mix gently.
    9. Incubate the sample at 50 °C for 50 min, then 85 °C for 5 min, and then hold at 4 °C to stop the reaction.
    10. Use the synthesized cDNA as a template in PCR reactions to check for the expression of neuro-retinal progenitor and mature retinal cell markers.
    11. Normalize the total cDNA templates of each sample, namely F2-UD (hiPSC-F2-3F1; undifferentiated cells), OC-1M (1-week-old optic cup in suspension culture), and OC-2M (4-week-old optic cup in suspension culture) by semi-quantitative PCR using the housekeeping genes such as hE1fα or GAPDH.
    12. Prepare the master mix for semi-quantitative PCR, as mentioned in Table 4, and place the test sample tubes for amplification in a thermal cycler. The PCR amplification conditions are mentioned in Table 5.
  2. Histology and immunohistochemistry
    1. Collect the optic cups in a 2.0 mL microcentrifuge tube and aspirate the excess medium (steps 4.2.3-4.2.6). Rinse the organoids with 1x PBS and then wash and suspend them in 500 µL of 4% Paraformaldehyde to fix them overnight at room temperature.
    2. The next day, wash the cups in deionized water. Allow the cups to stand in 95% alcohol (three changes, 15-20 min each), followed by 100% alcohol (three changes, 15-20 min each), a 1:1 mix of absolute alcohol and xylene for 15 min, xylene (two changes, 15 min each), and paraffin (three changes, 15 min each). Embed this tissue to prepare a paraffin block following standard procedures. Allow it to cool and solidify.
    3. Prepare thin sections (~4-5 µm thickness) using a microtome and place them on silane-coated microscopic slides (see Table of Materials) following standard histology procedures.
    4. For deparaffinization, heat the slides at 70 °C on a heating block for 15-20 min. Once the wax melts, wash the slides with xylene (three changes, 3-4 min each), which will remove the paraffin completely.
      NOTE: Incomplete removal of paraffin results in poor/patchy staining of sections with a huge amount of background noise.
    5. Re-hydrate the slides using different percentages of ethanol (100%, 90%, and 80%) for 3 min each. Rinse the slides with distilled water and proceed with antigen retrieval.
    6. Before starting the antigen retrieval, pre-heat the citrate buffer (pH 6.0) in a Coplin jar (see Table of Materials) using a microwave oven till it reaches 95-100 °C.
    7. Immerse the slides in pre-heated citrate buffer and heat the jar for 15 min in a microwave oven. Remove the Coplin jar from the oven and allow it to cool at room temperature.
    8. Block the sections for endogenous peroxidase by adding a 1:1 mixture of methanol and hydrogen peroxide for 5 min, followed by washing the sections thrice with 1x PBS.
    9. Permeabilize the sections using 0.5% Triton-X 100 for 15 min. Wash the slides thrice with 1x PBS.
    10. Block the nonspecific binding of primary antibody by incubating the sections with 10% Fetal Bovine Serum (FBS) in 1x PBS for 1 h.
    11. Incubate the sections with primary antibody for 1 h at room temperature or overnight at 4 °C. Wash the slides thrice with 1x PBS for 3-5 min each to remove the unbound antibody.
    12. Add suitable fluorescent dye-conjugated secondary antibody and incubate for 45 min. Wash the slides thrice with 1x PBS for 3-5 min each.
      NOTE: The antibodies and their respective dilutions are mentioned in the Table of Materials. The retinal organoid sections were immunolabelled using PAX6 and CHX10 to detect early neuro-retinal precursor cells, and using Recoverin and CRX to detect committed retinal and photoreceptor precursor cells. Similarly, anti-PAX6 and anti-MITF were used to detect RPE precursors, and anti-CRALBP and anti-RPE65 were used to detect pigmented mature RPE cells by immunocytochemistry of 2D monolayer cultures.
    13. Counterstain the sections with DAPI or PI and mount them on a glass slide using the antifade mounting medium (see Table of Materials).
    14. Image and document the immunolabelled sections of retinal organoids and RPE cultures using a fluorescence or confocal laser scanning microscope to examine different cell layers expressing different retinal markers.

Results

Differentiation of hiPSCs into eye lineages is achieved by culturing the cells in different cocktails of culture medium containing supplements and growth factors in sequential steps at different time points, as described in Figure 1. The hiPSC cultures are maintained in Essential 8 medium, the pluripotent stem cell maintenance medium. Once they reach 70%-80% confluency (Figure 2A), the medium is replaced with Differentiation Induction Medium (DIM) on day 0 (refer to step 3.2) containing 1 ng/mL bFGF, 1 ng/mL Noggin, and 1% N2 supplement. Together with the neural-inducing N2 supplement, Noggin, the BMP signaling inhibitor, plays a crucial role in directing the cells toward neuroectodermal lineage by blocking mesodermal and endodermal commitment. On the 1st, 2nd, and 3rd day, the concentration of Noggin is increased to 10 ng/mL (refer to step 3.3 and 3.4). From the 4th day, the DIM is replaced with Retinal Differentiation Medium (RDM) (step 3.5), and the cultures are maintained continuously for up to 30 days. The B27 in the RDM cocktail contains additional supplements such as multiple antioxidants and D-Galactose, which promotes aerobic metabolism and helps in reducing oxidative stress, improving the viability of differentiating progenitor cells. In addition, the presence of retinol acetate (vitamin A) and growth hormones such as triiodo-I-thyronine (T3) promotes neural and retinal lineage differentiation.

On the 14th to 18th day, the formation of neural rosettes is observed, which marks the initiation of eye-field commitment (Figure 2B). The eye field precursors within the neural rosettes further proliferate and self-organize themselves into distinct eye field primordial clusters (EFPs) with circular neuro-retinal structures at the center. Other cell types such as the retinal pigmented epithelium (RPE), neural crest epithelium, and those that contribute to the ocular surface emerge and migrate out as contiguous epithelium with well-defined margins. Well-formed eye fields, as described above, can be observed between the 21st to 28th day of differentiation (Figure 2C,D). The central island of neuro-retinal cups are harvested between day 25-30 using a flame-pulled glass Pasteur pipette (Figure 2E) and are maintained as non-adherent suspension cultures in RDM for a further 1-2 weeks, until day 45. The proliferating retinal progenitors further self-organize themselves to form multilayered 3D retinal organoids of about 2-3 mm in diameter (Figure 2F,G). From day 46, the RDM is supplemented with 100 µM Taurine to promote neurogenesis and to improve cell survival in long-term organoid cultures in vitro (Figure 2H).

Retinal organoids are characterized at different stages of maturation for the expression of several retinal progenitor markers using reverse transcription PCR (RT-PCR) and immunohistochemistry (IHC). For this, the organoids are harvested for total RNA isolation on the 30th and 60th day of differentiation. RT-PCR results confirmed the induction and expression of neuro-retinal markers such as NEUROD1, ChX10, CRX, PKCß1, RLBP1, RHOK, OPN1SW, RCVRN, ABCA4, RD3, and PDE6C in 1-week-old retinal organoids (4-5 weeks after differentiation, OC-1M) and 4-week-old retinal organoids8,12 (7-8 weeks after differentiation, OC-2M) (Figure 3A). Immunohistochemistry and fluorescence imaging has confirmed the expression of early retinal progenitor markers PAX6, CHX10, and OTX2 in OC-1M and mature retinal markers RCVRN and CRX in OC-2M8,12 (Figure 3Bi,ii).

In addition to the central neuro-retinal cups, the other ocular cell types, such as the retinal pigmented epithelium (RPE), neural crest epithelium, and ocular surface epithelial cells, emerge and migrate out of the EFPs. The neuroectoderm-derived RPE progenitors appear as compactly arranged epithelial cells surrounding the EFPs, which gradually mature and get pigmented along the migratory margins from day 30-45 (Figure 4A-C). These adherent differentiation cultures, after the removal of retinal cups, can be therefore extended till day 45, to harvest proliferating RPE precursors (Figure 4D), which can be further enriched to prepare monolayer cultures of fully mature pigmented RPE cells. Mature pigmented RPE can be seen as monolayers with typical cobblestone morphology (Figure 4E). The RPE cell identity is further confirmed by immunocytochemistry using antibodies against RPE-specific markers such as MITF (RPE progenitor marker), PAX6 (progenitor and mature RPE marker), and RPE65 (mature RPE marker)10,12 (Figure 4F-H).

Pluripotent stem cell-derived retinal organoids can thus serve as in vitro models for studying various inherited retinal diseases7,8,9. Disease-specific stem cell models are developed either by generating patient-specific iPSC lines or by introducing disease-specific mutations in healthy control iPSC lines using the CRISPR-based gene editing approach7,8. The mutant iPSCs may or may not differentiate efficiently into retinal cell types depending on the gene mutations involved. While most healthy control cell lines followed the timeline described above, there can be deviations in the case of disease-specific iPSCs in terms of the differentiation timelines, EFP morphology, retinal cup size, lamination, and maturation. The retinal differentiation potential of an RB1-/- hiPSC line (LVIP15-RB1-CS3) that carries a biallelic deletion of 10 bp within the exon 18 of the human RB1 gene was examined, which results in a frameshift and complete loss of RB1 protein expression. It was observed that the loss of RB1 expression did not affect the eye and early retinal lineage differentiation of the mutant hiPSC line. However, a marked delay in timelines and a reduction in EFP forming efficiency were observed. The atypical EFPs that emerged had abnormal aggregates of retinal progenitors that failed to laminate and self-organize into proper retinal cups (Figure 5A,B) or lacked the surrounding zone of RPE and ocular surface epithelium (OSE) (Figure 5C). When picked and maintained as suspension cultures, these retinal progenitor clusters formed irregular neuro-retinal aggregates (Figure 5D).

iPSC culture differentiation timeline; diagram shows DIM, RDM, retinal organoid maturation process.
Figure 1: Timeline representing the differentiation of iPSCs into retinal organoids. Please click here to view a larger version of this figure.

Cell differentiation process; sequence of microscopy images; stem cell to embryoid body formation.
Figure 2: Self-organized 3D retinal organoid generation. (A) Growing hiPSCs cultures under feeder-free conditions. (B) Developing neuronal rosettes at day 14 of differentiation (asterisk). (C,D) Eye field primordial (EFP) clusters containing a central neuro-retinal cup-like structure (black arrows) surrounded by the migrating zone of the epithelium (white arrows) at day 21-28 of differentiation. (E) Flame-pulled glass Pasteur pipette with a hooked tip. The smooth curve at the hinge region is used for nudging and lifting the retinal cups (arrow). (F,G) Retinal cups harvested at day 25 and cultured under suspension to generate self-organized 3D retinal organoids. (H) Mature retinal organoids in suspension culture at day 45. Scale bars: 100 µm (A,B,D,G); 200 µm (C,F,H). Please click here to view a larger version of this figure.

Gene expression results; gel electrophoresis bands; microscopy of retinal markers PAX6, CHX10, RCVRN.
Figure 3: Characterization of retinal organoids. (A) Retinal gene expression profiling by RT-PCR of the undifferentiated normal hiPSC line23 (hiPSC-F2-3F1) (F2-UD) and the differentiated normal optic cups picked at 3-4 weeks of differentiation and matured further in suspension culture for 1 week (OC-1M) and 4 weeks (OC-2M) respectively. The cDNAs of all test samples were normalized using eEF1a as the loading control. (B) Confocal images of immunolabelled sections of (i) immature retinal organoids (OC-1M) using antibodies against the neuro-retinal progenitor markers CHX10, PAX6, and OTX2 (in red) and (ii) mature retinal organoids (OC-2M) using antibodies against the photoreceptor precursor markers Recoverin, and CRX (in red). The marked outermost layer of the retinal organoids with differentiating photoreceptor cells (box) in the left panels are zoomed and shown in the right panels. DAPI was used as a counterstain (in blue). The rudimentary inner segment-like extensions are marked by white arrows. Scale bar: 20 µm. Please click here to view a larger version of this figure.

Microscope image of cell differentiation in organoid culture; immunostaining for PAX6, MITF, RPE65.
Figure 4: Emergence of different ocular cell types. (A) EFP clusters with the neuro-retinal cup at the center and migrating RPE outgrowths showing pigmentation along the leading edges (white arrow). (B) Well-differentiated pigmented epithelial outgrowths from multiple EFPs all around the neuro-retinal island. (C) Higher magnification of an EFP shows the migratory zone of RPE progenitors (white arrow) and ocular surface epithelium (asterisk) surrounding a neuro-retinal cup. (D) Extended adherent cultures that developed monolayers of immature RPE cells containing both pigmented and non-pigmented cells. (E) Monolayer cultures of fully mature and pigmented RPE cells showing cobblestone morphology at day 60. (F-H) RPE cells expressing PAX6, MITF, and RPE65 in green. Scale bar: 200 µm (A,B); 100 µm (C-E); 20 µm (F-H). Please click here to view a larger version of this figure.

Cell differentiation process; microscope images of stem cells forming embryoid bodies in culture.
Figure 5: Abnormal retinal cup formation in RB1-/- mutant iPSCs. (A,B) EFPs with abnormal aggregates of retinal progenitors with distorted lamination and lack of striations. (C) EFP with the miniature neuro-retinal cup but lacking the surrounding zone of RPE and ocular surface epithelium (arrow). (D) Irregular neuro-retinal aggregates formed in suspension culture. Scale bar: 100 µm. Please click here to view a larger version of this figure.

Primer namePrime sequence (5'-3')Band size (bp)Ref Id
1heEF1αF: GAAGTCTGGTGATGCTGCCATTGT198NM_001402
R: TTCTGAGCTTTCTGGGCAGACTTG
2hNeuroD1F: CGCGCTTAGCATCACTAACT     349NM_002500
R: GCGTCTCTTGGGCTTTTGAT      
3hCHX10F: CAAGTCAGCCAAGGATGGCA     382NM_182894
R: CTTGACCTAAGCCATGTCCT       
4hCRXF: TCAACGCCTTGGCCCTAAGT        357NM_000554
R: ACACATCTGTGGAGGGTCTT       
5hPKC-β1F: AAAGGCAGCTTTGGCAAGGT     376NM_212535
R: CGAGCATCACGTTGTCAAGT     
6RLBP1F: TGCACCATTGAAGCTGGCTA     361NM_000326
R: AGAAGGGCTTGACCACATTG    
7RHOKF: CAAGCTGTATGCCTGCAAGA       360NM_002929
R: ATCCGGACATTGCCGTCATT        
8hOPN1SWF: TGCTTCATTGTGCCTCTCTC 373NM_001708
R: AGCTGCATGTGTCGGATTCA
9RCVRNF: AGACCAACCAGAAGCTGGAGT    367NM_002903
R: ACGGGTGTCATGTGAGTGGTA     
10hABCA4F: CACCGTAGCAGGCAAGAGTATT271NG_009073
R: AATGAGTGCGATGGCTGTGGAGA
11hRD3F: ATGGTGCTGGAGACGCTTAT 328NM_183059 
R: CTTCCTGCTTCATCCTCTCCA 
12hPDE6CF: GTTGATGCCTGTGAACAAATGC        351NM_006204
R: ACCACTCAGCATAGGTGTGAT     

Table 1: List of gene-specific primers for RT-PCR.

Components  for RNA-Primer mix Volume (in µL)
RNA (1-2 µg)
10 mM dNTP1
10 mM Oligo dT1
DEPC-treated waterupto 10 
Total Reaction Volume10

Table 2: RNA-primer master mix for cDNA conversion.

Components  for Mastermix 2Volume (in µL)
10x RT Buffer2
25 mM MgCl24
0.1 M DTT2
SuperScript III Reverse Transcriptase1
RNaseOUT1
Total Reaction Volume10

Table 3: Master mix 2 for cDNA conversion.

Components of PCRVolume  (in µL)/reaction
10x PCR Buffer2
2 mM dNTP2
Forward primer (5 µM)1
Reverse primer (5 µM)1
Taq Polymerase0.2
cDNA Template (50-100 ng)1
Sterile Milli-Q water12.8
Total Reaction Volume20
 

Table 4: Master mix for semi-quantitative PCR.

TemperatureTimeNo. of cycles
Denaturation95 °C5 minx 1
Denaturation95 °C30 sx 35
Annealing50-60 °C30 s
Extension72 °C30 s
Final Extension 72 °C10 minx 1

Table 5: PCR amplification conditions.

Discussion

hiPSCs are a powerful tool to study organ and tissue development in vitro. Recapitulating the disease phenotype by differentiating healthy versus disease-specific hiPSCs toward the retinal lineage can help in gaining newer insights into the pathophysiology of different forms of inherited retinal dystrophies. Several protocols have been described and adopted for the in vitro differentiation of PSCs into retinal cell types. Most of them involve the use of culture medium containing complex cocktails of recombinant growth factors, supplements, small molecules, and reagents, such as: N1, N2, and B27 supplements; BMP and TGFβ signaling blockers like Noggin, SB431542, LDN193189, and Follistatin, or inducers such as Activin A, Lefty, and IDE1; canonical Wnt signaling blockers such as DKK1, SFRP, IWP-2, and IWR-1-endo, or inducers such as CHIR99021, SB216763, and CKI-7; FGF receptor signaling blockers such as PD0325901 and PD173074 or inducers like bFGF; notch signaling inhibitors such as DAPT; other signaling molecules such as insulin-like growth factor (IGF-1); retinoic acid; growth hormones such as Triiodothyronine (T3) and Hydrocortisone; and anti-oxidants and other pro-survival factors such as Ascorbic acid, Nicotinamide, Taurine, Docosahexaenoic acid, 1-Thioglycerol, etc. These components are included in the culture medium at different stages of stem cell differentiation to stimulate or modulate various signaling cascades to induce eye and retinal lineage commitment11,12,13,14,15,16,17,18,19,20,21,22.

Here, a simpler, robust, and efficient method of generating retinal organoids directly from near-confluent, adherent cultures of hiPSCs is described. The simplified protocol involves using fewer supplements, growth factors, and small molecules that primarily trigger the initial differentiation of PSCs into the neuroectodermal lineage. Subsequent differentiation steps rely on the inherent ability of PSCs to synchronously differentiate into the cell type of related lineages, which then self-organize and mutually regulate the development and spatial organization of multiple cell types that contribute to the formation of complex tissues. The gradual withdrawal of bFGF and the addition of Noggin help in the successful induction of early neuro-ectodermal fate commitment within 3 days of differentiation. Continued maintenance of differentiation cultures in neural-inducing RDM, without adding any growth factors or small molecules, result in the induction of eye field primordial (EFP) structures with clear margins, within 3-4 weeks of differentiation. The EFPs contain multipotent progenitor cells, which upon undisturbed and continued maintenance, result in multi-lineage differentiation and self-assembly to form complex EFPs consisting of centrally positioned neuro-retinal cups or optic cups (OCs), surrounded by other related ocular cell types such as the retinal pigmented epithelium (RPE), neural crest epithelium, and ocular surface epithelium. Alternately, the PSCs can be grown as suspension cultures from day 1-3 to form EBs under identical culture conditions. The EBs can be further plated on day 4 and grown as adherent cultures on matrix-coated surfaces in RDM to initiate retinal lineage differentiation, as described above. Healthy differentiating cultures routinely give rise to about 20-30 EFPs per well of a 6-well plate. The OCs can be harvested from the EFPs at 3-4 weeks of retinal differentiation and are maintained in suspension cultures for a further 30-60 days, to enable the differentiation of neuro-retinal progenitors and to generate mature retinal organoids. After 4 weeks of suspension culture, about 70%-80% of the optic cups picked from EFPs remain intact, retain their lamination, and develop into mature retinal organoids (OC-2M), with RCVRN+ and CRX+ committed photoreceptor cells and inner segment-like extensions within the outermost layers.

The confluency of growing iPSC cultures is critical at the time of initiation of differentiation and shifting the cultures to DIM. Cultures with smaller colonies and confluence below 60%, and those that are precociously differentiating, result in significantly reduced EFP numbers. When the eye field clusters emerge, the central island of neuro-retinal cups should be harvested within 1 week. This can be done by gently nudging and lifting the intact cups using the angle or the curved region of the flame-pulled glass capillary tip, as described in the protocol section. Care must be taken not to damage the cups. Further delays in picking would result in flattening and a loss of 3D organization due to the proliferation and migration of neuro-retinal progenitor cells, which makes harvesting difficult and results in atypical retinal organoids.

The efficiency of eye field induction and maturation of retinal cups varies between different disease or patient-specific hiPSC lines, depending on the underlying genetic defects. For example, the retinal lineage commitment and EFP forming efficiencies of a RP disease-specific line was identical to that of the healthy control cells, whereas an RB1 null line failed to form EFPs (data not shown). Some lines carrying mutations linked to Leber Congenital Amaurosis formed atypical EFPs with defects in their size, self-assembly, lamination, and maturation of retinal progenitors (data not shown). Further molecular validations and gene expression profiling of patient-specific retinal organoids compared to healthy control tissues would be necessary to understand the pathophysiology of a disease condition. Considering the variability in patient genomes and the involvement of multi-gene networks in disease manifestations, it may also be important to study retinal organoids derived from isogenic iPSC lines to establish an absolute genotype-phenotype correlation in disease modeling studies. Such isogenic lines can be created either by targeted gene knockouts in healthy control lines or by correcting the pathogenic mutations in patient-specific iPSCs, using advanced genome editing techniques8,9.

Such intact retinal organoids derived from normal or disease-specific iPSC lines can be used in novel drug screening and testing. Photoreceptor precursors within the retinal organoids and other ocular cell types, such as the RPE and corneal epithelium within the EFP outgrowths, can be further isolated and enriched for their applications in basic research and regenerative medicine. The protocol described here can be easily adopted to GMP-compliant processes for preparing clinical grade cells meant for preclinical and clinical trial evaluations.

Disclosures

All authors have no conflict of interest or financial disclosures.

Acknowledgements

The authors acknowledge the scientific and technical support from Dr. Chitra Kannabiran, Geneticist; Dr. Subhadra Jalali, Retinal Consultant; Dr. Milind Naik, Oculoplastic Surgeon; and Dr. Swathi Kaliki, Ocular Oncologist at the LV Prasad Eye Institute, Hyderabad toward the generation of normal and patient-specific iPSC lines. The authors acknowledge the R&D grants from the Science and Engineering Research Board, Department of Science and Technology (IM), (SB/SO/HS/177/2013), Department of Biotechnology (IM), (BT/PR32404/MED/30/2136/2019) ,and Senior Research Fellowships from ICMR (S.M., D.P.), UGC (T.A.), and CSIR (V.K.P.), Government of India.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
0.22 µm Syringe filtersTPP99722 
15 mL centrifuge tubeTPP91015
50 mL centrifuge tubeTPP91050
6 well platesTPP92006
Anti-Chx10 Antibody; Mouse monoclonalSanta CruzSC3655191:50 dilution
Anti-CRX antibody; Rabbit monoclonalAbcamab1406031:300 dilution
Anti-MiTF antibody, Mouse monoclonalAbcamab32011:250 dilution
Anti-Recoverin Antibody; Rabbit polyclonal     MilliporeAB55851:300 dilution
B-27 Supplement (50x), serum freeThermo Fisher17504044
Basic Fibroblast growth factor (bFGF)Sigma AldrichF0291
Centrifuge 5810REppendorf
Coplin Jar (50 mL)Tarson
Corning Matrigel hESC-Qualified MatrixCorning354277
CryoTubesThermo FisherV7884
DMEM/F-12, GlutaMAX supplement (basal medium)Thermo Fisher10565-018
DreamTaq DNA polymeraseThermo FisherEP0709
Dulbeco’s Phosphate Buffered SalineThermo Fisher14190144
Essential 8 medium kitThermo FisherA1517001
Ethylene diamine tetraaceticacid disodium salt dihydrate (EDTA)Sigma AldrichE5134
Falcon Not TC-treated Treated Petri Dish, 60 mm Corning351007
Fetal Bovine Serum, qualified, United States Gibco26140079
GelDocXR+ with Image lab softwareBIO-RADAgarose Gel documentation system 
GlutaMAX SupplementThermo Fisher35050061
Goat anti-Mouse IgG (H+L), Alexa Fluor 488InvitrogenA110011:300 dilution
Goat anti-Mouse IgG (H+L), Alexa Fluor 546InvitrogenA110301:300 dilution
Goat anti-Rabbit IgG (H+L), Alexa Fluo 546InvitrogenA110351:300 dilution
Goat anti-Rabbit- IgG (H+L), Alexa Fluor 488InvitrogenA110081:300 dilution
HistoCore MULTICUTLeicaFor sectioning
KnockOut Serum ReplacementThermo Fisher10828028
L-Acsorbic acidSigma AldrichA92902
MEM Non-Essential Amino Acids Solution (100x)Thermo Fisher11140-050
N2 supplement (100x)Thermo Fisher17502048
NanoDrop 2000Thermo FisherTo quantify RNA
ParaformaldehydeQualigens23995
Pasteur Pipets, 9 inch, Non-Sterile, UnpluggedCorning7095D-9
Penicillin-Streptomycin Thermo Fisher15140-122
Recombinant Anti-Otx2 antibody , Rabbit monoclonalAbcamab1839511:300 dilution
Recombinant Anti-PAX6 antibody; Rabbit MonoclonalAbcamab1950451:300 dilution
Recombinant Anti-RPE65 antibody, Rabbit MonoclonalAbcamab2317821:300 dilution
Recombinant Human Noggin ProteinR&D Systems6057-NG
SeaKem LE AgaroseLonza50004
Serological pipettes 10 mLTPP94010
Serological pipettes 5 mLTPP94005
Sodium ChlorideSigma AldrichS7653
Sodium Citrate Tribasic dihydrateSigma AldrichS4641
Starfrost (silane coated) microscopic slidesKnittel
SuperScript III First-Strand Synthesis SystemThermo Fisher18080051
SuperScript III First-Strand Synthesis System for RT-PCRInvitrogen18080051
Triton X-100Sigma AldrichT8787
TRIzol ReagentInvitrogen15596026
UltraPure 0.5 M EDTA, pH 8.0Thermo Fisher15575020
VECTASHIELD Antifade Mounting Medium with DAPI Vector laboratoriesH-1200 
VitronectinThermo FisherA27940
Y-27632 dihydrochloride (Rho-kinase inhibitor)Sigma AldrichY0503
Zeiss LSM 880ZeissConfocal microscope

References

  1. Dandona, R., et al. Moderate visual impairment in India: the Andhra Pradesh Eye Disease Study. British Journal of Ophthalmology. 86 (4), 373-377 (2002).
  2. Hartong, D. T., Berson, E. L., Dryja, T. P. Retinitis pigmentosa. Lancet. 368 (9549), 1795-1809 (2006).
  3. Sen, P., et al. Prevalence of retinitis pigmentosa in South Indian population aged above 40 years. Ophthalmic Epidemiology. 15 (4), 279-281 (2008).
  4. Nazimul, H., Rohit, K., Anjli, H. Trend of retinal diseases in developing countries. Expert Review of Ophthalmology. 3 (1), 43-50 (2008).
  5. RetNet - Retinal Information Network. , Available from: https://sph.uth.edu/retnet/ (2022).
  6. Cicero, S. A., et al. Cells previously identified as retinal stem cells are pigmented ciliary epithelial cells. Proceedings of the National Academy of Sciences. 106 (16), 6685-6690 (2009).
  7. Guo, Y., et al. Modeling retinitis pigmentosa: retinal organoids generated from the iPSCs of a patient with the USH2A mutation show early developmental abnormalities. Frontiers in Cellular Neuroscience. 13, 361(2019).
  8. Lane, A., et al. Modeling and rescue of RP2 Retinitis pigmentosa using iPSC-derived retinal organoids. Stem Cell Reports. 15 (1), 67-79 (2020).
  9. Li, Y. P., Deng, W. L., Jin, Z. B. Modeling retinitis pigmentosa through patient-derived retinal organoids. STAR Protocols. 2 (2), 100438(2021).
  10. Gonzalez-Cordero, A., et al. Recapitulation of human retinal development from human pluripotent stem cells generates transplantable populations of cone photoreceptors. Stem Cell Reports. 9 (3), 820-837 (2017).
  11. Meyer, J. S., et al. Optic vesicle-like structures derived from human pluripotent stem cells facilitate a customized approach to retinal disease treatment. Stem Cells. 29 (8), 1206-1218 (2011).
  12. Zhu, J., Lamba, D. A. Small molecule-based retinal differentiation of human embryonic stem cells and induced pluripotent stem cells. Bio-Protocol. 8 (12), 2882(2018).
  13. Nakano, T., et al. Self-formation of optic cups and storable stratified neural retina from human ESCs. Cell Stem Cell. 10 (6), 771-785 (2012).
  14. Reichman, S., et al. From confluent human iPS cells to self-forming neural retina and retinal pigmented epithelium. Proceedings of the National Academy of Sciences. 111 (23), 8518-8523 (2014).
  15. Zhong, X., et al. Generation of three-dimensional retinal tissue with functional photoreceptors from human iPSCs. Nature Communications. 5, 4047(2014).
  16. Wahlin, K. J., et al. Photoreceptor outer segment-like structures in long-term 3D retinas from human pluripotent stem cells. Scientific Reports. 7 (1), 766(2017).
  17. Capowski, E. E., et al. Reproducibility and staging of 3D human retinal organoids across multiple pluripotent stem cell lines. Development. 146 (1), (2019).
  18. Chichagova, V., et al. Differentiation of retinal organoids from human pluripotent stem cells. Current Protocols in Stem Cell Biology. 50 (1), 95(2019).
  19. Kelley, R. A., Chen, H. Y., Swaroop, A., Li, T. Accelerated development of rod photoreceptors in retinal organoids derived from human pluripotent stem cells by supplementation with 9-cis retinal. STAR Protocols. 1 (1), 100033(2020).
  20. Zhou, S., et al. Differentiation of human embryonic stem cells into cone photoreceptors through simultaneous inhibition of BMP, TGFbeta and Wnt signaling. Development. 142 (19), 3294-3306 (2015).
  21. Chambers, S. M., et al. Highly efficient neural conversion of human ES and iPS cells by dual inhibition of SMAD signaling. Nature Biotechnology. 27 (3), 275-280 (2009).
  22. Mellough, C. B., et al. IGF-1 signaling plays an important role in the formation of three-dimensional laminated neural retina and other ocular structures from human embryonic stem cells. Stem Cells. 33 (8), 2416-2430 (2015).
  23. Susaimanickam, P. J., et al. Generating minicorneal organoids from human induced pluripotent stem cells. Development. 144 (13), 2338-2351 (2017).

Reprints and Permissions

Tags

Retinal DifferentiationHuman IPSC CulturesSuspension CultureRetinal Progenitor CellsDisease ModelingPhotoreceptor PrecursorsImmunohistochemistryRetinal Pigment Epithelium