A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Screening Sperm for the Rapid Isolation of Germline Edits in Zebrafish

1.9K views

⸱

DOI:

10.3791/64686

⸱

February 10th, 2023

In This Article

Summary

CRISPR-Cas technologies have revolutionized the field of genome editing. However, finding and isolating the desired germline edit remains a major bottleneck. Therefore, this protocol describes a robust method for quickly screening F0 CRISPR-injected zebrafish sperm for germline edits using standard PCR, restriction digest, and gel electrophoresis techniques.

Abstract

The advent of targeted CRISPR-Cas nuclease technologies has revolutionized the ability to perform precise genome editing in both established and emerging model systems. CRISPR-Cas genome editing systems use a synthetic guide RNA (sgRNA) to target a CRISPR-associated (Cas) endonuclease to specific genomic DNA loci, where the Cas endonuclease generates a double-strand break. The repair of double-strand breaks by intrinsic error-prone mechanisms leads to insertions and/or deletions, disrupting the locus. Alternatively, the inclusion of double-stranded DNA donors or single-stranded DNA oligonucleotides in this process can elicit the inclusion of precise genome edits ranging from single nucleotide polymorphisms to small immunological tags or even large fluorescent protein constructs. However, a major bottleneck in this procedure can be finding and isolating the desired edit in the germline. This protocol outlines a robust method for screening and isolating germline mutations at specific loci in Danio rerio (zebrafish); however, these principles may be adaptable in any model where in vivo sperm collection is possible.

Introduction

The CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas system is a powerful tool to perform loci-specific mutagenesis and precise genome editing in the Danio rerio (zebrafish) model system1,2,3,4. The Cas-ribonucleoprotein (RNP) is comprised of two main components: a Cas endonuclease (commonly Cas9 or Cas12a) and a locus-specific synthetic guide RNA (sgRNA)5. Together, the Cas-RNP generates a double-stranded break (DSB) in the desired locus that can be repaired by one of two intrinsic repa....

Access restricted. Please log in or start a trial to view this content.

Protocol

This study was carried out in line with the guidelines in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocol was approved by the University of Texas at Austin Animal Care and Use Committee (AUP-2021-00254).

1. Designing the sgRNA for CRISPR mutagenesis

  1. Obtain the exon sequence containing the targeted loci.
  2. Design a synthetic guide RNA (sgRNA) with a protospacer adjacent motif (PAM) site that is specific to the Cas endonuclease.
    1. If co-injecting a donor construct, design the sgRNA to have a predicted cut site as close to the desired edits a....

Access restricted. Please log in or start a trial to view this content.

Results

The experimental approaches described in this protocol allow for the more rapid identification of genome edits or putative deleterious alleles by focusing on the analysis of thousands of genomes derived from the collection of F0-injected male sperm. Figure 2 highlights how to interpret the results obtained using this protocol.

To generate mutations in the p2ry12 locus, one-cell stage zebrafish embryos were injected with Cas9 endonuclease and a p2ry12<.......

Access restricted. Please log in or start a trial to view this content.

Discussion

This protocol describes a method for rapidly characterizing putative genome edits or targeted mutations using CRISPR-Cas technology by focused analysis on F0 male sperm genomes. This protocol should be amenable to other animal models where sperm is readily available for sampling without euthanasia. This method will increase the throughput of screening for desired edits and is especially useful for identifying rare HDR-mediated knock-in events. This approach also serves to reduce the number of experimental animals used to.......

Access restricted. Please log in or start a trial to view this content.

Acknowledgements

We would like to thank Anna Hindes at Washington University School of Medicine for her initial efforts in obtaining good-quality sperm genomic DNA using the hot shot method. This work was funded by the National Institute of Arthritis and Musculoskeletal and Skin Diseases of the National Institutes of Health under Award (R01AR072009 to R.S.G.).

....

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
Agarose powder Fisher BioReagentsBP1356-100
Breeding tanksCarolina Biological 161937
BstNI Restriction EnzymeNEBR0168S
Cas9 EndonucleaseIDT1081060
DNA Ladder, 100 bp Thermo Scientific FERSM0241
dnah10 donor construct  Sigma-AldrichDNA Oligo in Tube; 0.025 nM, standard desalt purification, dry.
Phosphorothioate bond on the donor at the first three phosphate bonds on both the 5’ and 3’ ends (5'-CCTCTCTCCCTTTCAGAAGCTTC
TGCTCATCCGCTGCTTCTGCCT
GGACCGAGTGTACCGTGCCGTC
AGTGATTACGTCACGC-3')
dnah10 forward primer Sigma-AldrichDNA Oligo in Tube; 0.025 nM, standard desalt purification, dry (5'-CATGGAACTCTTTCCTAATGAGT
TTGGC-3')
dnah10 reverse primer Sigma-AldrichDNA Oligo in Tube; 0.025 nM, standard desalt purification, dry ('5-AGTAGAGATCACACATCAACAGA
ATACAGC-3') 
dnah10 synthetic sgRNA Synthego Synthetic sgRNA, target sequence: 5'-GCTCATCCGCTGCTTCAGGC-3'
Electrophoresis power supplyThermo Scientific 105ECA-115
Filter forcepsMilliporeXX6200006P
Fish (system) waterGenericn/a
Gel electrophoresis system (including casting frame, comb, and electrophoresis chamber) Thermo Scientific B2
Gel imaging light box Azure BiosystemsAZI200-01
Gel stain, 10000X InvitrogenS33102
Glass bowl, 250 mL Genericn/a
Isolation tanks, 0.8 L AquaneeringZT080
Microcap capillary tube with bulb, 20 µL Drummond1-000-0020/CA
MinicentrifugeBio-Rad12011919EDU
Micropipettes, various with appropriate tipsGeneric n/a
Microwave Generic n/a
Nuclease free waterPromegaP119-C
Paper towelsGenericn/a
PCR tubes, 0.2 mLBioexpressT-3196-1
Plastic spoon, with drilled holes/slots Genericn/a
KCl solution, 0.2 M RNAse FreeSigma-AldrichP9333
p2ry12 forward primer Sigma-AldrichDNA Oligo in Tube; 0.025 nM, standard desalt purification, dry (5'-CCCAAATGTAATCCTGACCAGT
-3')
p2ry12 reverse primerSigma-AldrichDNA Oligo in Tube; 0.025 nM, standard desalt purification, dry (5'-CCAGGAACACATTAACCTGGAT
-3') 
p2ry12 synthetic sgRNA Synthego Synthetic sgRNA, target sequence: 5'-GGCCGCACGAGGTCTCCGCG-3'
Restriction Enzyme 10X BufferNEBB6003SVIAL
NaOH solution, 50 mM Thermo Scientific S318; 424330010
Sponge, 1-inch x 1-inch cut with small oval divotGeneric n/a
StereomicroscopeZeissStemi 508
Taq polymerase master mix, 2XPromegaM7122
TBE Buffer Concentrate, 10XVWRE442
Thermal CyclerBio-Rad1861096
Tissue paperFisher Scientific06-666
Tricaine-methanesulfonate solution (Syncaine, MS-222), 0.016% in fish water (pH 7.0±0.2) Syndel200-266
Tris Base, 1M (Buffered with HCl to ph 8.0) PromegaH5131

References

  1. Auer, T. O., Duroure, K., De Cian, A., Concordet, J. P., Del Bene, F. Highly efficient CRISPR/Cas9-mediated knock-in in zebrafish by homology-independent DNA repair. Genome Research. 24 (1), 142-153 (2014).
  2. Hwang, W. Y., et al. Efficient ....

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

CRISPR Genome EditingZebrafish Germline EditsSperm ScreeningPCR Restriction EnzymesGel ElectrophoresisIn Vitro FertilizationF0 Male CarriersIndel DetectionThermal CyclerDNA Sequencing