Gene Expression Analyses in Human Follicles

Summary

Here, we describe a protocol outlining how to isolate human ovarian follicles from frozen-thawed cortical tissue to perform gene expression analyses.

Abstract

The ovary is a heterogeneous organ composed of different cell types. To study the molecular mechanisms occurring during folliculogenesis, the localization of proteins and gene expression can be performed on fixed tissue. However, to properly assess gene expression levels in a human follicle, this complex and delicate structure must be isolated. Hence, an adapted protocol previously described by Woodruff's laboratory has been developed to separate follicles (the oocyte and the granulosa cells) from their surrounding environment. The ovarian cortical tissue is first manually processed to obtain small fragments using two tools: a tissue slicer and a tissue chopper. The tissue is then enzymatically digested with 0.2% collagenase and 0.02% DNase for at least 40 min. This digestion step is performed at 37 °C and 5% CO₂ and is accompanied by mechanical pipetting of the medium every 10 min. After incubation, the isolated follicles are collected manually using a calibrated microcapillary pipette under microscope magnification. If follicles are still present in the pieces of tissue, the procedure is completed with manual microdissection. The follicles are collected on ice in a culture medium and are rinsed twice in droplets of phosphate-buffered saline solution. This digestion procedure must be carefully controlled to avoid follicle deterioration. As soon as the structure of the follicles appears to be compromised or after a maximum of 90 min, the reaction is stopped with a 4 °C blocking solution containing 10% fetal bovine serum. A minimum of 20 isolated follicles (sized under 75 µm) should be collected to obtain an adequate amount of total RNA after RNA extraction for real-time quantitative polymerase chain reaction (RT-qPCR). After extraction, the quantification of total RNA from 20 follicles reaches a mean value of 5 ng/µL. The total RNA is then retrotranscribed into cDNA, and the genes of interest are further analyzed using RT-qPCR.

Introduction

The ovary is a complex organ composed of functional and structural units, including the follicles within the cortex and the stroma. Folliculogenesis, the process of follicle activation, growth, and maturation from a primordial quiescent state to a mature follicle able to be fertilized and to support early embryonic development, is widely studied in research¹. Unraveling the mechanisms driving this phenomenon could improve fertility care for women². Analyses on fixed human tissue allow the assessment of protein expression and gene localization within the functional units of the ovary^3,4. However, specific techniques are needed to dissociate the follicles from the surrounding cortex to accurately assess gene expression levels within the ovarian follicles. Hence, in a previous study, a follicle isolation technique was developed to allow analyses of gene expression directly from the functional unit of the ovary⁵. Different approaches have been developed, such as enzymatic digestion and/or mechanical isolation, as well as laser capture microdissection, that allow follicle isolation within a piece of tissue^6,7,8,9. Follicle isolation is widely used, either with human or animal ovarian tissue, to evaluate the gene expression profiles of follicles at all stages of development^10,11,12. However, an optimal isolation procedure should take into account the fragile structure of the follicle within the dense cortex and, therefore, should be performed with care to avoid any damage⁷. This manuscript describes a procedure, adapted from a protocol described by Woodruff's laboratory, to isolate human follicles from frozen-thawed ovarian cortex in order to perform gene expression analyses¹³.

The first step of ovarian follicle isolation from frozen human tissue is the thawing procedure. This process is performed based on the clinical protocol used for the grafting of cryopreserved ovarian tissue, as previously described^14,15. The process aims to remove the cryoprotectant agents by rinsing the ovarian cortex in decreasing concentrations of the medium. Then, the tissue is fragmented before enzymatic and mechanical isolation to retrieve the follicles. Follicles at different stages can be distinguished using a stereomicroscope with high magnification and good-quality optics in order to isolate the ones of interest. Each isolated follicle is measured using a ruler integrated into the microscope, and the follicles can be pooled according to their developmental stage: primordial follicles (30 µm), primary follicles (60 µm), secondary follicles (120-200 µm), and antral follicles (>200 µm)¹⁶. Further classification can be performed according to the morphology of the follicles: primordial follicles have one layer of flattened granulosa cells (GCs), primary follicles have one layer of cuboidal GCs, secondary follicles have at least two layers of cuboidal GCs, and the presence of a cavity among the GCs characterizes the antral stage. When follicles of interest are selected, RNA extraction is performed. The RNA quantity and quality are evaluated prior to real-time quantitative polymerase chain reaction (RT-qPCR) (Figure 1).

Protocol

This project was approved by the Erasme Hospital Ethical Committee (Brussels, Belgium). The patient included in this protocol underwent ovarian tissue cryopreservation (OTC) for fertility preservation before chemotherapy exposure in 2000. The patient signed informed written consent to donate her residual frozen tissue to research at the end of the storage period.

1. Thawing of cryopreserved ovarian tissue

1. Prepare a 6-well plate containing five thawing solutions. The first well contains 5 mL of cryoprotectant solution composed of Leibovitz-15 medium, 0.1 mol/L sucrose, 1.5 mol/L dimethyl sulfoxide (DMSO), and 1% human serum albumin (HSA). The next wells contain 5 mL of Leibovitz-15 medium with decreasing concentrations of cryoprotectant: 1 mol/L, 0.5 mol/L, and 2 x 0 mol/L DMSO.
   NOTE: The cryoprotectant solution can differ according to the protocol used in the fertility clinic.
2. Remove a vial containing an ovarian cortical fragment from liquid nitrogen in compliance with safety rules (cryogenic gloves, protective glasses, and closed shoes), and keep the tube at room temperature (RT) for 30 s.
3. Soak the vial in double-distilled water for 2 min at RT with gentle agitation before opening the vial under a vertical hood and directly transferring it into the first well of the 6-well plate (on ice).
4. Transfer the fragment successively into each well of the 6-well plate, with each containing decreasing concentrations of cryoprotectant in 5 mL of Leibovitz-15 medium. Gently agitate the tissue in each medium for 5 min (on ice).

2. Follicle isolation

NOTE: All experiments are conducted using RNase-free materials and under a vertical hood.

1. Transfer the thawed tissue into a 2 mm gridded Petri dish filled with 10 mL of dissection medium (Leibovitz-15 medium, sodium pyruvate [2 mmol/L], L-glutamine [2 mmol/L], HSA [0.3%], penicillin G [30 µg/mL], and streptomycin [50 µg/mL]). Adjust the size of the tissue with a scalpel if necessary.
   NOTE: Depending on the clinical protocol, the size of the frozen tissue can vary from 8 mm x 4 mm x 1 mm to 4 mm x 2 mm x 1 mm. For this protocol, two strips of 4 mm x 2 mm x 1 mm were used.
2. Pile up the three pieces of the tissue slicer, put the fragment between the two blocks, and cut the fragment in half using a blade, sliding through the blocks to obtain two fragments of 0.5 mm thickness.
3. Use the tissue chopper to cut the fragment and obtain smaller pieces. If necessary, cut the remaining pieces manually with a scalpel until the tissue is totally shattered.
4. Transfer the fragmented tissue into a gridded Petri dish filled with 7 mL of digestion medium (culture medium [McCoy's 5A medium, 3 mmol/L glutamine, 0.1% HSA, 30 µg/mL penicillin G, 50 µg/mL streptomycin, 2.5 µg/mL transferrin, 4 ng/mL selenium, and 50 µg/mL ascorbic acid] supplemented with 0.2 % collagenase and 0.02% DNase).
5. Put the dish in the incubator at 5% CO₂ and 37 °C. Every 10 min, take the Petri dish out of the incubator, and flush the tissue by pipetting up and down with a 1 mL pipette.
6. After 45 min of incubation in the digestion medium, place the dish under a stereomicroscope with a magnification range of 5x-6.3x, and retrieve the follicles using a microcapillary pipette. Select the follicles of interest, and isolate them by sucking them up with a mouth pipette.
   NOTE: Mouth pipetting should be performed carefully to avoid the loss of material into the pipe and contamination.
7. If the follicles remain stuck in a piece of cortex, isolate them mechanically with two 27 G syringes by ripping the cortex off with the tip of the syringes to release follicles from the stroma.
   NOTE: Do not touch the follicles with the syringes to avoid damaging them.
8. Transfer the follicles with the microcapillary in a 4-well plate containing drops of 15 µL of the calibrated culture medium covered by 500 µL of oil culture (1 to 10 follicles per drop). This step maintains the follicle viability during the collection process. At the end of the procedure, rinse the follicles twice for 5 s each time into two drops of 15 µL of phosphate-buffered saline solution (PBS) covered by 500 µL of oil culture (on ice).
9. Collect 20 follicles with a minimal quantity of PBS using the mouth pipette (maximum 10 µL) in an empty tube, and keep the tube on ice.
   NOTE: For RNA stability, it is crucial to perform step 2.8 and step 2.9 on ice. Around 20 follicles (<75 µm) are needed to have enough RNA for standard RT-qPCR (SYBR Green).
10. After a maximum of 90 min of incubation in the digestion medium, stop the enzymatic reaction by adding into the Petri dish an excess of cold (4 °C) blocking solution (7.5 mL) composed of culture medium supplemented with 10% fetal bovine serum (FBS).
    ​NOTE: The blocking solution can be added as soon as the experimenter observes follicles sticking on the plate or damaged follicles (asymmetric shape or darker-colored follicles). It is advised to perform follicle isolation within a maximum period of 2.5 h to avoid follicular damage and to perform RNA extraction immediately after isolation.

3. RNA extraction

NOTE: RNA extraction is performed following the instructions provided with an RNA extraction kit by adapting the elution volumes.

1. Suspend the isolated follicles by adding 100 µL of the lysis solution provided with the RNA extraction kit to the tube containing the follicles under a chemical hood, and vortex at a high speed (2,500 rpm/min) to break the structure of the follicles. Add 50 µL of ethanol (100%) to the tube, and briefly vortex at a high speed.
   NOTE: As the lysis buffer contains 2-mercaptoethanol and thiocyanic acid, this step must be performed with caution under a chemical hood.
2. Transfer the total volume of the tube (approximately 160 µL) to a microfilter cartridge assembly comprising a column and a collection tube, and centrifuge it for 10 s at 16,363 x g at 4 °C. Wash the column with 180 µL of wash solution 1, provided with the kit, and centrifuge the tube for 10 s at 16,363 x g at 4 °C.
3. Add 180 µL of wash solution 2/3, provided with the kit, to the column, and centrifuge for 10 s at 16,363 x g at 4 °C. Perform this step twice. Centrifuge the tube one last time for 1 min to dry the filter, and place a new collection tube under the cartridge.
4. Perform the elution of the nucleic acids in two steps:
   1. First, add 8 µL of warm elution solution (75 °C) to the filter, wait for 1 min at RT, and centrifuge for 30 s at 16,363 x g at 4 °C.
   2. Repeat this step with 7 µL of elution solution.
      NOTE: The tube containing the eluted nucleic acids must be kept on ice. To avoid DNA contamination, a supplemental step of DNA degradation is highly recommended-step 3.5.
5. Incubate the tube with 2 IU DNase and 1x DNase buffer for 20 min at 37 °C. Block the enzymatic activity with 1/10 DNase inactivation reagent for 2 min at RT.
6. Centrifuge the tube for 1.5 min at 16,363 x g at 4 °C. Finally, collect the suspension containing the RNA, and transfer it to a new tube.
7. Assess the quantity of RNA present in the sample by using a spectrophotometer (NanoDrop 2000 software > Nucleic Acid > RNA). Use 1 µL of elution solution as a blank, and measure the RNA quantity extracted from isolated follicles with 1 µL of solution.
8. Check the 260/280 ratio for RNA purity (around 2.0). Store the sample at −80 °C, or directly retrotranscribe it to perform RT-qPCR.
   NOTE: To assess the RNA integrity, the sample can be processed with a high-resolution automated electrophoresis system before or after freezing at −80 °C. In this work, following retrotranscription, RT-qPCR was performed with the following cycle:
   Hold stage with 20 s at 50 °C and 10 min at 95 °C
   40 PCR cycles with 15 s at 95 °C and 1 min at 60 °C
   Melt curve stage with 15 s at 95 °C, 1 min at 60 °C, 30 s at 95 °C, and 15 s at 60 °C

Results

Using this isolation procedure, the experimenter can retrieve follicles from the stromal environment to perform specific gene expression analyses. Based on the size and morphology of the follicles, it is possible to differentiate the different stages of folliculogenesis. The experimenter can select follicles of interest according to their size using an adapted microcapillary pipette. By using a microcapillary of maximum 75 µm, it is possible to discriminate primordial and primary follicles from secondary, antral, and mat...

Discussion

The cryopreservation of ovarian tissue is a promising approach for preserving the fertility of cancer patients. In the clinic, thawed cortical tissue is grafted back into the patient after remission, allowing the resumption of ovarian function and fertility^19,20. Besides clinical use, residual ovarian fragments may also be donated for research at the end of the storage period to study the mechanisms regulating folliculogenesis. Moreover, this tissue is particular...

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
2 mm gridded Petri dish	Corning	430196
2100 Bioanalyzer instrument	Agilent	G2939BA
2100 Expert software	Agilent	version B.02.08.SI648
4-wells plate	Sigma Aldrich	D6789
6-wells plate	Carl Roth	EKX5.1
Agilent total RNA 6000 pico kit	Agilent	5067-1513
Ascorbic acid	Sigma Aldrich	A4403
Aspirator tube assemblies for microcapillary pipettes	Sigma Aldrich	A5177
Centrifuge	Eppendorf	5424R
Collagenase IV	LifeTechnologies	17104-019
DMSO	Sigma Aldrich	D2650
DNase	Sigma Aldrich	D4527-10kU
FBS	Gibco	10270-106
GoScript reverse transcriptase	Promega	A5003
HSA	CAF DCF	LC4403-41-080
Leibovitz-15	LifeTechnologies	11415-049
L-Glutamine	Sigma Aldrich	G7513
McCoy’s 5A + bicarbonate + Hepes	LifeTechnologies	12330-031
McIlwain tissue chopper	Stoelting	51350
Microcapillary RI EZ-Tips 200 µm	CooperSurgical	7-72-2200/1
Microcapillary RI EZ-Tips 75 µm	CooperSurgical	7-72-2075/1
NanoDrop 2000/2000c operating software	ThermoFisher	version 1.6
NanoDrop spectrophotometer	ThermoFisher	2000/2000c
Penicillin G	Sigma Aldrich	P3032
PowerTrack SYBR green master mix	ThermoFisher	A46109
Primers: GDF9			F: CCAGGTAACAGGAATCCTTC R: GGCTCCTTTATCATTAGATTG
Primers: HPRT			F: CCTGGCGTCGTGATTAGTGAT R: GAGCACACAGAGGGCTACAA
Primers: Kit Ligand			F: TGTTACTTTCGTACATTGGCTGG R: AGTCCTGCTCCATGCAAGTT
Real-Time qPCR Quantstudio 3	ThermoFisher	A33779
RNAqueous-micro total RNA isolation kit	ThermoFisher	AM1931
Selenium	Sigma Aldrich	S9133
Sodium pyruvate	Sigma Aldrich	S8636
Stereomicroscope	Nikon	SMZ800
Streptomycine sulfate	Sigma Aldrich	S1277
Sucrose	Sigma Aldrich	S1888
Thermo Scientific Forma Series II  water-jacketed CO2 incubators	ThermoFisher	3110
Thomas Stadie-Riggs tissue slicer	Thomas Scientific	6727C10
Transferrin	Roche	10652202001