This protocol describes an RNA interference and ChIP assay to study the epigenetic inheritance of RNAi-induced silencing and associated chromatin modifications in C. elegans.
Method Article
* These authors contributed equally
This protocol describes an RNA interference and ChIP assay to study the epigenetic inheritance of RNAi-induced silencing and associated chromatin modifications in C. elegans.
Transgenerational epigenetic inheritance (TEI) allows the transmission of information through the germline without changing the genome sequence, through factors such as non-coding RNAs and chromatin modifications. The phenomenon of RNA interference (RNAi) inheritance in the nematode Caenorhabditis elegans is an effective model to investigate TEI that takes advantage of this model organism's short life cycle, self-propagation, and transparency. In RNAi inheritance, exposure of animals to RNAi leads to gene silencing and altered chromatin signatures at the target locus that persist for multiple generations in the absence of the initial trigger. This protocol describes the analysis of RNAi inheritance in C. elegans using a germline-expressed nuclear green fluorescent protein (GFP) reporter. Reporter silencing is initiated by feeding the animals bacteria expressing double-stranded RNA targeting GFP. At each generation, animals are passaged to maintain synchronized development, and reporter gene silencing is determined by microscopy. At select generations, populations are collected and processed for chromatin immunoprecipitation (ChIP)-quantitative polymerase chain reaction (qPCR) to measure histone modification enrichment at the GFP reporter locus. This protocol for studying RNAi inheritance can be easily modified and combined with other analyses to further investigate TEI factors in small RNA and chromatin pathways.
Epigenetic inheritance allows the transmission of gene regulatory information across generations and can therefore allow the environment or experiences of parents to affect their progeny. In C. elegans, germline gene silencing initiated by exogenous double-stranded RNA (dsRNA) can be inherited for multiple generations in progeny not exposed to the original trigger1,2,3,4. This process, termed RNA interference (RNAi) inheritance, is one of several related epigenetic silencing phenomena in C. elegans, including piRNA-initiated multigenerational silencing2,5, paramutation/RNAe (RNA-induced epigenetic silencing)6,7,8, and multicopy array-initiated silencing9, which have overlapping but distinct requirements for small RNA and chromatin regulation machinery. In C. elegans exogenous RNAi, dsRNA is processed into small interfering RNAs (siRNAs) that act in a complex with primary Argonaute proteins to recognize their target mRNA. This targeting leads to the amplification of secondary siRNAs that associate with secondary Argonautes to silence target mRNA through both cytoplasmic and nuclear silencing pathways. For germline-expressed RNAi targets, the nuclear secondary Argonaute HRDE-1 and additional nuclear RNAi factors target nascent transcripts, resulting in transcriptional repression and recruitment of histone methyltransferases to deposit repressive chromatin marks, including H3K9me310. Histone H3K9me3 promotes the establishment of heritable silencing of germline-expressed green fluorescent protein (GFP) transgenes by RNAi inheritance11,12.
The goal of this protocol is to use a transgene expressing a GFP-histone fusion protein in the germline as a reporter for RNAi inheritance and to assay changes in histone modifications at the reporter transgene locus using chromatin immunoprecipitation and quantitative polymerase chain reaction (ChIP-qPCR). This protocol describes a standardized plate-based RNAi feeding approach to initiate reporter silencing. It also provides a detailed timeline for passaging animals between generations by isolating in utero embryos from gravid adults by alkaline hypochlorite treatment ('bleaching'). Methods and representative data for monitoring the frequency of GFP silencing in a subset of the population by fluorescence microscopy and for histone H3K9me3 ChIP-qPCR are also described. Reporter-based RNAi inheritance assays provide a highly tractable system to functionally dissect the roles of genetic and environmental factors in epigenetic regulation13,14, and genetic screens using such reporters have identified both genes that are required for2,3,15 and genes that negatively regulate16,17 the duration of transgenerational epigenetic inheritance.
NOTE: An assay timeline is provided in Figure 1.
1. Preparation of RNAi nematode growth medium (RNAi-NGM) plates
2. Starting the RNAi inheritance assay: bleaching and plating embryos for the P0 generation
NOTE: Before starting the RNAi Inheritance assay, worms containing the GFP reporter mjIs134 [mex-5p::gfp-h2b::tbb-2 3'UTR]7 should be maintained unstarved at 21 °C for at least two generations.

Figure 1: RNAi inheritance assay schematic. Proposed timeline for RNAi-NGM plate preparation and RNAi inheritance assay setup. Gravid adults are picked on Day -4 onto NGM plates seeded with OP50-1. After 4 days, adult progeny are bleached and embryos are plated onto RNAi-NGM plates. The P0 generation is exposed to RNAi for 4 days at 21 °C. Once the worms reach adulthood, replicates are passaged by bleaching and scored for germline GFP expression each generation. Please click here to view a larger version of this figure.
3. Passaging and scoring each generation for germline GFP expression
NOTE: To facilitate scoring, use a vinyl record to create agarose pads with linear ridges to line up the worms. This method was adapted from Rivera Gomez and Schvarzstein19.
4. Animal collection for ChIP
NOTE: The number of animals and timing depends on the strain, developmental stage, epitope, and number of immunoprecipitation (IP) targets. In the example below, collect animals for three IPs: H3K9me3, histone H3, and IgG control. The ChIP protocol was adapted from Askjaer et al.21.
5. Formaldehyde crosslinking
CAUTION: Work with formaldehyde in a fume hood to prevent vapour exposure.
6. Sonication
NOTE: Sonication parameters depend on the type and model of sonicator and animal stage. Parameters such as sample volume and concentration, on/off intervals, number of cycles, and power setting need to be optimized empirically. For example, over a time course of sonication, monitor worm lysis using a protein assay and determine when the concentration reaches a plateau. In addition, monitor when the average shear size of the genomic DNA is approximately 200-1,000 bp by electrophoresis of DNA, purified following crosslinking reversal, on a 1.5% agarose/tris-acetate-EDTA (TAE) gel.
7. Immunoprecipitation
NOTE: Scale the amount of antibody and magnetic beads to the volume and concentration of lysate.
8. Washes and elution
NOTE: To ensure that the magnetic beads do not dry, add each wash or elution buffer quickly after aspirating the previous wash.
9. Reverse crosslinking and DNA elution
10. qPCR reaction setup and run
NOTE: The primer, reaction setup, and thermocycler parameters should be modified to match the manufacturer's recommendations for the qPCR reaction mix in use.
11. Determining amplification efficiency and verifying product specificity

12. Calculating the percentage of Input


Animals carrying the germline-expressed GFP-histone H2B [mex-5p::gfp-h2b::tbb-2 3'UTR]7 reporter (Figure 2A) were exposed to GFP RNAi or control RNAi by feeding, and passaged as described in the protocol and Figure 1. Nuclear GFP signal in the germline was manually scored using a fluorescence dissecting microscope for a sample of the population at each generation. Silencing of the transgene was fully penetrant in the scored P0 and F1 animals treated with GFP RNAi (Figure 2B). In the F2 generation, the proportion of the population exhibiting inheritance of GFP silencing was approximately 50%. By the F5 generation, the majority of the population did not show inheritance of silencing, and by the F10 generation, no inheritance was detected, as all the animals expressed GFP.
To determine the change in histone H3K9me3 enrichment corresponding to RNAi-induced silencing, ChIP-qPCR was performed on F1 generation animals following either GFP RNAi or control RNAi treatment. As expected, the GFP RNAi-treated population displayed higher histone H3K9me3 levels at the GFP target and at the 1.3 kb downstream region compared to control RNAi-treated animals (Figure 2C). The specificity of the histone H3K9me3 ChIP is supported by the enrichment at a positive control locus (clec-18) known to be enriched in this mark, but not at a nearby negative control locus (hrp-2). Histone H3 enrichment and near-background enrichment in the IgG control immunoprecipitations were also detected at all qPCR loci, as expected. When ChIP enrichment at the reporter is normalized to the clec-18 positive control locus, higher histone H3K9me3 enrichment upon GFP RNAi is shown, whereas histone H3 enrichment is similar between the control and GFP RNAi treatments (Figure 2D). Since GFP RNAi is not expected to affect histone H3K9me3 or total histone H3 occupancy at the clec-18 locus, this normalization mitigates against technical variation, such as differences in ChIP efficiency between the GFP RNAi and control RNAi samples. The fold-change of histone H3K9me3 and histone H3 levels between RNAi treatments shows GFP reporter-specific histone H3K9me3 enrichment, independent of histone occupancy, upon GFP RNAi-induced silencing (Figure 2E).

Figure 2: GFP RNAi-induced silencing corresponds to elevated H3K9me3 enrichment at the RNAi target. (A) Diagram of the germline-expressed GFP RNAi reporter mjIs134[mex-5p::gfp-h2b::tbb-2 3'UTR] with qPCR amplicon regions labelled. (B) GFP expression scored across generations after RNAi treatments at 21 °C. Error bars represent the standard deviation from two biological replicates. (C) ChIP-qPCR of H3K9me3, histone H3, and IgG control in F1 young adults from two biological replicates. clec-18 and hrp-2 are the positive and negative control loci for H3K9me3 enrichment, respectively. (D) H3K9me3 and histone H3 enrichment at the GFP RNAi reporter normalized to the clec-18 positive control locus. (E) Change in H3K9me3 and histone H3 enrichment between GFP RNAi- and control RNAi-treated animals, with normalization to clec-18. Dotted line represents a fold-change of 1. Please click here to view a larger version of this figure.
In this protocol, dsRNA is introduced by feeding, which has become a standard method in C. elegans18. For RNAi inheritance assays, the feeding approach provides an easy method to obtain a large P0 population2,11,12,22,23,24,25. However, the timing and duration of RNAi exposure affects the efficacy of transgene silencing26, and the concentration of RNAi bacteria affects the persistence of heritable RNAi silencing1. Therefore, standardized RNAi bacteria and worm growth are important to obtain a consistent level of GFP silencing and duration of inheritance. Here, embryos are plated on RNAi plates so that P0 animals are exposed to RNAi bacteria from hatching. Alternative approaches have plated synchronized L124,27 or L425 stage animals onto RNAi-NGM plates. In addition, since starvation and other stresses affect the maintenance of RNAi inheritance13, plates must be monitored to prevent overcrowding and exhaustion of the food supply. As an alternative to initiating RNAi by feeding, some of the pioneer C. elegans RNAi inheritance studies induced RNAi through gonad injection, which provides a greater control of dsRNA concentration1,28.
In this protocol, each generation is passaged as a population with alkaline hypochlorite treatment, as previously described16,22,23,24. Hypochlorite treatment ensures the F1 generation will not be contaminated with RNAi bacteria from the parental environment22 and prevents potential undesired population bottle-necking. However, bulk passaging may also be a limitation, since individual animals may have distinct inheritance patterns1,29. An alternative method to establish each generation is to select individual animals1,2,9,11,25. This approach allows for tracking phenotypes within lineages and the incorporation of genetic crosses. Lineage analysis may also be advantageous for low penetrance phenotypes12.
Fluorescent protein expression is a powerful and convenient readout of RNAi-induced silencing2,3,4,12,14,15,16,25,30. As described in this protocol, GFP expression can be manually scored as ON or OFF11,12,15,16,25. Manual scoring can be further refined by assigning qualitative intensity levels3,4,14. Alternatively, automated intensity scoring of microscopy images11,12,14,25,27 or flow cytometry fluorescence measurement of live animals2 can provide a quantitative and high-throughput readout. However, since the reporter expression is restricted to the germline, a caveat of automated approaches is that they must also differentiate between animals with silenced GFP expression versus animals with no germline, especially if the study incorporates mutants with abnormal germline development. As an alternative to GFP fluorescence, reverse transcription (RT)-qPCR can be used to quantify RNAi target pre-mRNA and mRNA levels2,16,23,24. This approach provides a more direct readout of silencing, which targets RNA, and is especially useful for other RNAi targets where silencing does not produce a visible phenotype. A limitation of using artificial GFP reporters is that exogenous and endogenous sequences are differentially regulated in transgenerational RNAi11. Studies with endogenous targets, such as the temperature-sensitive embryonic lethal allele oma-1(zu405)1,11,16,25, should therefore be considered as a complementary approach to fluorescent transgene reporters.
The analysis of ChIP in the context of RNAi inheritance assays requires comparison between treatments and replicates. First, to account for differences in starting material between samples, the ChIP signal is normalized to Input signal at the same locus as the 'percentage of Input'. Processing a histone H3 ChIP in parallel will help to determine whether any histone modification alterations correspond with changes in nucleosome density. In addition, because ChIP is a multi-step process, the efficiency may vary between samples. The selection of appropriate positive and negative control loci is useful to evaluate and compare the signal-to-noise ratio among samples and experiments. In addition, to facilitate comparisons between samples, the ChIP DNA qPCR threshold cycle values at the RNAi target are often normalized to a control locus3,11,15,23,30,31. To evaluate the effects of the RNAi treatment, the ratio of the ChIP signal in treatment RNAi versus control or no RNAi conditions is also compared. A limitation of the current approach is that ChIP is performed with whole animals, while the response to RNAi treatment may be unique to the germline. An approach to overcome this caveat is to perform ChIP using isolated germline nuclei. Additional technical considerations for optimizing ChIP have also been discussed extensively elsewhere32,33.
Overall, this RNAi inheritance and ChIP protocol provides a detailed and easy-to-adapt foundation that can be integrated with other techniques to further explore transgenerational epigenetic regulation. For example, high throughput sequencing libraries can be constructed from the ChIP DNA (ChIP-seq) for a more detailed view of the chromatin landscape both proximal to the RNAi target and on a genome-wide scale.
All authors confirm that they do not have any conflicts to disclose.
We wish to acknowledge the labs in the C. elegans community who developed and shared the tools and whose work is cited in this manuscript. Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440). This work was supported by a Canadian Institutes of Health Research (CIHR) Project grant to A.L.S. (PJT-175245). C.L. is supported by a Natural Sciences and Engineering Research Council of Canada (NSERC) postgraduate scholarship (PGS-D).
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| Agarose | Bioshop | AGA002 | |
| Ampicillin | Bioshop | AMP201 | Make a 100 mg/mL solution in ultrapure water. Filter-sterilize and store at -20 °C. |
| Anti-H3K9me3 Rabbit Polyclonal Antibody | Abcam | ab8898 | Concentration is batch-dependent (0.9 - 1 mg/mL). |
| Anti-Histone H3 Rabbit Polyclonal Antibody | Abcam | ab1791 | Concentration is batch-dependent (0.7 - 1 mg/mL). |
| Bleach (6% Sodium hypochlorite) | Lavo | 02358107 | |
| C. elegans strain with GFP RNAi Reporter | NA | SX1263 | Sapetschnig et al. 2015 (ref. 7). A gift from E. Miska lab, University of Cambridge. |
| Carbenicillin | BioShop | CAR544 | Make a 25 mg/mL solution in ultrapure water. Filter-sterilize and store at -20 °C. |
| Dynabeads Protein G Magnetic Beads | Invitrogen | 10003D | |
| E. coli strain HT115(DE3) | Caenorhabditis Genetics Center (CGC) | HT115(DE3) | |
| E. coli strain OP50-1 | Caenorhabditis Genetics Center (CGC) | OP50-1 | |
| EDTA (0.5 M, pH 8.0) | Invitrogen | 15575020 | |
| Fluorescence Stereoscope | Zeiss | Axio Zoom.V16 | |
| Formaldehyde (37%) | Sigma | F8775 | |
| Glycine | Sigma | 50046 | Make a 1.25 M solution and store at 4 °C. |
| HEPES-KOH (1 M, pH 7.5) | Teknova | H1035 | |
| Hydrophobic Printed Slides, 10 wells | VWR | 100488-904 | |
| IGEPAL CA-630 (Octylphenol ethoxylate) | BioShop | NON999 | Make a 10% (v/v) solution in ultrapure water and store at room temperature. |
| IPTG (Isopropyl-β-D-thiogalactoside) | BioShop | IPT001 | Make a 0.2 g/mL solution in ultrapure water. Filter-sterilize and store at -20 °C. |
| iTaq Universal SYBR Green Supermix | Bio-Rad | 1725122 | |
| LB Agar Plates supplemented with 100 µg/mL Ampicillin | NA | NA | Standard lab recipe. |
| Levamisole (Tetramisole hydrochloride) | Sigma | L9756 | Make a 200 mM solution in ultrapure water. Store at -20 °C. |
| LiCl (8 M) | Sigma | L7026 | |
| M9 Buffer | NA | NA | 22 mM KH2PO4, 42 mM Na2HPO4, 86 mM NaCl, 1 mM MgSO4. |
| Magnetic Separator (1.5 mL tubes) | Applied Biosystems | A13346 | |
| Magnetic Separator (0.2 mL tubes) | Permagen | MSR812 | |
| Microscope Cover Glass | Fisher Scientific | 12541B | |
| Microscope Slide | Technologist Choice | LAB-037 | |
| NaCl (5 M) | Promega | V4221 | For ChIP buffers. |
| NaOH | Sigma | S5881 | Make a 10 M solution and store at room temperature. |
| NGM Plates | NA | NA | 1.7% (w/v) agar, 0.3% (w/v) NaCl, 0.25% (w/v) peptone, 1 mM CaCl2, 5 μg/mL cholesterol, 25 mM Potassium phosphate pH 6.0, 1 mM MgSO4, 50 µg/mL streptomycin. |
| Normal Rabbit IgG (1 mg/mL) | Cell Signaling Technology | 2729 | |
| Petri Dishes (35 mm x 10 mm) | Sarstedt | 82.1135.500 | |
| Phosphate Buffered Saline (10X) | Fisher BioReagents | BP3991 | |
| Plasmid - Control RNAi | Addgene | L4440 (Plasmid #1654) | |
| Plasmid - GFP-targetting RNAi | Addgene | L4417 (Plasmid #1649) | Note, alternative L4440-derived plasmids targeting GFP can be used. |
| Primer pair [-3.3 kb upstream of gfp] | Integrated DNA Technologies | NA | F: AAACCAAAGGACGAGAGATTCA, R: GGCTCGATCAAGTAAAATTTCG |
| Primer pair [+1.3 kb downstream of gfp] | Integrated DNA Technologies | NA | F: TCGACCAGTTCTAAAGTCACCG, R: ACGTGCGGGATCATTTCTTACT |
| Primer pair [clec-18] | Integrated DNA Technologies | NA | F: TGCTCCATGACCTCAACAACA, R: AGTACAGTTCACCGATCCAGA |
| Primer pair [gfp exon 1] | Integrated DNA Technologies | NA | F: CTGGAGTTGTCCCAATTCTTGT, R: GGGTAAGTTTTCCGTATGTTGC |
| Primer pair [gfp exon 4] | Integrated DNA Technologies | NA | F: GATGGCCCTGTCCTTTTACCA, R: ATGCCATGTGTAATCCCAGCA |
| Primer pair [hrp-2] | Integrated DNA Technologies | NA | F: CGTCAACAGGGAGCAGCTG, R: CCTCCGAACTTTCTCTGTCCA |
| Protease Inhibitor Cocktail Tablet | Roche | 11836170001 | |
| Proteinase K | Bioline | BIO-37084 | |
| QIAquick PCR Purification Kit | Qiagen | 28104 | |
| Real-Time PCR Detection System | Bio-Rad | CFX96 | |
| RNAi-NGM plates | NA | NA | 1.7% (w/v) agar, 0.3% (w/v) NaCl, 0.25% (w/v) peptone, 1 mM CaCl2, 5 µg/mL cholesterol, 25 mM Potassium phosphate buffer pH 6.0, 1 mM MgSO4, 25 µg/mL carbenicillin and 5 mM IPTG. |
| RNase A | Sigma | R4642 | |
| Sarkosyl (N-Lauroylsarcosine sodium salt) | Sigma | L5777 | Make a 10% (w/v) solution and store at room temperature protected from light for a maximum of 1 month. |
| SDS | Sigma | 74255 | Make a 10% (w/v) solution and store at room temperature. |
| Sodium deoxycholate | Sigma | 30970 | Make a 5% (w/v) solution and store at room temperature protected from light for a maximum of 1 month. |
| Sonication Tube | Evergreen | 214-3721-010 | |
| Sonication Tube Cap | Evergreen | 300-2911-020 | |
| Sonicator | Qsonica | Q800R3-110 | |
| Streptomycin sulfate | Bioshop | STP101 | Make a 50 mg/mL solution in ultrapure water. Filter-sterilize and store at -20 °C. |
| TAE buffer (1X) | NA | NA | 40 mM Tris, 20 mM acetate, 1 mM EDTA |
| Tally counter clicker | Uline | H-7350 | |
| Tetracycline | Bioshop | TET701 | Make a 5 mg/mL solution in ethanol and store at -20 °C. |
| Thermomixer | Eppendorf | 05-400-205 | |
| Tris-HCl (1 M, pH 8.0) | Invitrogen | 15568025 | |
| Triton X-100 | Sigma | T8787 | Make a 10% (v/v) solution in ultrapure water and store at room temperature. |