A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Single-Copy Gene Locus Chromatin Purification in Saccharomyces cerevisiae

2K views

⸱

DOI:

10.3791/65460

⸱

November 17th, 2023

In This Article

Summary

This protocol presents a locus-specific chromatin isolation method based on site-specific recombination to purify a single-copy gene locus of interest in its native chromatin context from budding yeast, Saccharomyces cerevisiae.

Abstract

The basic organizational unit of eukaryotic chromatin is the nucleosome core particle (NCP), which comprises DNA wrapped ~1.7 times around a histone octamer. Chromatin is defined as the entity of NCPs and numerous other protein complexes, including transcription factors, chromatin remodeling and modifying enzymes. It is still unclear how these protein-DNA interactions are orchestrated at the level of specific genomic loci during different stages of the cell cycle. This is mainly due to the current technical limitations, which make it challenging to obtain precise measurements of such dynamic interactions. Here, we describe an improved method combining site-specific recombination with an efficient single-step affinity purification protocol to isolate a single-copy gene locus of interest in its native chromatin state. The method allows for the robust enrichment of the target locus over genomic chromatin, making this technique an effective strategy for identifying and quantifying protein interactions in an unbiased and systematic manner, for example by mass spectrometry. Further to such compositional analyses, native chromatin purified by this method likely reflects the in vivo situation regarding nucleosome positioning and histone modifications and is, therefore, amenable to further structural and biochemical analyses of chromatin derived from virtually any genomic locus in yeast.

Introduction

The dynamic organization of eukaryotic genomes into chromatin compacts the DNA to fit within the confines of the nucleus while ensuring sufficient dynamics for gene expression and accessibility for regulatory factors. In part, this versatility is mediated by the nucleosome, the basic unit of chromatin, which comprises a core particle with 147 bp of DNA wrapped ~1.7 times around the histone octamer1. The nucleosome is a highly dynamic structure with respect to its composition, with numerous histone variants and posttranslational modifications (PTMs) on the N- and C-terminal histone tails. Furthermore, eukaryotic chromatin interacts with a multit....

Access restricted. Please log in or start a trial to view this content.

Protocol

See the Table of Materials for details related to all the materials and instruments used in this protocol. See Table 1 for a list of the solutions, buffers, and media used.

1. Recombinant yeast strain construction

  1. To construct a recombination-competent yeast strain, transform SbfI-digested plasmid K238 into a yeast strain with integrated LexA-binding sites and RS recombination sites at the locus of interest13,14.
    NOTE: The transformed SbfI restriction fragment contains the required expression cassette for constituti....

Access restricted. Please log in or start a trial to view this content.

Results

The purification of the ~1.4 kb ARS316 chromatin domain was mediated by the constitutively expressed LexA-TAP adapter protein. To serve as a negative control, we conducted purifications using an isogenic strain that expresses LexA-TAP but does not contain integrated RS and LexA-binding sites. Figure 3 illustrates the DNA analysis outcome from a standard purification experiment performed on both the control and a recombination-competent strain targeting the ARS316 locus. After DNA isolation a.......

Access restricted. Please log in or start a trial to view this content.

Discussion

The identification of the factors and chromatin landscape of a specific target genomic region continues to pose a major challenge in chromatin research18. This protocol describes an efficient system to specifically excise and purify distinct chromatin domains from yeast chromosomes. To our knowledge, the purity and yield of this single-step purification overcome many of the limitations of locus-specific chromatin purification methods, thus allowing for the achievement of very high enrichment of th.......

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors have no conflicts of interest to disclose.

Acknowledgements

Work in the S.H. laboratory was supported by the DFG through SFB1064 (project ID 213249687), the European Research Council (ERC Starting Grant 852798 ConflictResolution), and the Helmholtz Gesellschaft.

....

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
Yeast strains
Control Strain: MATa; ura3Δ0; leu2Δ0; his3Δ1; met15Δ0; bar1::kanMX4; Chr I 212kb::LEU2 pTEF2-LEXA-TAP pGAL1-10 RecRSection 1, see references 13 and 14
Recombination Strain: MATa; ura3Δ0; leu2Δ0; his3Δ1; met15Δ0; bar1::kanMX4; RS_LEXA_NS-3_ARS316_NS+3_RS; Chr I 212kb::LEU2 pTEF2-LEXA-TAP pGAL1-10 RecRSection 1, see reference 13 and 14
Plasmid
K238 plasmidSection 1, see reference 13
Storage: Store at -20 °C
K071 Spike-in plasmid DNASection 7.1, see reference 13
Storage: Store at -20 °C
Reagents
AcetoneCarl Roth5025.1Section 2
Storage: Store at room temperature
Ammonium acetate (NH4Ac)Sigma AldrichA7262Section 6 and 7.1
Storage: Store at room temperature
Ammonium solution (NH4OH) 25%Merck Millipore533003Section 6
Storage: Store at room temperature
Ammonium sulfateSanta CruzSc-29085Section 2
Storage: Store at room temperature
Bacto agarBD (VWR)90000-760Section 3
Storage: Store at room temperature
Bacto peptoneBD (VWR)211820Section 3
Storage: Store at room temperature
β-MercaptoethanolSigma Aldrich07604Section 7.2
Storage: Store at 4 °C
Chemiluminescent substrate kitThermoFisher34580Section 7.2
Storage: Store at 4 °C
Di-Sodium Hydrogen phosphate dodecahydrateMerck1.06579.1000Section 2 and 7.1
Storage: Store at room temperature
Dithiothreitol (DTT)ThermoFisher15508013Section 4
Storage: Store at 4 °C
EthanolMerck100983Section 7.1
Storage: Store at room temperature
Ethylenediaminetetraacetic acid (EDTA)Sigma AldrichEDSection 7.1
Storage: Store at room temperature
Galactose (20% (w/v) stock)Sigma AldrichG0625-1KG  /  5KGSection 3
Storage: Store at room temperature
Gel loading dye (6x)BioLabsB7024ASection 7.1
Storage: Store at -20 °C
GlusoseSigma-AldrichG8270Section
Storage: Store at room temperature
GlycineCarl Roth.0079.4Section 2
Storage: Store at room temperature
Glycogen (5 mg/mL)InvitrogenAM9510Section 7.1
Storage: Store at -20 °C
Hydrochloric acid (HCl)PanReac AppliChem182109.1211Section 2, 4 and 7.1
Storage: Store at room temperature
Magnesium Acetate (MgAc)Bernd Kraft15274.2600/C035Section 4
Storage: Store at room temperature
Magnesium chloride (MgCl2)Sigma AldrichM8266Section 6
Storage: Store at room temperature
Nu PAGE LDS sample buffer (4x)Invitrogen2399549Section 7.2
Storage: Store at room temperature
Phenol/Chloroform/Isoamyl alcohol (25:24:1 v/v)Invitrogen15593-031Section 7.1
Storage: Store at 4 °C
Potassium chloride (KCl)SigmaP9541Section 4
Storage: Store at room temperature
Radioactively labeled α-32P dATP (3,000 Ci/mmol, 10 mCi/mL)Hartmann AnalyticSRP-203Section 7.1
Storage: Store at 4 °C
RadPrime labeling systemThermoFisher18428-011Section 7.1
Storage: Store at -20 °C
Raffinose (20% (w/v) stock)SERVA34140.03Section 3
Storage: Store at room temperature
Sodium chloride (NaCl)MerckK53710504142Section 7.1
Storage: Store at room temperature
Sodium citrate (Na3C6H5O7)Sigma-Aldrich71402Section 7.1
Storage: Store at room temperature
Sodium hydroxide (NaOH)Sigma AldrichS5881Section 7.1
Storage: Store at room temperature
Sodium n-dodecyl sulfate (SDS) (5% stock (w/v) )Alfa AesarA11183Section 7.1
Storage: Store at room temperature
Sodium phosphate monobasicSigma-Aldrich71496Section 2 and 7.1
Storage: Store at room temperature
Sodium azideSanta Cruz Biotechnologysc-208393Section 2
Storage: Store at -20 °C
 TriethylamineSigma Aldrich90340Section 2
Storage: Store at room temperature
Tris baseChem CruzSC-3715BSection 2 and 4
Storage: Store at room temperature
Triton X-100Sigma AldrichX100Section 2 and 4
Storage: Store at room temperature
Tween-20Bernd Kraft18014332Section 4
Storage: Store at room temperature
Yeast extractBD (VWR)212720Section 3
Storage: Store at room temperature
Yeast mating factor alpha (1 µg/mL stock ) BiomolY2016.5Section 3
Storage: Store at -20 °C
Yeast Synthetic Drop-out medium Supplements without LEUCINESigma AldrichY1376Section 1, see reference 14
Enzymes
HpaI restriction enzyme (5,000 U/mL)NEBR0105SSection 7.1
Storage: Store at -20 °C
Protease and Phosphatase Inhibitor Cocktail (100x)ThermoFisher Scientific78446Section 4
Storage: Store at4 °C
Proteinase K (10 mg/mL)SERVA33756Section 7.1
Storage: Store at -20 °C
RNase A (10 mg/mL) ThermoFisherEN0531Section 7.1
Storage: Store at -20 °C
TEV protease (10000 U/µL)NEBP8112SSection 5
Storage: Store at -20 °C
Materials
BcMag Epoxy-Activated Magnetic BeadsBioclone Inc.FC-102Section 2
Storage: Store at 4 °C
Dry iceSection 4
Low-binding centrifuge tubes 2.0 mLEppendorf22431102Section 4
Microspin G-25 ColumnsCytiva27-5325-01Section 7.1
Storage: Store at room temperature
ParafilmMerckP7793Section 4
Positive nylon membraneBiozol11MEMP0001Section 7.1
Storage: Store at room temperature
PVDF transfer membraneImmobilon-Merck MilliporeIPVH00010Section 7.2
Storage: Store at room temperature
SDS-PAGE gel 4-12% bis-tris (15 well, 1.5 mm)Invitrogen NP0336BOXSection 7.2
Storage: Store at 4 °C
Syringe (25 mL) with luer fittingHenke Sass Wolf4200-000V0Section 3
Whatman paper (Grade 3MM CHR Cellulose Western Blotting Paper Sheet)Cytiva3030-917Section 7.1
Storage: Store at room temperature
Antibodies
Anti-LexA, rabbit polyclonal IgG, DNA binding region antibodyMerck Millipore06-719Section 7.2
Storage: Store at -20 °C
Goat Anti-Rabbit IgG (H+L), Horseradish peroxidase conjugateInvitrogenG21234Section 7.2
Storage: Store at -20 °C
Peroxidase Anti-Peroxidase (PAP) antibody produced in rabbit for the detection of TAP-tagged proteinsSigma AldrichP1291-500ULSection 7.2
Storage: Store at -20 °C
Rabbit IgG antibodiesSigmaI5006-100MGSection 2
Storage: Store at 4 °C
Primers (10 µM)
ARS316: fwd 5'- CGGCATTATCGTACACAACCT, rev 5'- GTTCTTCGTTGCCTACATTTTCTSection 7.1
K071 Spike-in plasmid DNA: fwd: 5'-TTTTCGCTGCTTGTCCTTTT, rev 5'- CATTTTCGTCCTCCCAACATSection 7.1
PCR fragment from yeast genomic DNA as a template  for ARS316 amplification (for southern blot): fwd 5’- AAATTCTGCCCTTGATTCGT                                                  rev 5’- TTTGTTTATCTCATCACTAATSection 7.1
PDC1: fwd 5'- CATGATCAGATGGGGCTTCA, rev 5'-ACCGGTGGTAGCGACTCTGTSection 7.1
Equipment
Coffee grinderGastroback42601Section 4
Dewar flaskNAL GENE4150-2000Section 3
DynaMag TM-2 magnetic rackInvitrogen12321DSection 4, 5 and 6
Hybridization ovenHybaid Mini10Ri418Section 2
MicrocentrifugeEppendorf5424RSection 4 and 7.1
UV-crosslinkerAnalytikjena95-0174-02Section 7.1

References

  1. Kornberg, R. D., Lorch, Y. Twenty-five years of the nucleosome, fundamental particle of the eukaryote chromosome. Cell. 98 (3), 285-294 (1999).
  2. Gauchier, M., van Mierlo, G., Vermeulen, M., Déjardin, J. Purification and enrichment of specific chromatin loci. Nature Methods

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Nucleosome Core ParticleProtein-DNA InteractionsAffinity PurificationMagnetic Bead IsolationNative ChromatinHistone ModificationsDNA Replication Origins