This protocol presents a locus-specific chromatin isolation method based on site-specific recombination to purify a single-copy gene locus of interest in its native chromatin context from budding yeast, Saccharomyces cerevisiae.
A subscription to JoVE is required to view this content. Sign in or start your free trial.
Method Article
This protocol presents a locus-specific chromatin isolation method based on site-specific recombination to purify a single-copy gene locus of interest in its native chromatin context from budding yeast, Saccharomyces cerevisiae.
The basic organizational unit of eukaryotic chromatin is the nucleosome core particle (NCP), which comprises DNA wrapped ~1.7 times around a histone octamer. Chromatin is defined as the entity of NCPs and numerous other protein complexes, including transcription factors, chromatin remodeling and modifying enzymes. It is still unclear how these protein-DNA interactions are orchestrated at the level of specific genomic loci during different stages of the cell cycle. This is mainly due to the current technical limitations, which make it challenging to obtain precise measurements of such dynamic interactions. Here, we describe an improved method combining site-specific recombination with an efficient single-step affinity purification protocol to isolate a single-copy gene locus of interest in its native chromatin state. The method allows for the robust enrichment of the target locus over genomic chromatin, making this technique an effective strategy for identifying and quantifying protein interactions in an unbiased and systematic manner, for example by mass spectrometry. Further to such compositional analyses, native chromatin purified by this method likely reflects the in vivo situation regarding nucleosome positioning and histone modifications and is, therefore, amenable to further structural and biochemical analyses of chromatin derived from virtually any genomic locus in yeast.
The dynamic organization of eukaryotic genomes into chromatin compacts the DNA to fit within the confines of the nucleus while ensuring sufficient dynamics for gene expression and accessibility for regulatory factors. In part, this versatility is mediated by the nucleosome, the basic unit of chromatin, which comprises a core particle with 147 bp of DNA wrapped ~1.7 times around the histone octamer1. The nucleosome is a highly dynamic structure with respect to its composition, with numerous histone variants and posttranslational modifications (PTMs) on the N- and C-terminal histone tails. Furthermore, eukaryotic chromatin interacts with a multit....
Access restricted. Please log in or start a trial to view this content.
See the Table of Materials for details related to all the materials and instruments used in this protocol. See Table 1 for a list of the solutions, buffers, and media used.
1. Recombinant yeast strain construction
Access restricted. Please log in or start a trial to view this content.
The purification of the ~1.4 kb ARS316 chromatin domain was mediated by the constitutively expressed LexA-TAP adapter protein. To serve as a negative control, we conducted purifications using an isogenic strain that expresses LexA-TAP but does not contain integrated RS and LexA-binding sites. Figure 3 illustrates the DNA analysis outcome from a standard purification experiment performed on both the control and a recombination-competent strain targeting the ARS316 locus. After DNA isolation a.......
Access restricted. Please log in or start a trial to view this content.
The identification of the factors and chromatin landscape of a specific target genomic region continues to pose a major challenge in chromatin research18. This protocol describes an efficient system to specifically excise and purify distinct chromatin domains from yeast chromosomes. To our knowledge, the purity and yield of this single-step purification overcome many of the limitations of locus-specific chromatin purification methods, thus allowing for the achievement of very high enrichment of th.......
Access restricted. Please log in or start a trial to view this content.
The authors have no conflicts of interest to disclose.
Work in the S.H. laboratory was supported by the DFG through SFB1064 (project ID 213249687), the European Research Council (ERC Starting Grant 852798 ConflictResolution), and the Helmholtz Gesellschaft.
....Access restricted. Please log in or start a trial to view this content.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| Yeast strains | |||
| Control Strain: MATa; ura3Δ0; leu2Δ0; his3Δ1; met15Δ0; bar1::kanMX4; Chr I 212kb::LEU2 pTEF2-LEXA-TAP pGAL1-10 RecR | Section 1, see references 13 and 14 | ||
| Recombination Strain: MATa; ura3Δ0; leu2Δ0; his3Δ1; met15Δ0; bar1::kanMX4; RS_LEXA_NS-3_ARS316_NS+3_RS; Chr I 212kb::LEU2 pTEF2-LEXA-TAP pGAL1-10 RecR | Section 1, see reference 13 and 14 | ||
| Plasmid | |||
| K238 plasmid | Section 1, see reference 13 Storage: Store at -20 °C | ||
| K071 Spike-in plasmid DNA | Section 7.1, see reference 13 Storage: Store at -20 °C | ||
| Reagents | |||
| Acetone | Carl Roth | 5025.1 | Section 2 Storage: Store at room temperature |
| Ammonium acetate (NH4Ac) | Sigma Aldrich | A7262 | Section 6 and 7.1 Storage: Store at room temperature |
| Ammonium solution (NH4OH) 25% | Merck Millipore | 533003 | Section 6 Storage: Store at room temperature |
| Ammonium sulfate | Santa Cruz | Sc-29085 | Section 2 Storage: Store at room temperature |
| Bacto agar | BD (VWR) | 90000-760 | Section 3 Storage: Store at room temperature |
| Bacto peptone | BD (VWR) | 211820 | Section 3 Storage: Store at room temperature |
| β-Mercaptoethanol | Sigma Aldrich | 07604 | Section 7.2 Storage: Store at 4 °C |
| Chemiluminescent substrate kit | ThermoFisher | 34580 | Section 7.2 Storage: Store at 4 °C |
| Di-Sodium Hydrogen phosphate dodecahydrate | Merck | 1.06579.1000 | Section 2 and 7.1 Storage: Store at room temperature |
| Dithiothreitol (DTT) | ThermoFisher | 15508013 | Section 4 Storage: Store at 4 °C |
| Ethanol | Merck | 100983 | Section 7.1 Storage: Store at room temperature |
| Ethylenediaminetetraacetic acid (EDTA) | Sigma Aldrich | ED | Section 7.1 Storage: Store at room temperature |
| Galactose (20% (w/v) stock) | Sigma Aldrich | G0625-1KG / 5KG | Section 3 Storage: Store at room temperature |
| Gel loading dye (6x) | BioLabs | B7024A | Section 7.1 Storage: Store at -20 °C |
| Glusose | Sigma-Aldrich | G8270 | Section Storage: Store at room temperature |
| Glycine | Carl Roth | .0079.4 | Section 2 Storage: Store at room temperature |
| Glycogen (5 mg/mL) | Invitrogen | AM9510 | Section 7.1 Storage: Store at -20 °C |
| Hydrochloric acid (HCl) | PanReac AppliChem | 182109.1211 | Section 2, 4 and 7.1 Storage: Store at room temperature |
| Magnesium Acetate (MgAc) | Bernd Kraft | 15274.2600/C035 | Section 4 Storage: Store at room temperature |
| Magnesium chloride (MgCl2) | Sigma Aldrich | M8266 | Section 6 Storage: Store at room temperature |
| Nu PAGE LDS sample buffer (4x) | Invitrogen | 2399549 | Section 7.2 Storage: Store at room temperature |
| Phenol/Chloroform/Isoamyl alcohol (25:24:1 v/v) | Invitrogen | 15593-031 | Section 7.1 Storage: Store at 4 °C |
| Potassium chloride (KCl) | Sigma | P9541 | Section 4 Storage: Store at room temperature |
| Radioactively labeled α-32P dATP (3,000 Ci/mmol, 10 mCi/mL) | Hartmann Analytic | SRP-203 | Section 7.1 Storage: Store at 4 °C |
| RadPrime labeling system | ThermoFisher | 18428-011 | Section 7.1 Storage: Store at -20 °C |
| Raffinose (20% (w/v) stock) | SERVA | 34140.03 | Section 3 Storage: Store at room temperature |
| Sodium chloride (NaCl) | Merck | K53710504142 | Section 7.1 Storage: Store at room temperature |
| Sodium citrate (Na3C6H5O7) | Sigma-Aldrich | 71402 | Section 7.1 Storage: Store at room temperature |
| Sodium hydroxide (NaOH) | Sigma Aldrich | S5881 | Section 7.1 Storage: Store at room temperature |
| Sodium n-dodecyl sulfate (SDS) (5% stock (w/v) ) | Alfa Aesar | A11183 | Section 7.1 Storage: Store at room temperature |
| Sodium phosphate monobasic | Sigma-Aldrich | 71496 | Section 2 and 7.1 Storage: Store at room temperature |
| Sodium azide | Santa Cruz Biotechnology | sc-208393 | Section 2 Storage: Store at -20 °C |
| Triethylamine | Sigma Aldrich | 90340 | Section 2 Storage: Store at room temperature |
| Tris base | Chem Cruz | SC-3715B | Section 2 and 4 Storage: Store at room temperature |
| Triton X-100 | Sigma Aldrich | X100 | Section 2 and 4 Storage: Store at room temperature |
| Tween-20 | Bernd Kraft | 18014332 | Section 4 Storage: Store at room temperature |
| Yeast extract | BD (VWR) | 212720 | Section 3 Storage: Store at room temperature |
| Yeast mating factor alpha (1 µg/mL stock ) | Biomol | Y2016.5 | Section 3 Storage: Store at -20 °C |
| Yeast Synthetic Drop-out medium Supplements without LEUCINE | Sigma Aldrich | Y1376 | Section 1, see reference 14 |
| Enzymes | |||
| HpaI restriction enzyme (5,000 U/mL) | NEB | R0105S | Section 7.1 Storage: Store at -20 °C |
| Protease and Phosphatase Inhibitor Cocktail (100x) | ThermoFisher Scientific | 78446 | Section 4 Storage: Store at4 °C |
| Proteinase K (10 mg/mL) | SERVA | 33756 | Section 7.1 Storage: Store at -20 °C |
| RNase A (10 mg/mL) | ThermoFisher | EN0531 | Section 7.1 Storage: Store at -20 °C |
| TEV protease (10000 U/µL) | NEB | P8112S | Section 5 Storage: Store at -20 °C |
| Materials | |||
| BcMag Epoxy-Activated Magnetic Beads | Bioclone Inc. | FC-102 | Section 2 Storage: Store at 4 °C |
| Dry ice | Section 4 | ||
| Low-binding centrifuge tubes 2.0 mL | Eppendorf | 22431102 | Section 4 |
| Microspin G-25 Columns | Cytiva | 27-5325-01 | Section 7.1 Storage: Store at room temperature |
| Parafilm | Merck | P7793 | Section 4 |
| Positive nylon membrane | Biozol | 11MEMP0001 | Section 7.1 Storage: Store at room temperature |
| PVDF transfer membrane | Immobilon-Merck Millipore | IPVH00010 | Section 7.2 Storage: Store at room temperature |
| SDS-PAGE gel 4-12% bis-tris (15 well, 1.5 mm) | Invitrogen | NP0336BOX | Section 7.2 Storage: Store at 4 °C |
| Syringe (25 mL) with luer fitting | Henke Sass Wolf | 4200-000V0 | Section 3 |
| Whatman paper (Grade 3MM CHR Cellulose Western Blotting Paper Sheet) | Cytiva | 3030-917 | Section 7.1 Storage: Store at room temperature |
| Antibodies | |||
| Anti-LexA, rabbit polyclonal IgG, DNA binding region antibody | Merck Millipore | 06-719 | Section 7.2 Storage: Store at -20 °C |
| Goat Anti-Rabbit IgG (H+L), Horseradish peroxidase conjugate | Invitrogen | G21234 | Section 7.2 Storage: Store at -20 °C |
| Peroxidase Anti-Peroxidase (PAP) antibody produced in rabbit for the detection of TAP-tagged proteins | Sigma Aldrich | P1291-500UL | Section 7.2 Storage: Store at -20 °C |
| Rabbit IgG antibodies | Sigma | I5006-100MG | Section 2 Storage: Store at 4 °C |
| Primers (10 µM) | |||
| ARS316: fwd 5'- CGGCATTATCGTACACAACCT, rev 5'- GTTCTTCGTTGCCTACATTTTCT | Section 7.1 | ||
| K071 Spike-in plasmid DNA: fwd: 5'-TTTTCGCTGCTTGTCCTTTT, rev 5'- CATTTTCGTCCTCCCAACAT | Section 7.1 | ||
| PCR fragment from yeast genomic DNA as a template for ARS316 amplification (for southern blot): fwd 5’- AAATTCTGCCCTTGATTCGT rev 5’- TTTGTTTATCTCATCACTAAT | Section 7.1 | ||
| PDC1: fwd 5'- CATGATCAGATGGGGCTTCA, rev 5'-ACCGGTGGTAGCGACTCTGT | Section 7.1 | ||
| Equipment | |||
| Coffee grinder | Gastroback | 42601 | Section 4 |
| Dewar flask | NAL GENE | 4150-2000 | Section 3 |
| DynaMag TM-2 magnetic rack | Invitrogen | 12321D | Section 4, 5 and 6 |
| Hybridization oven | Hybaid Mini10 | Ri418 | Section 2 |
| Microcentrifuge | Eppendorf | 5424R | Section 4 and 7.1 |
| UV-crosslinker | Analytikjena | 95-0174-02 | Section 7.1 |
Access restricted. Please log in or start a trial to view this content.