Method Article

Wild-type Blocking PCR Combined with Sanger Sequencing for Detection of Low-frequency Somatic Mutation

2.2K views

āø±

DOI:

10.3791/65647

āø±

August 23rd, 2024

* These authors contributed equally

In This Article

Summary

This article introduces the application of a low-frequency detection method based on Sanger sequencing in angioimmunoblastic lymphoma. Provide a basis for applying this method to other diseases.

Abstract

When monitoring minimal residual disease (MRD) after tumor treatment, there are higher requirements of the lower limit of detection than when detecting for drug resistance mutations and circulating tumor cell mutations during therapy. Traditional Sanger sequencing has 5%-20% wild-type mutation detection, so its limit of detection cannot meet the corresponding requirements. The wild-type blocking technologies that have been reported to overcome this include blocker displacement amplification (BDA), non-extendable locked nucleic acid (LNA), hot-spot-specific probes (HSSP), etc. These technologies use specific oligonucleotide sequences to block wild-type or recognize wild-type and then combine this with other methods to prevent wild-type amplification and amplify mutant amplification, leading to characteristics like high sensitivity, flexibility, and convenience. This protocol uses BDA, a wild-type blocking PCR combined with Sanger sequencing, to optimize the detection of RHOA G17V low-frequency somatic mutations, and the detection sensitivity can reach 0.5%, which can provide a basis for MRD monitoring of angioimmunoblastic T-cell lymphoma.

Introduction

Minimal residual disease (MRD) is the small number of cancer cells that are still present in the body after treatment. Due to their small number, they do not lead to any physical signs or symptoms. They often go undetected by traditional methods, such as microscopic visualization and/or tracking abnormal serum proteins in the blood. An MRD positive test result indicates the presence of residual diseased cells. A negative result means that residual diseased cells are absent. Post-cancer treatment, the remaining cancer cells in the body can become active and start to multiply, causing a disease relapse. Detecting MRD is indicative that either the treatment was not completely effective or that the treatment was incomplete. Another reason for MRD-positive results after treatment might be that not all the cancer cells responded to the therapy or because the cancer cells became resistant to the medications used1.

Angioimmunoblastic T-cell lymphoma (AITL) is a subtype of peripheral T-cell lymphoma (PTCL) derived from T follicular helper cells2; it is the most common type of T-cell lymphoma, accounting for about 15%-20% of PTCL3. It is a group of related malignancies that affect the lymphatic system. The cell of origin is the follicular T helper cell. The 2016 WHO classification categorizes it as Angioimmunoblastic T-cell Lymphoma4. In 2022, WHO renamed it as Nodal T-follicular helper cell lymphoma, angioimmunoblastic-type (nTFHL-AI), together with Nodal T-follicular helper cell lymphoma, follicular-type (nTFHL-F) and Nodal T-follicular helper cell lymphoma, not otherwise specified (nTFHL-NOS), collectively referred to as nodular follicular helper T cell lymphoma (nTFHL). This was done to identify its important clinical and immunophenotypic features and similar T follicular helper (TFH) gene expression signatures and mutants. Genetically, nTFHL-AI is characterized by the progressive acquisition of somatic mutations in early hematopoietic stem cells through TET2 and DNMT3A mutations, while RHOA and IDH2 mutations are also present in TFH tumor cells5. Several studies have shown that RHOA G17V mutation occurs in 50%-80% of AITL patients6,7,8,9. The RHOA protein encoded by the RHOA gene is activated by guanosine triphosphate (GTP) binding and inactivated by guanosine diphosphate (GDP) binding. When activated, it can bind to a variety of effector proteins and regulate a variety of biological processes. Physiologically, RHOA mediates T cell migration and polarity, plays a role in thymocyte development, and mediates activation of pre-T cell receptor (pre-TCR) signaling10. The RHOA G17V mutation is a loss-of-function mutation that plays a driving role in lymphoma pathogenesis11. The detection of its low-frequency mutation is helpful for the MRD monitoring of AITL.

Sanger sequencing has been used for more than 40 years as the gold standard for the detection of known and unknown mutations. However, its detection limit is only 5%-20%, which limits its application for low-frequency mutation detection12,13. In Sanger sequencing, the detection sensitivity can be decreased to 0.1% by replacing the traditional PCR with BDA, a wild-blocking technology14. BDA technology mainly adds a mismatched primer complementary to the mutant type when designing conventional primers to compete with the wild type so as to achieve the purpose of amplifying the mutant type. The key to primer design is the mismatch primer and the terminal modification. At the same time, according to the structural principle of DNA, the difference between the Gibbs free energy of the two primers is between 0.8 kcal/mol and 5 kcal/mol. Another key step in this technique is to suppress wild-type amplification by adjusting the ratio of wild-type and blocking primers14,15.

At present, common low-frequency somatic mutation detection techniques include PCR-based allele-specific PCR (allele-specific polymerase chain reaction, ASPCR), amplification-refractory mutation system PCR (amplification-refractory mutation system-PCR, ARMS-PCR) used for genotyping SNP with the help of refractory primers. Designing primers for the mutant and normal alleles allows selective amplification and digital PCR (Droplet Digital PCR, ddPCR), a method for performing digital PCR that is based on water-oil emulsion droplet technology16. A sample is fractionated into 20,000 droplets, and for each droplet, a PCR amplification of the template molecules is done with a sensitivity of 1 x 10-5; blocker displacement amplification (BDA) is also a PCR-based rare allele enrichment method used for accurate detection and quantitation of SNVs and indels down to 0.01% VAF in a highly multiplexed environment; locked nucleic acid technology (non-extendable locked nucleic acid, LNA), is a class of high-affinity RNA analogs in which the ribose ring is locked in the ideal conformation for Watson-Crick binding; hotspot-specific probes (Hot-Spot-Specific Probe, HSSP), overlap the target primer sequence, include a single mutation, and are modified with a C3 spacer at the C3' end to prevent amplification by qPCR14,16,17,18. When a mutation in the sequence exists, the HSSP competitively attaches to the target mutation and prevents the primer from binding to the target mutant sequence which stops sequence amplification; NGS (next-generation sequencing) - based immunoglobulin high-throughput sequencing (igHTS) Cancer Personalized Profiling by Deep Sequencing (CAAP-seq), it is a next-generation sequencing-based method used to quantify circulating DNA in cancer cells (sensitivity is 1 x 10-4); etc. Among them, most methods are based on PCR and can only detect a small number of mutation sites, and the NGS-based methods can detect multiple sites, but the cost is high, and the process is complicated14,16,17,18. There have been reports on the detection of RHOA G17V low-frequency mutations based on the qPCR, but the detection limit can only reach about 2%19. There is no report on the detection of RHOA G17V low-frequency mutation based on Sanger sequencing. Here, we demonstrate the increase in sensitivity achieved by BDA, a wild-type block PCR combined with Sanger sequencing, to optimize the detection of RHOA G17V low-frequency somatic mutations, and the detection sensitivity can reach 0.5%. Additional data for IDH2 and JAK1 is also provided.

This article provides a detailed protocol of RHOA G17V low-frequency detection scheme by Sanger sequencing and provides a reference for the development of more low-frequency mutation detection based on the Sanger sequencing platform. This method can be used to detect and monitor possible drug-resistance mutations and minimal residues in tumors.

Protocol

This study was approved by the medical ethics review committee of Yongzhou Central Hospital (approval number: 2024022601). The participants provided informed consent.

1. Primer design

  1. Conventional primer design: Design primers according to the reported primer design rules20, primer design by NCBI Primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi?LINK_LOC=BlastHome). For the mutation site of RHOA G17V, all reference sequences for the design of conventional primers are the mutated base sequence. Ensure the designed reverse amplification primers contain the mutation site sequence and the annealing temperature of the primers is about 60 °C.
  2. BDA primer design
    1. Design the wild blocking primer with a length of about 20-30 base pairs (bp), containing 2-4 modified bases, and the modified bases composed of A and T. Ensure the blocking primer has 6-14 bp overlapping with the mutation amplification primer, used to compete with the mutation amplification primer.
    2. Design the primer with an annealing temperature for the final designed mutant amplification primers and wild blocking primers set at about 60 °C, and the difference in Gibbs free energy between 0.8-5 kcal/mol. For detailed calculation rules, refer to literature15.
      NOTE: When the designed primers do not meet the above conditions, bases can be added or subtracted manually for adjustment. The final designed primer list is shown in Table 1 and Table 2.

2. Sample preparation and DNA extraction

NOTE: Experimental verification samples are all sourced from human lymphoma patients' peripheral blood, bone marrow, or solid tumor samples. There were 10 positive samples: 3 were solid tumor samples, 4 were bone marrow samples, and 3 were peripheral blood samples. There are 30 negative samples from healthy people.

  1. Extraction of bone marrow and peripheral blood samples
    1. Add 400 µL of bone marrow or peripheral blood sample and reagents into the corresponding tubes according to the requirements and extract according to the manufacturer's extraction procedure.
    2. Prepare new sample tubes and 1.5 mL microcentrifuge tubes. Number the sample tubes from 1-24. Mark the 1.5 mL tube covers with the sample name and extraction date in the order of the names on the corresponding blood collection tubes. Mark 1-24 on the side of the microcentrifuge tube for one-to-one correspondence check.
    3. Add 40 µL of proteinase K solution to the sample tube and add 400 µL of whole blood sample (for volumes less than 400 µL, fill to 400 µL with PBS).
    4. Put the sample tube (1-24), pipette tip (including pipette cover), and collection tube in the corresponding positions. Extract DNA according to the manufacturer's procedure.
  2. Extraction of Formalin-Fixed Paraffin-Embedded (FFPE) samples
    1. Put the samples and reagents into the corresponding tubes according to the requirements and extract according to the manufacturer's extraction procedure.
    2. Add 1.1 mL of proteinase K storage buffer (PK solution) to the proteinase K dry powder, vortex, and mix well to obtain a proteinase K solution with a concentration of 10 mg/mL. Store at -20 °C.
    3. Take out the proteinase K solution and melt it completely at room temperature. Run the dry thermostat and set the temperature at 55 °C.
    4. Take a 1.5 mL microcentrifuge tube and write the sample name on it. Take less than 30 mg of tissue and put it into the microcentrifuge tube. Then, add 500 µL of Deparaffin Buffer and 20 µL proteinase K solution to the tube.
    5. After vortex mixing for at least 10 s, place the microcentrifuge tube in a dry thermostat and keep it warm at 55 °C for 90 min.
    6. Make sure the spin column fits in the filter tube. After the incubation is completed, transfer the sample, including liquid and tissue, to the spin column. Centrifuge at 16,500 x g for 5 min to centrifuge all the liquid into the filter tube.
    7. Take 1 sample tube (without cap) included with the kit and write the sample name on it. Transfer the liquid from the 400 µL filter tube to the sample tube.
    8. After the sample pretreatment and preparation are completed, place the corresponding consumables and reagents in the corresponding positions and perform DNA extraction according to the manufacturer's instructions.
  3. DNA quality control
    1. Measure the concentration and purity of the extracted DNA and ensure DNA concentration is ≄ 25 ng/µL. Record each sample's DNA concentration and use immediately for subsequent detection or freeze at -20 °C.
      NOTE: OD260/OD280 values are generally used to test the purity of DNA samples. The normal OD260/OD280 value is about 1.7-1.9, indicating that the DNA purity is good; if the OD260/OD280 value is ≤1.7, it indicates that there may be protein contamination; if the OD260/OD280 value is ≄2.0, it indicates that there may be RNA contamination or DNA has been degraded.

3. PCR amplification

  1. Preparation of primers
    1. Preparation of primer stock solution
      1. Take out the primer dry powder and centrifuge at 5400-8400 x g for 2-3 min. Check the nmol value of the primer and slowly open the lid. Using a pipette with the corresponding volume of Double distilled water (ddH2O), which is 10x of the nM value, slowly add it along the wall of the primer tube.
      2. Prepare primers at 0.1 nM/µL or 100 µM stock solution (e.g., the nM value is 21.1; correspondingly, the water to be added is 211 µL). Vortex mix thoroughly, then centrifuge briefly to ensure the solution reaches the bottom of each well. Write the primer name, configuration data, and configuration person on the tube cap. Put it into the corresponding stock solution storage location.
    2. Preparation of primer working solution
      1. Pipette 5 µL of forward primer, 5 µL of reverse primer, 50 µL of wildtype primer stock solution, and 40 µL of ddH2O in a clean microcentrifuge tube. Pipette repeatedly 2x-3x, vortex to mix, and spin off instantly.
      2. Write the name of the primer, the date of configuration, and the person who configured it on the tube cap and put it into the corresponding storage location of the working solution.
  2. PCR amplification procedure
    1. For each reaction, add 5 µL of PCR amplification enzyme master mix, 1 µL of primer working solution, and 1 µL of DNA template (template input amount needs to reach 400 ng, if the DNA concentration is not sufficient; increase the volume of DNA and reduce the volume of ddH2O added) and 3 µL of ddH2O. Vortex to mix and spin off instantly.
    2. Put the PCR reaction tube on the pre-set PCR instrument for PCR amplification. Set the thermal cycle program of the PCR instrument as follows and run:
      ​95 °C for 3 min; 20 cycles of 95 °C for 30 s, 68 °C for 15 s (decrease 0.5 °C per cycle), 72 °C for 1 min; 16 cycles of 95 °C for 30 s, 58 °C for 15 s, 72 °C for 1 min; and 72 °C for 10 min.
  3. Perform gel electrophoresis on the PCR product with 2% agarose to check whether the target fragment is amplified.
  4. Purification of PCR products
    1. Bring purificase I and purificase II to room temperature and spin off instantly. Prepare the PCR product purification reaction as follows: 1 µL of purificase I, 0.5 µL of purificase II, 3 µL of PCR product, and 3.5 µL of ddH2O.
    2. Put the PCR reaction tube on the pre-set PCR instrument for PCR amplification. Set the thermal cycle program of the PCR instrument as follows and run the machine:
      37 °C for 30 min, 95 °C for 15 min.

4. Sequencing of PCR products after purification

  1. Sequencing
    1. Bring the sequencing amplification enzyme master mix, buffer, and ddH2O to room temperature. After the reagent has liquified, spin off instantly.
    2. Prepare the sequencing reaction system as follows: 1.8 µL of sequencing buffer, 0.4 µL of sequencing amplification enzyme master mix, 1 µL of sequencing primer, 0.8 µL of purified PCR product, and 6 µL of ddH2O.
    3. Put the PCR reaction tube on the pre-set PCR instrument for PCR amplification. Set the thermal cycle program of the PCR instrument as follows and run: 96 °C for 3 min; 28 cycles of 96 °C for 25 s, 56 °C for 15 s, 60 °C for 4 min.
    4. After the sequencing reaction is finished, remove the product from the PCR instrument. Store reaction products in the refrigerator, protected from light.
  2. Purification of sequencing products
    1. Vortex the magnetic beads thoroughly. Add 10 µL of magnetic beads and 40 µL of 80% alcohol to the 96-well plate and seal the plate with a film.
    2. Place the 96-well plate with magnetic beads and alcohol on the vortex shaker for 10 s to fully suspend and mix the magnetic beads (observing whether there is magnetic bead precipitation at the bottom and be careful not to get the liquid on the sealing film). Put it on a horizontal oscillator and tie it with a rubber band to vibrate for 3-5 min (maximum gear).
    3. After oscillating, put the PCR plate on the magnetic stand, pay attention to pressing it tightly. Keep the stand at 4 °C for static adsorption for 3 min, and after the magnetic beads are all adsorbed on the wall, remove the sealing film and pour out the waste liquid.
    4. Add 40 µL of 80% alcohol to the PCR plate, rinse the beads, and pour off the waste liquid. Place the plate on absorbent paper and pat it gently (Do not let the PCR plate separate from the disk). Repeat 1x.
    5. Put the absorbent paper upside down together with the magnetic plate into the centrifuge at 120 x g for a quick spin.
    6. Put the PCR plate containing the magnetic beads after removing the alcohol into the oven at 60 °C for 3-5 min. Dry the beads completely.
      NOTE: If there is no oven, place the plate at room temperature for 10 min.
    7. Add 40 µL of pure water after drying. Place the sealing film on the plate and shake it on a vortex shaker for 3-5 s. Put the plate on a horizontal shaker, tie it firmly, and shake it for 3-5 min to dissolve the purified sequencing product.
    8. Spin the dissolved sequencing product at 180 x g and use the product for genomic analysis using capillary electrophoresis21 (Note that the supporting disk needs to be added to the sample board).
  3. Analysis of sequencing results
    1. Obtain the sequencing results from the software. Refer to the software manual for detailed operation procedures. Use the reference sequence from NCBI.

Results

Compare the test sample's sequence with the reference sequence to obtain the test sample's mutation status. BDA-based WBT-PCR technology can detect the known RHOA G17V mutation and other low-frequency mutations in the amplification interval of upstream and downstream primers. See Figure 1. Two additional genes, namely IDH2 and JAK1, were also analyzed using this method, Figure 2 and Figure 3, respectively. The results show that this method is quite sensitive in detecting low-frequency mutations.

DNA sequencing chromatograms; comparison of traditional PCR vs. WBT-PCR methods for RHOA mutations.
Figure 1: Sequencing result for RHOA. From top to bottom, the figure shows the base mutation of the RHOA G17 site amplified by WBT-PCR and the sequencing results after traditional PCR amplification corresponding to wild-type RHOA G17. The middle picture shows the sequencing results of the c.50G>T mutation after amplification with WBT-PCR primers when the detection sensitivity is 0.5%. The bottom picture shows the sequencing results of the c.49-50delinsTT mutation after amplification with WBT-PCR primers when the detection sensitivity is 0.5%. Please click here to view a larger version of this figure.

WBT-PCR vs. Traditional PCR chromatogram; IDH2 mutation detection; DNA sequencing results.
Figure 2: Sequencing result for IDH2. From top to bottom, the figure above shows the base mutation of the IDH2 R172 site amplified by WBT-PCR and the sequencing results after traditional PCR amplification corresponding to wild-type IDH2 R172. The top picture shows the sequencing results of the c.515G>A mutation after amplification with WBT-PCR primers when the detection sensitivity is 0.5%. Please click here to view a larger version of this figure.

DNA sequencing chromatogram showing WBT-PCR mutation c.2108G>T, JAK1 gene; comparison chart
Figure 3: Sequencing result for JAK1. From top to bottom, the figure above shows the base mutation of the JAK1 S703 site amplified by WBT-PCR and the sequencing results after traditional PCR amplification corresponding to wild-type JAK1 S703. The top picture shows the sequencing results of the c.2108G>T mutation after amplification with WBT-PCR primers when the detection sensitivity is 0.5%. Please click here to view a larger version of this figure.

PrimerPrimer sequence
RHOA-VFATAACCTTTTGGTGCCAGGT
RHOA-VRGCTGAAGACTATGAGCAAGCA
RHOA-WTBAGCAAGCATGTCTTTCCACAGGCAAAA
Sequencing primerĀ ATAACCTTTTGGTGCCAGGT

Table 1: The final designed primer list of RHOA.

IDH2 R172 primer
PrimerPrimer sequence
IDH2-VFCTGGTTGAAAGATGGCGGCT
IDH2-VRTACCTGGTCGCCATGGGC
IDH2-WTBGCCATGGGCGTGCCTGCCAAAAT
Sequencing primerCTGGTTGAAAGATGGCGGCT
JAK1 gene primer
PrimerPrimer sequence
JAK1-VFACTCTGAGGCCGAGTAGTGT
JAK1-VRCCATTATGGACATCAGGACATTC
JAK1-WTBGGACATTCTCACCAAGTAGCTCAGAAAA
Sequencing primerACTCTGAGGCCGAGTAGTGT

Table 2: The final designed primer list of IDH2 and JAK1.

Discussion

The WTB-PCR based on BDA technology, described in this article, introduces a mismatched primer complementary to the mutant type when designing conventional primers to compete with the wild type, suppress the wild type, and amplify the mutant product. Then, the WTB-PCR products were sequenced for mutation analysis. The utility of WTB-PCR/Sanger is its simplicity and high sensitivity. According to the detection scheme established in this paper, most existing Sanger-based assays can be added with suppressor primers via BDA, thereby increasing detection sensitivity. The RHOA G17V mutation introduced in this article was sequenced by Sanger sequencing after WTB-PCR based on BDA technology. When the input amount of DNA reaches 400 ng, the detection sensitivity can reach 0.5% or even 0.1%. The detection sensitivity of different genes needs to be confirmed by the amount of DNA input, gene sequence, etc.

The key to WTB-PCR is the design of primers, and this technology can only detect known mutations. This article describes an application of this technology in Sanger sequencing. This technology can also be applied to next-generation sequencing, quantitative PCR, etc., and it can also be used in multiplex PCR detection. This WTB-PCR can reduce the lower limit of these detection methods and can be better applied to MRD monitoring. Most methods based on PCR can only detect a small number of mutation sites, and NGS-based methods can detect multiple sites, but the cost is high, and the process is complicated14,15,16,17,18. WTB-PCR has the characteristics of high sensitivity, low cost, and strong flexibility, making it an ideal choice for low-frequency mutation detection, which can greatly improve the detection sensitivity of Sanger sequencing and its application in MRD detection.

Disclosures

The authors have nothing to disclose.

Acknowledgements

This research was completed with the financial support of Kindstar Global Corporation and the help of the leaders of the Molecular Biology Laboratory and related colleagues. Thanks to the company, leaders, and relevant colleagues for their support and help. This article is only used for scientific research and does not constitute any commercial activity.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
Automatic DNA extractor9001301Qiagen
DNA nucleic acid detectorQ32854Thermo fisher
PCR amplification kitP4600merck
PCR instrumentC1000 TouchBiorad
proteinase K solutionD3001-2-Azymo research
proteinase K storage bufferD3001-2-Czymo research
Sequencing amplification enzyme kitP7670-FINQiagen

References

  1. Penn Medicine. Testing for measurable/minimal residual disease (MRD). , Oncolink Team. https://www.oncolink.org/cancer-treatment/procedures-diagnostic-tests/blood-tests-tumordiagnostic-tests/testing-for-measurable-minimal-residualdisease-mrd (2019).
  2. Xie, Y., Elaine, S. J. How I diagnose angioimmunoblastic T-cell lymphoma. Am J Clin Pathol. 156, 1-14 (2021).
  3. Mariko, Y., et al. Angioimmunoblastic T-cell lymphoma. Cancer Treat Res. 176, 99-126 (2019).
  4. Daniel, A. A., et al. The 2016 revision to the World Health Organization classification of myeloid neoplasms and acute lukemia. Blood. 127 (20), 2391-2405 (2016).
  5. Rita, A., et al. The 5th edition of the World Health Organization Classification of Haematolymphoid Tumours : Lymphoid Neoplasms. Leukemia. 36 (7), 1720-1748 (2022).
  6. Hae, Y. Y., et al. A recurrent inactivating mutation in RHOA GTPase in angioimmunoblastic T cell lymphoma. Nat Genet. 46 (4), 371-375 (2014).
  7. Lee, P. H., et al. RHOA G17V mutation in angioimmunoblastic T-cell lymphoma:A potential biomarker for cytological assessment. Exp Mol Pathol. 110, 104294(2019).
  8. Mamiko, S. Y., et al. Somatic RHOA mutation in angioimmunoblastic T cell lymphoma. Nat Genet. 46 (2), 171-175 (2014).
  9. Palomero, T., et al. Recurrent mutations in epigenetic regulators, RHOA and FYN kinase in peripheral T cell lymphomas. Nat Genet. 46 (2), 166-170 (2014).
  10. Fujisawa, M., et al. Activation of RHOA-VAV1 signaling in angioimmunoblastic T-cell lymphoma. Leukemia. 32 (3), 694-702 (2018).
  11. Voena, C., et al. RHO family GTPases in the biology of lymphoma. Cells. 8 (7), 646(2019).
  12. Shendure, J., et al. DNA sequencing an 40: past, present and future. Nature. 550 (7676), 345-353 (2017).
  13. Athanasios, C. T., et al. Comparison of Sanger sequencing, pyrosequencing, and melting curve analysis for the detection of KRAS mutations: diagnostic and clinical implications. J Mol Diagn. 12 (4), 425-432 (2010).
  14. Wu, L. R., et al. Multiplexed enrichment of rare DNA variants via sequence-selective and temperature-robust amplification. Nat Biomed Eng. 1, 714-723 (2017).
  15. John, S. J., et al. The thermodynamics of DNA structural motifs. Annu Rev Biophys Biomol Struct. 33, 415-440 (2004).
  16. Coren, A. M., et al. PCR-based methods for the enrichment of minority alleles and mutations. Clin Chem. 55 (4), 632-640 (2009).
  17. Eliza, M. L., et al. Circulating tumor DNA in B-cell lymphoma: technical advances, clinical applications, and perspectives for translational research. Leukemia. 36 (9), 2151-2164 (2022).
  18. Lee, H. J., et al. Hot-spot-specific probe (HSSP) for rapid and accurate detection of KRAS mutations in colorectal cancer. Biosensors. 12 (8), 597(2022).
  19. Matsubara, R. N., et al. Detection of the G17V RHOA mutation in angioimmunoblastic T-cell lymphoma and related lymphomas using quantitative allele-specific PCR. PLoS One. 9 (10), e109714(2014).
  20. Dieffenbach, C. W., et al. General concepts for PCR primer design. PCR Methods Appl. 3 (3), S30-S37 (1993).
  21. Applied Biosystems. User Guide for Applied Biosystems. 3730/3730xl DNA Analyzer. , (2014).

Reprints and Permissions

Tags

Low-Frequency MutationSomatic Mutation DetectionMinimal Residual DiseaseBlocker Displacement AmplificationDNA ExtractionGel ElectrophoresisCapillary ElectrophoresisAngioimmunoblastic Lymphoma