This article introduces the application of a low-frequency detection method based on Sanger sequencing in angioimmunoblastic lymphoma. Provide a basis for applying this method to other diseases.
Method Article
* These authors contributed equally
This article introduces the application of a low-frequency detection method based on Sanger sequencing in angioimmunoblastic lymphoma. Provide a basis for applying this method to other diseases.
When monitoring minimal residual disease (MRD) after tumor treatment, there are higher requirements of the lower limit of detection than when detecting for drug resistance mutations and circulating tumor cell mutations during therapy. Traditional Sanger sequencing has 5%-20% wild-type mutation detection, so its limit of detection cannot meet the corresponding requirements. The wild-type blocking technologies that have been reported to overcome this include blocker displacement amplification (BDA), non-extendable locked nucleic acid (LNA), hot-spot-specific probes (HSSP), etc. These technologies use specific oligonucleotide sequences to block wild-type or recognize wild-type and then combine this with other methods to prevent wild-type amplification and amplify mutant amplification, leading to characteristics like high sensitivity, flexibility, and convenience. This protocol uses BDA, a wild-type blocking PCR combined with Sanger sequencing, to optimize the detection of RHOA G17V low-frequency somatic mutations, and the detection sensitivity can reach 0.5%, which can provide a basis for MRD monitoring of angioimmunoblastic T-cell lymphoma.
Minimal residual disease (MRD) is the small number of cancer cells that are still present in the body after treatment. Due to their small number, they do not lead to any physical signs or symptoms. They often go undetected by traditional methods, such as microscopic visualization and/or tracking abnormal serum proteins in the blood. An MRD positive test result indicates the presence of residual diseased cells. A negative result means that residual diseased cells are absent. Post-cancer treatment, the remaining cancer cells in the body can become active and start to multiply, causing a disease relapse. Detecting MRD is indicative that either the treatment was not completely effective or that the treatment was incomplete. Another reason for MRD-positive results after treatment might be that not all the cancer cells responded to the therapy or because the cancer cells became resistant to the medications used1.
Angioimmunoblastic T-cell lymphoma (AITL) is a subtype of peripheral T-cell lymphoma (PTCL) derived from T follicular helper cells2; it is the most common type of T-cell lymphoma, accounting for about 15%-20% of PTCL3. It is a group of related malignancies that affect the lymphatic system. The cell of origin is the follicular T helper cell. The 2016 WHO classification categorizes it as Angioimmunoblastic T-cell Lymphoma4. In 2022, WHO renamed it as Nodal T-follicular helper cell lymphoma, angioimmunoblastic-type (nTFHL-AI), together with Nodal T-follicular helper cell lymphoma, follicular-type (nTFHL-F) and Nodal T-follicular helper cell lymphoma, not otherwise specified (nTFHL-NOS), collectively referred to as nodular follicular helper T cell lymphoma (nTFHL). This was done to identify its important clinical and immunophenotypic features and similar T follicular helper (TFH) gene expression signatures and mutants. Genetically, nTFHL-AI is characterized by the progressive acquisition of somatic mutations in early hematopoietic stem cells through TET2 and DNMT3A mutations, while RHOA and IDH2 mutations are also present in TFH tumor cells5. Several studies have shown that RHOA G17V mutation occurs in 50%-80% of AITL patients6,7,8,9. The RHOA protein encoded by the RHOA gene is activated by guanosine triphosphate (GTP) binding and inactivated by guanosine diphosphate (GDP) binding. When activated, it can bind to a variety of effector proteins and regulate a variety of biological processes. Physiologically, RHOA mediates T cell migration and polarity, plays a role in thymocyte development, and mediates activation of pre-T cell receptor (pre-TCR) signaling10. The RHOA G17V mutation is a loss-of-function mutation that plays a driving role in lymphoma pathogenesis11. The detection of its low-frequency mutation is helpful for the MRD monitoring of AITL.
Sanger sequencing has been used for more than 40 years as the gold standard for the detection of known and unknown mutations. However, its detection limit is only 5%-20%, which limits its application for low-frequency mutation detection12,13. In Sanger sequencing, the detection sensitivity can be decreased to 0.1% by replacing the traditional PCR with BDA, a wild-blocking technology14. BDA technology mainly adds a mismatched primer complementary to the mutant type when designing conventional primers to compete with the wild type so as to achieve the purpose of amplifying the mutant type. The key to primer design is the mismatch primer and the terminal modification. At the same time, according to the structural principle of DNA, the difference between the Gibbs free energy of the two primers is between 0.8 kcal/mol and 5 kcal/mol. Another key step in this technique is to suppress wild-type amplification by adjusting the ratio of wild-type and blocking primers14,15.
At present, common low-frequency somatic mutation detection techniques include PCR-based allele-specific PCR (allele-specific polymerase chain reaction, ASPCR), amplification-refractory mutation system PCR (amplification-refractory mutation system-PCR, ARMS-PCR) used for genotyping SNP with the help of refractory primers. Designing primers for the mutant and normal alleles allows selective amplification and digital PCR (Droplet Digital PCR, ddPCR), a method for performing digital PCR that is based on water-oil emulsion droplet technology16. A sample is fractionated into 20,000 droplets, and for each droplet, a PCR amplification of the template molecules is done with a sensitivity of 1 x 10-5; blocker displacement amplification (BDA) is also a PCR-based rare allele enrichment method used for accurate detection and quantitation of SNVs and indels down to 0.01% VAF in a highly multiplexed environment; locked nucleic acid technology (non-extendable locked nucleic acid, LNA), is a class of high-affinity RNA analogs in which the ribose ring is locked in the ideal conformation for Watson-Crick binding; hotspot-specific probes (Hot-Spot-Specific Probe, HSSP), overlap the target primer sequence, include a single mutation, and are modified with a C3 spacer at the C3' end to prevent amplification by qPCR14,16,17,18. When a mutation in the sequence exists, the HSSP competitively attaches to the target mutation and prevents the primer from binding to the target mutant sequence which stops sequence amplification; NGS (next-generation sequencing) - based immunoglobulin high-throughput sequencing (igHTS) Cancer Personalized Profiling by Deep Sequencing (CAAP-seq), it is a next-generation sequencing-based method used to quantify circulating DNA in cancer cells (sensitivity is 1 x 10-4); etc. Among them, most methods are based on PCR and can only detect a small number of mutation sites, and the NGS-based methods can detect multiple sites, but the cost is high, and the process is complicated14,16,17,18. There have been reports on the detection of RHOA G17V low-frequency mutations based on the qPCR, but the detection limit can only reach about 2%19. There is no report on the detection of RHOA G17V low-frequency mutation based on Sanger sequencing. Here, we demonstrate the increase in sensitivity achieved by BDA, a wild-type block PCR combined with Sanger sequencing, to optimize the detection of RHOA G17V low-frequency somatic mutations, and the detection sensitivity can reach 0.5%. Additional data for IDH2 and JAK1 is also provided.
This article provides a detailed protocol of RHOA G17V low-frequency detection scheme by Sanger sequencing and provides a reference for the development of more low-frequency mutation detection based on the Sanger sequencing platform. This method can be used to detect and monitor possible drug-resistance mutations and minimal residues in tumors.
This study was approved by the medical ethics review committee of Yongzhou Central Hospital (approval number: 2024022601). The participants provided informed consent.
1. Primer design
2. Sample preparation and DNA extraction
NOTE: Experimental verification samples are all sourced from human lymphoma patients' peripheral blood, bone marrow, or solid tumor samples. There were 10 positive samples: 3 were solid tumor samples, 4 were bone marrow samples, and 3 were peripheral blood samples. There are 30 negative samples from healthy people.
3. PCR amplification
4. Sequencing of PCR products after purification
Compare the test sample's sequence with the reference sequence to obtain the test sample's mutation status. BDA-based WBT-PCR technology can detect the known RHOA G17V mutation and other low-frequency mutations in the amplification interval of upstream and downstream primers. See Figure 1. Two additional genes, namely IDH2 and JAK1, were also analyzed using this method, Figure 2 and Figure 3, respectively. The results show that this method is quite sensitive in detecting low-frequency mutations.

Figure 1: Sequencing result for RHOA. From top to bottom, the figure shows the base mutation of the RHOA G17 site amplified by WBT-PCR and the sequencing results after traditional PCR amplification corresponding to wild-type RHOA G17. The middle picture shows the sequencing results of the c.50G>T mutation after amplification with WBT-PCR primers when the detection sensitivity is 0.5%. The bottom picture shows the sequencing results of the c.49-50delinsTT mutation after amplification with WBT-PCR primers when the detection sensitivity is 0.5%. Please click here to view a larger version of this figure.

Figure 2: Sequencing result for IDH2. From top to bottom, the figure above shows the base mutation of the IDH2 R172 site amplified by WBT-PCR and the sequencing results after traditional PCR amplification corresponding to wild-type IDH2 R172. The top picture shows the sequencing results of the c.515G>A mutation after amplification with WBT-PCR primers when the detection sensitivity is 0.5%. Please click here to view a larger version of this figure.

Figure 3: Sequencing result for JAK1. From top to bottom, the figure above shows the base mutation of the JAK1 S703 site amplified by WBT-PCR and the sequencing results after traditional PCR amplification corresponding to wild-type JAK1 S703. The top picture shows the sequencing results of the c.2108G>T mutation after amplification with WBT-PCR primers when the detection sensitivity is 0.5%. Please click here to view a larger version of this figure.
| Primer | Primer sequence | |
| RHOA-VF | ATAACCTTTTGGTGCCAGGT | |
| RHOA-VR | GCTGAAGACTATGAGCAAGCA | |
| RHOA-WTB | AGCAAGCATGTCTTTCCACAGGCAAAA | |
| Sequencing primerĀ | ATAACCTTTTGGTGCCAGGT | |
Table 1: The final designed primer list of RHOA.
| IDH2 R172 primer | |
| Primer | Primer sequence |
| IDH2-VF | CTGGTTGAAAGATGGCGGCT |
| IDH2-VR | TACCTGGTCGCCATGGGC |
| IDH2-WTB | GCCATGGGCGTGCCTGCCAAAAT |
| Sequencing primer | CTGGTTGAAAGATGGCGGCT |
| JAK1 gene primer | |
| Primer | Primer sequence |
| JAK1-VF | ACTCTGAGGCCGAGTAGTGT |
| JAK1-VR | CCATTATGGACATCAGGACATTC |
| JAK1-WTB | GGACATTCTCACCAAGTAGCTCAGAAAA |
| Sequencing primer | ACTCTGAGGCCGAGTAGTGT |
Table 2: The final designed primer list of IDH2 and JAK1.
The WTB-PCR based on BDA technology, described in this article, introduces a mismatched primer complementary to the mutant type when designing conventional primers to compete with the wild type, suppress the wild type, and amplify the mutant product. Then, the WTB-PCR products were sequenced for mutation analysis. The utility of WTB-PCR/Sanger is its simplicity and high sensitivity. According to the detection scheme established in this paper, most existing Sanger-based assays can be added with suppressor primers via BDA, thereby increasing detection sensitivity. The RHOA G17V mutation introduced in this article was sequenced by Sanger sequencing after WTB-PCR based on BDA technology. When the input amount of DNA reaches 400 ng, the detection sensitivity can reach 0.5% or even 0.1%. The detection sensitivity of different genes needs to be confirmed by the amount of DNA input, gene sequence, etc.
The key to WTB-PCR is the design of primers, and this technology can only detect known mutations. This article describes an application of this technology in Sanger sequencing. This technology can also be applied to next-generation sequencing, quantitative PCR, etc., and it can also be used in multiplex PCR detection. This WTB-PCR can reduce the lower limit of these detection methods and can be better applied to MRD monitoring. Most methods based on PCR can only detect a small number of mutation sites, and NGS-based methods can detect multiple sites, but the cost is high, and the process is complicated14,15,16,17,18. WTB-PCR has the characteristics of high sensitivity, low cost, and strong flexibility, making it an ideal choice for low-frequency mutation detection, which can greatly improve the detection sensitivity of Sanger sequencing and its application in MRD detection.
The authors have nothing to disclose.
This research was completed with the financial support of Kindstar Global Corporation and the help of the leaders of the Molecular Biology Laboratory and related colleagues. Thanks to the company, leaders, and relevant colleagues for their support and help. This article is only used for scientific research and does not constitute any commercial activity.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| Automatic DNA extractor | 9001301 | Qiagen | |
| DNA nucleic acid detector | Q32854 | Thermo fisher | |
| PCR amplification kit | P4600 | merck | |
| PCR instrument | C1000 Touch | Biorad | |
| proteinase K solution | D3001-2-A | zymo research | |
| proteinase K storage buffer | D3001-2-C | zymo research | |
| Sequencing amplification enzyme kit | P7670-FIN | Qiagen |