This protocol paper describes the methodology of embryonic chicken lens microinjection of an RCAS(A) retrovirus as a tool for studying in situ function and expression of proteins during lens development.
A subscription to JoVE is required to view this content. Sign in or start your free trial.
Method Article
This protocol paper describes the methodology of embryonic chicken lens microinjection of an RCAS(A) retrovirus as a tool for studying in situ function and expression of proteins during lens development.
Embryonic chicken (Gallus domesticus) is a well-established animal model for the study of lens development and physiology, given its high degree of similarity with the human lens. RCAS(A) is a replication-competent chicken retrovirus that infects dividing cells, which serves as a powerful tool to study the in situ expression and function of wild-type and mutant proteins during lens development by microinjection into the empty lumen of lens vesicle at early developmental stages, restricting its action to surrounding proliferating lens cells. Compared to other approaches, such as transgenic models and ex vivo cultures, the use of an RCAS(A) replication-competent avian retrovirus provides a highly effective, rapid, and customizable system to express exogenous proteins in chick embryos. Specifically, targeted gene transfer can be confined to proliferative lens fiber cells without the need for tissue-specific promoters. In this article, we will briefly overview the steps needed for recombinant retrovirus RCAS(A) preparation, provide a detailed, comprehensive overview of the microinjection procedure, and provide sample results of the technique.
The goal of this protocol is to describe the methodology of embryonic chicken lens microinjection of an RCAS(A) (replication-competent avian sarcoma/leukosis retrovirus A). Effective retroviral delivery in an embryonic chicken lens has been demonstrated to be a promising tool for the in vivo study of the molecular mechanism and structure-function of lens proteins in normal lens physiology, pathological conditions, and development. Moreover, this experimental model could be used for the identification of therapeutic targets and drug screening for conditions such as human congenital cataracts. In all, this protocol aims to lay out the necessary steps for the development of a customizable platform for the study of lens proteins.
Embryonic chicks (Gallus domesticus), owing to their similarity in lens structure and function with the human lens, are a well-established animal model for the study of lens development and physiology1,2,3,4. The use of an RCAS(A) replication-competent avian retrovirus has been regarded as a highly effective, rapid, and customizable system to express exogenous proteins in chick embryos. Notably, it has a unique ability to confine the target gene transfer to proliferative lens fiber cells without the need for tissue-specific promoters, using the unique embryonic development time frame in which the presence of empty lens lumen permits in situ RCAS(A) microinjection into the restricted site for the expression of exogenous proteins within proliferative lens fiber cells5,6,7,8.
The chick embryo microinjection procedure, described in-depth here, is based originally partially on the work of Fekete et. al.6 and further developed by Jiang et. al.8 and has been utilized as a means of introducing both viral and nonviral plasmids into the lens of embryonic chicks1,9,10,11,12,13. Overall, the previous work demonstrates the potential of utilizing this methodology to study lens development, differentiation, cellular communication, and disease progression, and for the discovery and testing of therapeutic targets for lens pathological conditions such as cataracts.
Access restricted. Please log in or start a trial to view this content.
This study was conducted in compliance with the Animal Welfare Act and the Implementing Animal Welfare Regulations in accordance with the principles of the Guide for the Care and Use of Laboratory Animals. All animal procedures were approved by the Institutional Animal Care and Use Committee at the University of Texas Health Science Center at San Antonio. For an overview of the protocol, see Figure 1; see the Table of Materials for details on all materials, reagents, and instruments used in this protocol.

Figure 1: Experimental outline. 1. The first step of the protocol is the determination of a specific target protein(s), the identification of the associated gene sequence(s), and DNA fragment generation. 2. Cloning of the gene sequence(s) into a retroviral vector by initial cloning into an adaptor vector, 3. followed by a viral vector. 4. Preparation of high-titer viral particles using packaging cells to harvest and concentrate. 5. The final step, and the focus of this protocol, is the chicken lens microinjection of the RCAS(A) viral particles into the lens lumen. Please click here to view a larger version of this figure.
1. Preparation of high-titer recombinant retroviruses

Figure 2: Instruments and setup for chick lens microinjection. (A) P-30 manual vertical microelectrode micropipette puller. (1) inset showing a glass micropipette being pulled. (B) (2) Egg Incubator. Incubate chicken egg for ~65-68 h in a 37 °C incubator to reach stage 18 (with a sealed, empty central lumen) for injection of retrovirus. (C) Microinjection setup. (3) lighting equipment, (4) Pico-Injector, (5) dissecting microscope, (6) Drummond micromanipulator, (7) computer/camera for visualization. Please click here to view a larger version of this figure.
2. Chick lens microinjection

Figure 3: Microinjection chick prep and schematic. (A) Opening of a chicken egg. (B) Cutting of the amniotic membrane. (C) Chicken lens lumen microinjection schematic. Please click here to view a larger version of this figure.
Access restricted. Please log in or start a trial to view this content.
After the determination of a specific target protein(s) and the identification of the associated gene sequence(s), the overall experimental approach involves the cloning of the gene sequence(s) into a retroviral RCAS(A) vector by the initial cloning into an adaptor vector, followed by a viral vector. Second, high-titer viral particles are prepared using packaging cells to harvest and concentrate the virions. These first two major steps have been largely described and representative results presented elsewhere
Access restricted. Please log in or start a trial to view this content.
This experimental model offers the opportunity to express the protein(s) of interest in the intact lens leading to the study of the functional relevance of these proteins in lens structure and function. The embryonic chick microinjection model is based partially on the work of Fekete et. al.6 and was further developed by Jiang et. al.8 and has been utilized as a means of inserting both viral plasmids and agents such as agonists, small interfering RNA (siRNA), and peptides i...
Access restricted. Please log in or start a trial to view this content.
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
This work was supported by the National Institutes of Health (NIH) Grants: RO1 EY012085 (to J.X.J) and F32DK134051 (to F.M.A), and Welch Foundation grant: AQ-1507 (to J.X.J.). The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health. The figures were partially created with Biorender.com.
Access restricted. Please log in or start a trial to view this content.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| 0.22 µm Filter | Corning | 431118 | For removing cellular debris from media |
| 35 mm x 10 mm Culture Dish | FisherScientific | 50-202-030 | For using during microinjection |
| Centrifuge | Fisherbrand | 13-100-676 | Spinning down solution |
| Constructs | GENEWIZ | - | For generation of constructs |
| Dissecting microscope | AmScope | SM-4TZ-144A | Visualization of lens for microinjection |
| DNA PCR primers | Integrated DNA Technologies | - | Generation of primers: Intracellular loop (IL)-deleted Cx50 (residues 1–97 and 149–400) as well as the Cla12NCO vector were obtained with the following pair of primers: sense, CTCCTGAGAACCTACATCCT; antisense, CACCGCATGCCCAAAGTACAC ILs of Cx43 (residues 98–150) and Cx46 (residues 98–166) were obtained with the following pairs of primers: sense, TACGTGATGAGGAAAGAAGAG; antisense, TCCTCCACGCATCTTTACCTTG; sense, CACATTGTACGCATGGAAGAG; antisense, AGCACCTCCC AT ACGGATTC, respectively Cla12NCO-Cx43 construct template was obtained with the following pair of primers: sense, CTGCTTCGTACTTACATCATC; antisense, GAACAC GTGCGCCAGGTAC ILs of Cx50 (residues 98–148) or Cx46 (residues 98–166) were cloned by using Cla12NCO-Cx50 and Cla12NCO-Cx46 constructs as the templates with the following pair of primers: sense, CACCATGTCCGCATGGAGGAGA; antisense, GGTCCCC TC CAGGCGAAAC; sense, CACATTGTACGCATGGAAGAG; antisense, AGCACCTCCCATACGGATTC, respectively |
| Drummond Nanoject II Automatic Nanoliter Injector | Drummond Scientific | 3-000-204 | Microinjection Pipet |
| Dual Gooseneck Lights Microscope Illuminator | AmScope | LED-50WY | Lighting for visualization |
| Dulbecco’s Modified Eagle Medium (DMEM) | Invitrogen | For cell culture | |
| Egg Holder | - | - | Homemade styrofoam rings with 2-inch diameter and one-half inch height |
| Egg Incubator | GQF Manufacturing Company Inc. | 1502 | For incubation of fertilized eggs |
| Fast Green | Fisher scientific | F99-10 | For visualization of viral stock injection |
| Fertilized white leghorn chicken eggs | Texas A&M University | N/A | Animal model of choice for microinjection (https://posc.tamu.edu/fertile-egg-orders/) |
| Fetal Bovine Serum (FBS) | Hyclone Laboratories | For cell culture | |
| Fluorescein-conjugated anti-mouse IgG | Jackson ImmunoResearch | 115-095-003 | For anti-FLAG 1:500 |
| Forceps | FisherScientific | 22-327379 | For moving things around and isolation |
| Glass capillaries | Sutter Instruments | B100-75-10 | Glass micropipette for microinjection (O.D. 1.0 mm, I.D. 0.75 mm, 10 cm length) |
| Lipofectamine | Invitrogen | L3000001 | For transfection |
| Manual vertical micropipette puller | Sutter Instruments | P-30 | To obtain glass micropipette of the correct size |
| Microcentrifuge Tubes | FisherScientific | 02-682-004 | Dissolving solution |
| Microscope | Keyence | BZ-X710 | For imaging staining |
| Parafilm | FisherScientific | 03-448-254 | Placing solution |
| Penicillin/Streptomycin | Invitrogen | For cell culture | |
| Pico-Injector | Harvard Apparatus | PLI-100 | For delivering small liquid volumes precisely through micropipettes by applying a regulated pressure for a digitally set period of time |
| rabbit anti-chick AQP0 | Self generated | - | Jiang JX, White TW, Goodenough DA, Paul DL. Molecular cloning and functional characterization of chick lens fiber connexin 45.6. Mol Biol Cell. 1994 Mar;5(3):363-73. doi: 10.1091/mbc.5.3.363. |
| rabbit anti-FLAG antibody | Rockland Immunichemicals | 600-401-383 | For staining FLAG |
| Rhodamine-conjugated anti-rabbit IgG | Jackson ImmunoResearch | 111-295-003 | For anti-AQP0 1:500 |
| Sponge clamping pad | Sutter Instruments | BX10 | For storage of glass micropipette |
Access restricted. Please log in or start a trial to view this content.