Method Article

Microinjection of Recombinant RCAS(A) Retrovirus into Embryonic Chicken Lens

2.2K views

DOI:

10.3791/65727

September 1st, 2023

In This Article

Summary

This protocol paper describes the methodology of embryonic chicken lens microinjection of an RCAS(A) retrovirus as a tool for studying in situ function and expression of proteins during lens development.

Abstract

Embryonic chicken (Gallus domesticus) is a well-established animal model for the study of lens development and physiology, given its high degree of similarity with the human lens. RCAS(A) is a replication-competent chicken retrovirus that infects dividing cells, which serves as a powerful tool to study the in situ expression and function of wild-type and mutant proteins during lens development by microinjection into the empty lumen of lens vesicle at early developmental stages, restricting its action to surrounding proliferating lens cells. Compared to other approaches, such as transgenic models and ex vivo cultures, the use of an RCAS(A) replication-competent avian retrovirus provides a highly effective, rapid, and customizable system to express exogenous proteins in chick embryos. Specifically, targeted gene transfer can be confined to proliferative lens fiber cells without the need for tissue-specific promoters. In this article, we will briefly overview the steps needed for recombinant retrovirus RCAS(A) preparation, provide a detailed, comprehensive overview of the microinjection procedure, and provide sample results of the technique.

Introduction

The goal of this protocol is to describe the methodology of embryonic chicken lens microinjection of an RCAS(A) (replication-competent avian sarcoma/leukosis retrovirus A). Effective retroviral delivery in an embryonic chicken lens has been demonstrated to be a promising tool for the in vivo study of the molecular mechanism and structure-function of lens proteins in normal lens physiology, pathological conditions, and development. Moreover, this experimental model could be used for the identification of therapeutic targets and drug screening for conditions such as human congenital cataracts. In all, this protocol aims to lay out the necessary steps for the de....

Access restricted. Please log in or start a trial to view this content.

Protocol

This study was conducted in compliance with the Animal Welfare Act and the Implementing Animal Welfare Regulations in accordance with the principles of the Guide for the Care and Use of Laboratory Animals. All animal procedures were approved by the Institutional Animal Care and Use Committee at the University of Texas Health Science Center at San Antonio. For an overview of the protocol, see Figure 1; see the Table of Materials for details on all materials, reagents, and instruments used in this protocol.

Access restricted. Please log in or start a trial to view this content.

Results

After the determination of a specific target protein(s) and the identification of the associated gene sequence(s), the overall experimental approach involves the cloning of the gene sequence(s) into a retroviral RCAS(A) vector by the initial cloning into an adaptor vector, followed by a viral vector. Second, high-titer viral particles are prepared using packaging cells to harvest and concentrate the virions. These first two major steps have been largely described and representative results presented elsewhere

Access restricted. Please log in or start a trial to view this content.

Discussion

This experimental model offers the opportunity to express the protein(s) of interest in the intact lens leading to the study of the functional relevance of these proteins in lens structure and function. The embryonic chick microinjection model is based partially on the work of Fekete et. al.6 and was further developed by Jiang et. al.8 and has been utilized as a means of inserting both viral plasmids and agents such as agonists, small interfering RNA (siRNA), and peptides i.......

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Acknowledgements

This work was supported by the National Institutes of Health (NIH) Grants: RO1 EY012085 (to J.X.J) and F32DK134051 (to F.M.A), and Welch Foundation grant: AQ-1507 (to J.X.J.). The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health. The figures were partially created with Biorender.com.

....

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
0.22 µm FilterCorning431118For removing cellular debris from media
35 mm x 10 mm Culture DishFisherScientific50-202-030For using during microinjection
CentrifugeFisherbrand13-100-676Spinning down solution
ConstructsGENEWIZ-For generation of constructs
Dissecting microscopeAmScopeSM-4TZ-144AVisualization of lens for microinjection
DNA PCR primersIntegrated DNA Technologies-Generation of primers:

Intracellular loop (IL)-deleted Cx50 (residues 1–97 and 149–400) as well as the Cla12NCO vector were obtained with the following pair of primers: sense, CTCCTGAGAACCTACATCCT; antisense, CACCGCATGCCCAAAGTACAC

ILs of Cx43 (residues 98–150) and Cx46 (residues 98–166) were  obtained with the following pairs of primers: sense, TACGTGATGAGGAAAGAAGAG; antisense, TCCTCCACGCATCTTTACCTTG; sense, CACATTGTACGCATGGAAGAG; antisense, AGCACCTCCC AT ACGGATTC, respectively

Cla12NCO-Cx43 construct template was obtained with the following pair of primers: sense, CTGCTTCGTACTTACATCATC; antisense, GAACAC GTGCGCCAGGTAC

ILs of Cx50 (residues 98–148) or Cx46 (residues 98–166) were cloned by using Cla12NCO-Cx50 and Cla12NCO-Cx46 constructs as the templates with the following pair of primers: sense, CACCATGTCCGCATGGAGGAGA; antisense, GGTCCCC TC CAGGCGAAAC; sense, CACATTGTACGCATGGAAGAG; antisense, AGCACCTCCCATACGGATTC, respectively
Drummond Nanoject II Automatic Nanoliter InjectorDrummond Scientific3-000-204Microinjection Pipet
Dual Gooseneck Lights Microscope IlluminatorAmScopeLED-50WYLighting for visualization
Dulbecco’s Modified Eagle Medium (DMEM)InvitrogenFor cell culture
Egg Holder--Homemade styrofoam rings with 2-inch diameter and one-half inch height
Egg IncubatorGQF Manufacturing Company Inc.1502For incubation of fertilized eggs
Fast GreenFisher scientificF99-10For visualization of viral stock injection
Fertilized white leghorn chicken eggsTexas A&M UniversityN/AAnimal model of choice for microinjection (https://posc.tamu.edu/fertile-egg-orders/)
Fetal Bovine Serum (FBS)Hyclone LaboratoriesFor cell culture
Fluorescein-conjugated anti-mouse IgGJackson ImmunoResearch115-095-003For anti-FLAG  1:500
ForcepsFisherScientific22-327379For moving things around and isolation
Glass capillariesSutter InstrumentsB100-75-10Glass micropipette for microinjection (O.D. 1.0 mm, I.D. 0.75 mm, 10 cm length)
LipofectamineInvitrogenL3000001For transfection
Manual vertical micropipette pullerSutter InstrumentsP-30To obtain glass micropipette of the correct size
Microcentrifuge TubesFisherScientific02-682-004Dissolving solution
MicroscopeKeyenceBZ-X710For imaging staining
ParafilmFisherScientific03-448-254Placing solution
Penicillin/StreptomycinInvitrogenFor cell culture
Pico-InjectorHarvard ApparatusPLI-100For delivering small liquid volumes precisely through micropipettes by applying a regulated pressure for a digitally set period of time
rabbit anti-chick AQP0Self generated-Jiang JX, White TW, Goodenough DA, Paul DL. Molecular cloning and functional characterization of chick lens fiber connexin 45.6. Mol Biol Cell. 1994 Mar;5(3):363-73. doi: 10.1091/mbc.5.3.363.
rabbit anti-FLAG antibodyRockland Immunichemicals600-401-383For staining FLAG
Rhodamine-conjugated anti-rabbit IgG Jackson ImmunoResearch111-295-003For anti-AQP0  1:500
Sponge clamping padSutter InstrumentsBX10For storage of glass micropipette

References

  1. Li, Z., Gu, S., Quan, Y., Varadaraj, K., Jiang, J. X. Development of a potent embryonic chick lens model for studying congenital cataracts in vivo. Communications Biology. 4 (1), 325(2021).
  2. Chen, Y., et al.

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Tags

RCAS RetrovirusChicken Lens MicroinjectionEmbryonic Chicken ModelLens DevelopmentGene TransferExogenous Protein ExpressionLens Fiber CellsImmunofluorescence LabelingConnexin InteractionMicropipette Injection

Related Articles