A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

DNAzyme 10-23 - Based Nanomachines for Nucleic Acid Recognition

2.1K views

⸱

DOI:

10.3791/66461

⸱

February 9th, 2024

 ,  ,  ,  , 

Corresponding Authors: Maria S. Rubel <msrubel@itmo.ru>

In This Article

Summary

The DNAzyme-based nanomachines can be used for highly selective and sensitive detection of nucleic acids. This article describes a detailed protocol for the design of DNAzyme-based nanomachines with a 10-23 core using free software and their application in the detection of an Epstein-Barr virus fragment as an example.

Abstract

DNAzyme-based nanomachines (DNM) for the detection of DNA and RNA sequences (analytes) are multifunctional structures made of oligonucleotides. Their functions include tight analyte binding, highly selective analyte recognition, fluorescent signal amplification by multiple catalytic cleavages of a fluorogenic reporter substrate, and fluorogenic substrate attraction for an increase in sensor response. Functional units are attached to a common DNA scaffold for their cooperative action. The RNA-cleaving 10-23 DNMs feature improved sensitivity in comparison with non-catalytic hybridization probes. The stability of the DNM and the increased chances of substrate recognition are provided by a double-stranded DNA fragment, a tile. DNM can differentiate two analytes with a single nucleotide difference in a folded RNA and a double-stranded DNA and detect analytes at concentrations ~1000 times lower than other protein-free hybridization probes. This article presents the concept behind the diagnostic potential of DNA-nanomachine activity and overviews DNM design, assembly, and application in nucleic acid detection assays.

Introduction

One of the earliest methods for nucleic acid detection is complementary binding of selective oligonucleotides to the analyzed RNA or DNA sequences. This method employs nucleic acid fragments (probes) that can form Watson-Crick base pairs with a targeted DNA or RNA analyte1. The complex is then differentiated from the analyte and the unbound probe by a variety of techniques. Certain methods, such as Northern blotting, in situ hybridization, or qPCR, are based on the phenomenon of complementary binding2. The most common hybridization probes have two significant drawbacks: low sensitivity (they ....

Access restricted. Please log in or start a trial to view this content.

Protocol

1. DNM design

  1. Select a unique region within the genome of interest.
    NOTE: This work uses a region of the Epstein-Barr virus (EBV) genome in positions 13972-14154 (OR652423.1).
  2. Create a primer set for the amplification of the selected fragment, for example, via Primer3 tool embedded in Ugene26.
  3. Open the UNAFold web tool27 (see Table of Materials) and insert the selected region. Change the folding temperature to 55 °C, and ionic conditions to 250 mM of monovalent ions, and 200 mM of Mg2+.
    1. Open the resulting se....

Access restricted. Please log in or start a trial to view this content.

Results

The aim of the first experiment was to show the assembly of the DNM before the synthetic fragment of the analyte. All the constituent DNM strands were added to the reaction buffer and assembled in the beaker. The assembled DNM complex was assessed for its correct size and homogeneity by native PAGE. Native PAGE shows the assembled DNM with the analyte in lane 1 and two DNM strands in lanes 2 and 4. If the DNA nanomachine were not assembled, 2 or 3 separate bands would be visible instead of a single low-mobility band (lan.......

Access restricted. Please log in or start a trial to view this content.

Discussion

The design of DNA machines is straightforward but requires some experience in designing hybridization probes or functional DNA nanostructures. It is appropriate to keep the analyte fragment as short as possible to diminish the number of possible secondary structures and simplify DNM invasion to the secondary structure. The CG content should preferably be below 60% to avoid stable intramolecular structures. Successful assembly of the DNM is achieved at slow cooling rates. In some cases, DNMs can be spontaneously asse.......

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors declare no conflict of interest.

Acknowledgements

The authors would like to thank Ekaterina V. Nikitina for kindly providing gDNA of EBV. Muhannad Ateiah, Maria Y. Berezovskaya, and Maria S. Rubel thank the Ministry of Education and Science of the Russian Federation (Grant No FSER-2022-0009) and the Priority 2030 program.

....

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
1.5 mL tubeBiofilCFT011015
100 bp+ DNA LadderEvrogenNL002
100-1000 µL pipetteKirgenKG-Pro1000
10-100 µL pipetteKirgenKG-Pro100
1-10 µL pipetteKirgenKG-Pro10
20-200 µL pipetteKirgenKG-Pro200
2-20 µL pipetteKirgenKG-Pro20
4x Gel Loading DyeEvrogenPB020
Acrylamide 4KAppliChemA1090,0500
Ammonium persulfateCarl Roth2809447
BiorenderBiorenderhttps://www.biorender.com
BisacrylamideMolekula22797959
Boric AcidTechSnabH-0202
ChemiDoc imaging systemBioRad12003153
Costar 96-Well Black Polystyrene PlateCorningCOS3915
DinaMeltRNA Institutehttp://www.unafold.org/Dinamelt/applications/two-state-melting-hybridization.php
EDTAAmrescoAm-O105
Ethidium bromideBioLabMixEtBr-10
HEPESAmrescoAm-O485
Magnesium chlorideAppliChem131396
Mini Protean Tetra CellBioRad1658001EDU
pipette 10 µL tipsKirgenKG1111-L
pipette 1000 µL tipsKirgenKG1636
pipette 200 µL tipsKirgenKG1212-L
Pixelmator ProPixelmator Teamhttps://www.pixelmator.com/pro/
Potassium chlorideCarl Roth1782751
PowerPac Basic Power SupplyBioRad1645050
RNAse/DNAse free waterInvitrogen10977049
Sealing film for PCR platesSovtechP-502
Sodium chlorideVektonHCh (0,1)
Spark multimode microplate readerTecanSpark- 10M
T100 amplificatorBioRad10014822
TEMEDMolekula68604730
Tris(hydroxymethyl)aminomethaneAmrescoAm-O497
UNAFoldRNA Institutehttp://www.unafold.org/mfold/applications/dna-folding-form.php
Water bathLOIPLB-140
Oligos used
Analyte:Evrogendirect order, standard desalting purification
GAGCACTTGGTCAGGCACACGG
ACAGGGTCAGCGGAGGACGCG
TGGCACAGCAGCCCGGGGTAG
GTCCCCTGGACCTGCCGCTGG
CGGACTACGCCTTCGTTGC
Tile-Arm3:Evrogendirect order, standard desalting purification
CCG GGCTGCTGTGCCATTTT
TTGCTGACTACTGTCACCTCT
CTGCTAGTCT
Dzb-Tile: AGACTAGCAGAGAGGTGACAG
TAGTCAGCTTTTTTCGCGTCCTC
CGCTGACCACAACGAGAGGAA
ACCTT
Evrogendirect order, standard desalting purification
Dza: TGCCCAGGGAGGCTAGCTCT
GTCCGTGTGCCTGACCA
Evrogendirect order, standard desalting purification
F-sub oligonucleotide: AAGGTT(FAM)TCCTCrGrU
CCCTGGGCA-BHQ1
DNA-Syntezdirect order, HPLC purification

References

  1. Kolpashchikov, D. M. Evolution of hybridization probes to DNA machines and robots. Acc. Chem Res. 52, 1949-1956 (2019).
  2. Guo, J., Ju, J., Turro, N. J. Fluorescent hybridization probes for nucleic acid detection. Anal. Bioanal Chem. 402, 3115-3125 (2012).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

DNAzyme NanomachinesRNA Cleaving DNAzymeHybridization ProbesSingle Nucleotide PolymorphismFluorescent Signal AmplificationDouble Stranded DNADNA ScaffoldNative PAGEDNA Nanotechnology