The chromosomal insertion procedure takes only 2 h total across 3 days to see a result-colonies growing on a selective agar plate (Figure 1A-C). The expected number of colonies on the transformation plate is strain dependent: one may see 20-30 or even hundreds of colonies as insertion of Tn7 at attTn7 sites is specific and efficient9. Patching transformation plate colonies onto selective media (Figure 4A) preserves the transformed strain and provides starting material for colony PCR screening (Figure 1E and Figure 4B). Screening of colonies by PCR can be kept to a minimum-no more than 10 colonies should need to be processed, and most should yield a positive result for insertion. The PCR product for the screening primers, ABglmS2_F_New and Tn7R (Table 1), is 382 bp (Figure 4B lane 4); negative controls for the reaction include wild-type A. baumannii ATCC 17978 (Figure 4B lane 2), AB258 (Figure 4B lane 3), and no template (Figure 4B lane 5). Colonies that are PCR-positive represent complemented, marked strains.
Removal of the gentamicin resistance gene (unmarking) takes less than 3 h, spanning 6 days as cells transformed with the excision plasmid need to be chosen through selective plating, and then the excision plasmid needs to be cured from the bacteria (Figure 1F). Flp-FRT recombination-based excision is precise and effective and should result in ≥20 colonies on the transformation plate. Colonies that are cross-patched onto carbenicillin (selecting for β-lactam resistance conferred by the excision plasmid) and gentamicin (looking for loss of gentamicin resistance) should all be carbenicillin-resistant and gentamicin-sensitive, respectively. The excision plasmid is forced out of the bacteria by growth on 5% sucrose agar plates. Growth on sucrose forces the cells to eliminate pFLP2ab as the sacB gene on the plasmid promotes the conversion of sucrose to levans, a polysaccharide toxic to the bacteria12,13. All colonies that grow on 5% sucrose media should then grow only on plain LB agar plates; there should be no growth on carbenicillin agar plates. Colonies growing on the plain LB agar plates represent unmarked strains. Confirming loss of the gentamicin marker can be achieved by colony PCR using the Gm_F and Gm_R primers (Table 1 and Figure 5). This primer pair yields an amplicon of 525 bp only in the positive control (the initially created marked strain, Figure 5 lane 4); wild-type ATCC 17978 (Figure 5 lane 2), AB258 (Figure 5 lane 3), any tested colony (Figure 5 lane 5), and the no-template control (Figure 5 lane 6) should not show amplification.
Once the unmarked strain is confirmed, functional testing can commence with phenotypic assays. Here, the obvious first choice is determining the minimum inhibitory concentration (MIC) of a range of antibiotics: ciprofloxacin is a known substrate of AdeIJK, tetracycline can be removed by AdeIJK (the major efflux pump is AdeAB), and kanamycin has a relatively minor effect on A. baumannii ATCC 179782,14. Using the broth micro-dilution method according to the CLSI guidelines15, the complemented unmarked strain AB258::adeIJK was challenged with each antibiotic in the absence and presence of 50 µM IPTG; wild-type strain ATCC 17978 and RND efflux-deficient strain AB258 were included as controls (Table 2). Overall, the trend seen in the MIC values tells the expected story-decreased susceptibility of AB258::adeIJK to ciprofloxacin and tetracycline with induced expression of the efflux pump, verifying that the insertion of adeIJK was successful.

Figure 1: Overview of the procedure. (A) An overnight culture of the A. baumannii strain to be complemented is prepared. (B) The cells from the overnight culture are washed with water 3 times via centrifugation and kept on ice. (C) The delivery and helper plasmids are added to the cells and incubated on ice for 20 min. The sample is electroporated, LB media is added, and the cells are allowed to recover for 1 h at 37 °C. A 100 µL aliquot of cells is spread onto LB + Gm50 agar plates and incubated at 37 °C overnight. (D) Colonies from the transformation plate are patched onto an LB + Gm50 agar plate and grown overnight at 37 °C. (E) Patched colonies are prepared for PCR to screen for the presence of an amplification product spanning the chromosomal insertion site. PCR amplification is visualized by agarose gel electrophoresis. PCR-positive samples represent successful insertion of the gene of interest into the chromosome and the creation of a marked strain. (F) A colony positive for gentamicin is prepared as in steps (A-C), with electroporation of the pLFP2ab plasmid to remove the gentamicin cassette from the chromosomal insertion. Selective plating on LB + Cb200 agar confirms uptake of the plasmid. Duplicate patching on LB + Cb200 and LB + Gm50 agar plates reveals colonies that are CbR and GmS confirming loss of the gentamicin cassette from the insertion. Growth of selected CbR colonies on 5% sucrose cures the pLFP2ab plasmid from the cells. Colonies from the 5% sucrose plate are patched onto LB + Cb200 agar and LB agar to reveal desired CbS and GmS colonies and confirm the creation of the unmarked strain. Gm50, gentamicin at 50 µg/mL; Cb200, carbenicillin at 200 µg/mL; R, resistant; S, sensitive. Please click here to view a larger version of this figure.

Figure 2: Plasmids used in this protocol. General plasmid maps of (A) pUC18T-mini-Tn7T-LAC-Gm (insertion plasmid), (B) pTNS2 (helper plasmid), and (C) pFLP2ab (excision plasmid). Please click here to view a larger version of this figure.

Figure 3: Schematic of insertion and unmarking. (A) Insertion. The single Tn7 insertion site in the A. baumannii chromosome is located 24 bp from the end of the glmS2 gene. Co-electroporation of the insertion plasmid and the helper plasmid allows for complementation of the gene of interest (inserted gene, purple) along with the rest of the insertion cassette (FRT sites for marker excision, yellow; accC1 gene for gentamicin resistance, green; lacIq gene for inducible expression, blue) into the chromosome. (B) Unmarking. Electroporation of the complemented, marked insertion strain with the pFLP2ab excision plasmid facilitates removal of the gentamicin resistance gene (accC1, green) via Flp-FRT recombination (FRT sites, yellow), creating an unmarked strain. Please click here to view a larger version of this figure.

Figure 4: Transformation, patching, and insertion confirmation by colony PCR. Representative result of (A) the growth of transformation colonies after patching, and (B) colony PCR amplification with ABglmS_F_New (grey) and Tn7R (orange) primers to confirm chromosomal insertion. Lane 1: Low molecular weight DNA ladder; Lane 2: ATCC 179798; Lane 3: AB258; Lane 4: AB258::adeIJK-LAC-Gm; Lane 5: no-template control. The expected band of 382 bp is labeled. Note that the gentamicin-specific primers (Gm_F and Gm_R, green) could also be used to affirm chromosomal insertion. Please click here to view a larger version of this figure.

Figure 5: Confirmation of loss of marker by colony PCR. Representative result of colony PCR amplification with gentamicin-specific primers (Gm_F and Gm_R) to confirm the loss of the antibiotic marker via pFLPab-based excision. Lane 1: low molecular weight DNA ladder; Lane 2: ATCC 179798; Lane 3: AB258; Lane 4: AB258::adeIJK-LAC-Gm; Lane 5: AB258::adeIJK; Lane 6: no-template control. The expected band of 525 bp is labeled. Please click here to view a larger version of this figure.
| Strains, plasmids, and primers | Relevant characteristics | Reference |
| Stain | | |
| A. baumannii ATCC 17978 | Type strain | ATCC |
| A. baumannii ATCC 17978 AB258 | ΔadeAB,ΔadeFGH,ΔadeIJK | 11 |
| Plasmids | | |
| pUC18T-miniTn7T-Gm-LAC | GmR, AmpR | 9 |
| pUC18T-miniTn7T-Gm-LAC-adeIJK | GmR, AmpR, adeIJK | This study |
| pTNS2 | AmpR | 9 |
| pFLP2ab | pWH1266 origin or replication, sacB, AmpR | 7 |
| Primers | Sequence (5′–3′) | |
| ABglmS_F_New | CACAGCATAACTGGACTGATTTC | 7 |
| Tn7R | TATGGAAGAAGTTCAGGCTC | 7 |
| Gm_F | TGGAGCAGCAACGATGTTAC | This study |
| Gm_R | TGTTAGGTGGCGGTACTTGG | This study |
Table 1: Bacterial strains, plasmids, and primers used in this protocol. Gm, gentamicin; Amp, ampicillin; R, resistant.
| Ciprofloxacin | Tetracycline | Kanamycin |
| IPTG | − | + | − | + | − | + |
| ATCC 17978 | 0.250 | nd | 0.500 | nd | 1.5 | nd |
| AB258 | 0.031 | nd | 0.063 | nd | 4 | nd |
| AB258::adeIJK | 0.016 | 0.063 | 0.031 | 0.125 | 8 | 2 |
| Fold change | | 4.01 | | 4.03 | | 0.25 |
Table 2: Testing the functionality of the inserted genes via antibiotic susceptibility. Comparison of minimum inhibitory concentration (MIC) values for A. baumannii ATCC 17978, AB258, uninduced AB258::adeIJK, and IPTG-induced AB258::adeIJK against ciprofloxacin, tetracycline, and kanamycin. Fold change = induced (+ IPTG)/uninduced (− IPTG); nd = not determined.