Method Article

Quantifying Yersinia pseudotuberculosis Type III Secretion System Activity Following Iron Starvation and Anaerobic Growth

1.3K views

DOI:

10.3791/66642

May 31st, 2024

In This Article

Summary

Bacteria colonize host tissues that vary in oxygen and iron bioavailability, yet most approaches to studying bacteria use aerated, rich media. This protocol describes culturing the human pathogen Yersinia pseudotuberculosis under varying iron concentrations and oxygen tension, and quantifying activity of the Yersinia type III secretion system, which is an important virulence factor.

Abstract

A key virulence mechanism for many Gram-negative pathogens is the type III secretion system (T3SS), a needle-like appendage that translocates cytotoxic or immunomodulatory effector proteins into host cells. The T3SS is a target for antimicrobial discovery campaigns since it is accessible extracellularly and largely absent from non-pathogenic bacteria. Recent studies demonstrated that the T3SS of Yersinia and Salmonella are regulated by factors responsive to iron and oxygen, which are important niche-specific signals encountered during mammalian infection. Described here is a method for iron starvation of Yersinia pseudotuberculosis, with subsequent optional supplementation of inorganic iron. To assess the impact of oxygen availability, this iron starvation process is demonstrated under both aerobic and anaerobic conditions. Finally, incubating the cultures at the mammalian host temperature of 37 °C induces T3SS expression and allows quantification of Yersinia T3SS activity by visualizing effector proteins released into the supernatant. The steps detailed here offer an advantage over the use of iron chelators in the absence of iron starvation, which is insufficient for inducing robust iron starvation, presumably due to efficient Yersinia iron uptake and scavenging systems. Likewise, acid-washing laboratory glassware is detailed to ensure the removal of residual iron, which is essential for inducing robust iron starvation. Additionally, using a chelating agent is described to remove residual iron from media, and culturing the bacteria for several generations in the absence of iron to deplete bacterial iron stores. By incorporating standard protocols of trichloroacetic acid-induced protein precipitation, SDS-PAGE, and silver staining, this procedure demonstrates accessible ways to measure T3SS activity. While this procedure is optimized for Y. pseudotuberculosis, it offers a framework for studies in pathogens with similar robust iron uptake systems. In the age of antibiotic resistance, these methods can be expanded to assess the efficacy of antimicrobial compounds targeting the T3SS under host-relevant conditions.

Introduction

Many clinically relevant Gram-negative pathogens like Yersinia, Vibrio, Escherichia, Pseudomonas, and Shigella encode the type III secretion system (T3SS) to inject effector proteins into host cells1. In many bacterial species, the T3SS is under strict regulatory control2. For example, translocation of Yersinia T3SS effector proteins into target host cells is critical to subvert host defense mechanisms and enable bacterial colonization of host tissues. However, Yersinia T3SS activity is metabolically burdensome and can trigger recognition by host immune receptors3. Accordingly, regulators that sense specific environmental cues control the expression of T3SS genes in many bacterial species. As pathogens such as Yersinia experience environmental changes during their infection cycle that impact the expression of critical virulence factors, it is important to develop laboratory conditions that mimic salient features of host niches occupied by bacterial pathogens. Specifically, oxygen tension and iron availability differ among various tissue sites in a spatiotemporal manner and impact the expression of virulence genes such as the T3SS4,5,6. Therefore, the goal of this method is to assess how oxygen and iron impact the expression of the Yersinia T3SS. This will provide insight into the dynamics of the host-pathogen interaction.

The method described here details how to culture Yersinia pseudotuberculosis aerobically and anaerobically, as well as how to deplete Yersinia iron stores during aerobic or anaerobic growth. There are a few important considerations highlighted here regarding successfully culturing bacteria under these variable conditions. First, anaerobic culturing requires additional glucose supplementation, a modification that is noted in the media recipe. Second, since Y. pseudotuberculosis employs siderophores and other iron uptake systems that can robustly scavenge iron from the environment, special attention is devoted to ensuring the culture media and laboratory glassware are as free of iron as possible7. Previous studies have used iron chelators such as dipyridyl to deplete iron from rich-media bacterial cultures to mimic iron starvation8,9. However, depleting Yersinia iron stores to induce iron starvation requires the removal of residual iron in glassware and media as well as prolonged growth in the absence of iron. This protocol details how to acid wash glassware and chelate media to remove residual iron, in addition to culturing the bacteria for several generations to ensure thorough iron starvation. Iron starvation can be ensured by measuring relative transcript levels of well-characterized iron-responsive genes across conditions, as demonstrated here with yfeA, and bfd.

The culmination of this protocol demonstrates how to precipitate secreted T3SS effector proteins from each of these conditions by treating the culture supernatant with trichloroacetic acid (TCA) and visualizing secreted proteins through SDS-PAGE. Finally, relative T3SS activity is assessed by visualizing secreted proteins via silver staining and quantifying relative levels of T3SS effector proteins, referred to as Yersinia outer proteins (Yops)10.

T3SS activity assays generally utilize specific antibodies to detect T3SS effector protein levels in the culture supernatant. However, western blotting antibodies for T3SS effector proteins are often not commercially available. Therefore, special attention has been taken to ensure that the final visualization of T3SS activity in this method does not require specific antibodies, and instead can leverage silver staining, which allows for the visualization of all secreted proteins. While this method is specifically tailored and optimized for Y. pseudotuberculosis, it can be adapted to other bacterial species, though the exact media conditions and incubation times will vary.

Protocol

The details of the reagents, media composition, primer sequences, and equipment are listed in the Table of Materials. Figure 1 illustrates the overall experimental workflow.

1. Preparation of acid washed glassware and chelated M9 media

NOTE: Before starting, refer to the material section for the exact reagents and recipes that will be used. M9 media was first used for Yersinia T3SS assays in Cheng et al.11.

  1. Pour 100 mL of 6 N HCl into a 250 mL glass flask.
    CAUTION: HCl is extremely hazardous; ensure appropriate precautions are taken when handling this substance.
  2. Seal the mouth of the glass container with a glass stopper and carefully swirl the flask for 1 min to distribute the HCl thoroughly, occasionally changing directions.
  3. Dispose of the 6 N HCl appropriately.
  4. Rinse the glass container by adding 100 mL of deionized H2O, sealing the mouth, shaking for 20 s, then dumping the water.
  5. Repeat the rinsing step for a total of 3 times.
  6. Let air dry. Autoclave to sterilize.
  7. To chelate media, mix M9 components together with the chelating reagent and stir with a magnetic stir bar at room temperature for ~18 h. Filter-sterilize and add MgSO4 to a final concentration of 1 mM.

2. Culturing Y. pseudotuberculosis under varying iron levels and oxygen tension

  1. Streak Y. pseudotuberculosis (strain IP2666pIB1 is used in this study) on Lysogeny Broth (LB) agar plates and incubate at room temperature.
    NOTE: Incubating Yersinia at 37 °C, particularly in low calcium medium, leads to T3SS activity, growth arrest, and ultimately selects for loss of the plasmid for Yersinia virulence (pYV) that encodes the T3SS12. Therefore, this protocol uses 26 °C incubation of Yersinia until T3SS activity needs to be measured.
  2. After 48 h, once visible colonies form, inoculate 4 mL of M9 media containing 0.2% glucose, 1 mg/L FeSO4.7H2O, and supplemented with casamino acids (referred to here as M9 media) from a single, isolated colony and culture overnight at 26 °C with aeration at 250 rpm for approximately 18 h.
    NOTE: Use acid-washed glassware starting with the following step and moving on.
  3. Subculture into chelated M9 media following the steps below.
    NOTE: For all subsequent steps, M9 media with 0.9% glucose is used rather than the standard 0.2% glucose.
    1. Using a spectrophotometer, measure the optical density (OD600) of the overnight culture.
    2. Dilute the overnight culture to an OD600 value of 0.1 in a total of 14 mL of sterile chelated M9 media containing 0.9% glucose and no FeSO4.7H2O in a 250 mL acid-washed flask with no iron supplementation.
    3. Incubate for 8 h at 26 °C with aeration at 250 rpm.
  4. Subculture into aerobic and anaerobic cultures in parallel.
    1. Measure the OD600 of the growing cultures.
    2. For continuing aerobic incubation, subculture the growing cultures to an OD600 value of 0.1 in 14 mL of sterile chelated M9 media containing 0.9% glucose and no FeSO4.7H2O in a 250 mL acid-washed flask and culture with aeration at 26 °C for 12 h with no iron supplementation.
    3. For anaerobic culturing, subculture to an OD600 value of 0.1 in 14 mL of sterile chelated M9 media into two acid-washed glass tubes. Into the first tube, add filter-sterilized (using 0.22 µm polyethersulfone membrane) FeSO4.7H2O for a final concentration of 1 mg/L (referred to as "high iron"). In the second tube, add FeSO4.7H2O for a final concentration of 0.01 mg/L (referred to as "low iron"). This can be done by using a 10 mg/mL FeSO4.7H2O stock solution. Incubate both tubes anaerobically in an anaerobic chamber at room temperature for 12 h.
      NOTE: 1 mg/L FeSO4.7H2O provides iron-replete conditions for robust Yersinia growth. Conversely, adding only 0.01 mg/L FeSO4.7H2O to anaerobic cultures ensures sufficient growth under anaerobic conditions but still enables iron starvation responses, whereas aerobic cultures are grown for 12 h in the absence of any added iron to stimulate iron starvation responses prior to stimulation of T3SS activity.
  5. Induce type III secretion system activity.
    1. Shift the anaerobic cultures to 37 °C and continue anaerobic incubation for 4 h to induce the T3SS.
    2. Measure the OD600 of the aerobically growing culture.
    3. Into two acid-washed flasks, subculture the aerobically growing cultures to an OD600 value of 0.2 in 14 mL of sterile chelated M9 media. Into the first flask, add filter-sterilized FeSO4.7H2O for a final concentration of 1 mg/L. Into the second flask, add FeSO4.7H2O for a final concentration of 0.01 mg/L. Incubate both flasks with aeration at 26 °C at 250 rpm for 2 h.
    4. After 2 h, shift the aerobic cultures to 37 °C with aeration at 250 rpm and incubate for 4 h to induce the T3SS.

3. Trichloroacetic acid (TCA) precipitation of T3SS effector proteins

  1. Once the anaerobic incubation is complete, measure the OD600 of the cultures.
  2. Normalize all anaerobic samples to achieve equal cell mass (refer to the example provided in Table 1). For anaerobic culturing, generally expect an OD600 value of ~0.5 in iron-starved cultures and ~1 for iron-replete cultures. In this case, use 6 mL of the iron-starved cultures and 3 mL of the iron-replete cultures.
    NOTE: The remaining culture can be used for other purposes, such as harvesting total RNA and using quantitative PCR to measure steady-state levels of target mRNA (not described here).
  3. Transfer the normalized volumes of each culture into 15 mL tubes.
  4. To control for the efficiency of secreted protein precipitation, add 4 µL of 0.5 mg/mL bovine serum albumin (BSA) into each tube.
  5. Pellet cultures at 3200 x g for 15 min at 4 °C.
  6. Attach a 0.22 µm PVDF filter to a 10 mL syringe, and filter the supernatant of each pelleted culture into a fresh 15 mL tube.
    NOTE: This filtration step minimizes the chances of transferring whole bacterial cells, which would result in unwanted cytoplasmic proteins in the sample.
  7. Add 10% of the supernatant volume of 6.1 N TCA to each sample.
  8. Vortex vigorously for 1 min. Incubate tubes on ice in a 4 ˚C cold room overnight.
    NOTE: The duration of incubation can be optimized based on need. As little as a 1 h incubation can work for conditions or strains where secretion is robust.
  9. Repeat the pellet collection and TCA precipitation steps with the aerobic cultures once the 4 h incubation is complete.
    NOTE: Normalize the aerobic cultures by pelleting volumes with equivalent cell mass.
  10. Add 2 mL of each sample to a fresh 2 mL tube and centrifuge at 21,000 x g for 15 min at 4 °C.
  11. Aspirate supernatant using a vacuum attachment, and be careful not to touch the bottom or sides of the tube.
    NOTE: The pellet can be difficult to visualize and may appear as a haze along the length of the tube.
  12. Repeat steps 3.10 and 3.11 until all contents from each precipitation reaction are precipitated into a single 2 mL tube. This may take three or four sequential centrifugation steps but allows the concentration of all secreted proteins from each sample into a 2 mL tube.
  13. To wash the pellets, gently add 1 mL of ice-cold 100% acetone into each tube. To avoid sample loss, do not resuspend and do not touch the sides of the tube.
  14. Centrifuge the samples at 21,000 x g for 15 min at 4 °C.
  15. Aspirate the supernatant and be careful not to touch the bottom or sides of the tube.
  16. Repeat ice-cold acetone washing steps 3.13 and 3.14.
  17. After aspirating the supernatant for the final time, open the tubes and allow the pellet to dry completely on the bench for approximately 1 h.
  18. Add 50 µL of the FSB: DTT solution to each dried sample. To avoid protein loss, do not resuspend.
  19. Thoroughly vortex each sample for 1 min, ensuring the FSB: DTT solution coats the walls of the entire tube. This can be optimized by using a vortex attachment capable of holding multiple tubes at once.
  20. Boil the samples at 95 °C for 15 min.
  21. Centrifuge the samples briefly for 30 s at the maximum speed at room temperature.
  22. Store at -80 °C until future use.

4. SDS-PAGE and silver staining to visualize T3SS effector proteins

  1. Load 15 µL of each anaerobic sample and 10 µL of each aerobic sample into a 12.5% SDS-PAGE gel, along with 3 µL of a commercially available unstained standard as the ladder.
  2. Run the gel for about 90 min at 100 V. These settings can vary depending on the apparatus used.
  3. Follow the silver staining protocol following the manufacturer's instructions, resulting in a gel, as shown in Figure 2.

5. Quantifying relative T3SS activity

  1. Position the gel into the imaging system, ensuring all the bands intended for quantification are in the image frame.
    NOTE: The molecular weight of BSA is ~66 kDa, while the molecular weight of the T3SS effector protein YopE is ~23 kDa.
  2. In the software, select all the YopE bands across all wells.
  3. Set the reference YopE band to the appropriate sample.
  4. Export the relative quantification values calculated by the software for all the YopE bands.
  5. Going back into the software, select all the BSA bands across all wells.
  6. Set the reference BSA band to ensure it is from the same sample as the reference YopE band.
  7. Export the relative quantification values calculated by the software for all the BSA bands.
  8. To calculate relative YopE expression levels, divide the YopE relative quantity value by the BSA relative quantity value for each sample.

Results

This method allows for the relative comparison of secreted Yops across various conditions relative to a reference condition of interest. The overall experimental workflow is depicted in Figure 1. Table 1 depicts a representation of how cell culture normalization would typically occur in the instance of each culture condition and the volume of TCA that would be added to each supernatant. Here, representative results are shown using wildtype (WT) Y. pseudotuberculosis IP2666pIB1 as well as two congenic mutants, ΔyscNU and ΔyopE. The ΔyopE mutant is used as a control lacking YopE, while the ΔyscNU mutant is used as a complete T3SS negative control as it is unable to assemble a functional T3SS13,14. A representative image of a silver-stained 12.5% SDS-PAGE gel containing the secreted proteins is depicted in Figure 2. As described above, each sample contained spiked-in BSA as a control for protein precipitation efficiency. In analyzing the data, anaerobic and aerobic data sets should be treated as independent data sets since each was normalized separately. In the anaerobic samples, ~38-fold more YopE was present in the low iron samples relative to the high iron samples, consistent with previous results15,16. In the aerobic samples, a similar amount of secreted YopE was observed in low and high iron samples, consistent with previous results16. Generally, at least three biological replicates of each condition are used to establish statistical significance.

To confirm that this protocol results in adequate iron starvation, qPCR analysis was conducted on iron-responsive genes yfeA and bfd in the wildtype strain across all conditions. YfeA is the periplasmic binding protein of an ABC transport system responsible for iron transport, while Bfd is a bacterioferritin-associated ferredoxin involved in the mobilization of iron stores17,18,19,20. RNA was isolated as described previously21, and as expected, yfeA and bfd were significantly upregulated in iron-depleted conditions relative to iron-replete conditions, both aerobically and anaerobically, as shown in Figure 3. Additionally, we quantified yopE mRNA steady-state levels using qPCR to confirm that the observed results for relative YopE at the protein level were consistent with yopE transcript levels (see Figure 3).

Finally, since bacteria are prone to lysing in stressful culturing conditions, it was important to show that the steps in this protocol do not result in bacterial lysis that could potentially confound results. To confirm this, TCA-precipitated supernatant samples were subject to western blotting and probed for YopE and RpoA, a subunit of RNA polymerase and a cytoplasmic protein. As shown in Figure 4, while the YopE expression pattern followed that shown in Figure 3, there was no evidence of RpoA present in sample supernatants, suggesting there was no observable lysis that would release cytoplasmic RpoA into the supernatant.

Microbial culture experiment diagram, highlighting anaerobic/aerobic iron conditions over 5 days.
Figure 1: Experimental workflow for growing Yersinia pseudotuberculosis under varying iron and oxygen availability. Graphical representation of the culturing steps. Note that acid-washed glassware must be used starting on Day 4. Please click here to view a larger version of this figure.

Anaerobic vs aerobic culturing, protein gel electrophoresis, strain comparison, YopE/BSA ratio.
Figure 2: Results of silver stained 12.5% SDS-PAGE gel of TCA-precipitated protein from culture supernatants. Precipitated culture supernatants were loaded onto a 12.5% SDS-PAGE gel and silver stained. (A) Secretion profile of WT, ΔyscNU, and ΔyopE strains grown anaerobically. Representative relative values of YopE normalized to the anaerobic WT iron-replete sample. (B) Secretion profile of WT, ΔyscNU, and ΔyopE strains grown aerobically. Representative relative values of YopE normalized to the aerobic WT iron-replete sample. White arrows indicate YopE (~23 kDa). Please click here to view a larger version of this figure.

Anaerobic, aerobic conditions bar chart; mRNA levels, high/low iron impact; 16S rRNA reference.
Figure 3: Relative mRNA levels of iron-responsive genes demonstrate iron starvation. RNA was isolated from WT Y. pseudotuberculosis cultured in the conditions described in Figure 1. qPCR was used to measure the relative expression of yfeA, bfd, and yopE levels normalized to 16S rRNA in anaerobic (A-C) and aerobic (D-F) conditions. ****p < 0.0001 as determined by an unpaired t-test. Please click here to view a larger version of this figure.

Anaerobic vs. aerobic culturing Western blot; αYopE and αRpoA protein expression, iron levels.
Figure 4: The lack of cytoplasmic RpoA in supernatant samples demonstrates the lack of cell lysis in culture conditions. 5 µL of precipitated supernatants of (A) anaerobic and (B) aerobic samples from Figure 3 were run on a 12.5% SDS-PAGE gel along with a pellet control. Proteins were transferred onto a PVDF membrane for western blotting. The membrane was cut, and the top half probed for RpoA using an anti-RpoA antibody, and the bottom half probed for YopE using an anti-YopE antibody. Please click here to view a larger version of this figure.

(A)
ANAEROBIC
ConditionODVolume to Collect (mL)Volume of 6.1 N TCA added to Sup (mL)
WT Low Iron0.560.6
WT High Iron130.3
(B)
AEROBIC
ConditionODVolume to Collect (mL)Volume of 6.1N TCA added to Sup (mL)
WT Low Iron0.960.6
WT High Iron1.43.8570.386

Table 1: Representative sample collection workflow. On day 5, (A) once the 4 h incubation at 37 °C is complete for the anaerobic samples, 6 mL of the sample with the lowest OD600 value was collected and the rest of the sample volumes were normalized accordingly. After filtering the supernatant, 6.1 N TCA was added. (B) Once the aerobic incubations (2 h at 26˚ C and 4 h at 37 °C) were complete, 6 mL of the sample with the lowest OD600 value was collected, and the rest of the sample volumes were normalized accordingly. After filtering the supernatant, 6.1 N TCA was added.

Discussion

The T3SS is an important virulence factor in many pathogenic bacteria; therefore, developing laboratory techniques to study its regulation is important for understanding pathogenesis and developing potential therapeutics1. Iron and oxygen are known to be important host cues sensed by bacterial pathogens to regulate T3SS expression5; therefore, this method presents a strategy for culturing Y. pseudotuberculosis under either anaerobic or aerobic conditions, with iron starvation or repletion, and demonstrates how to quantify relative T3SS activity under these different conditions by assessing relative amounts of secreted YopE T3SS effector protein levels.

While the workflow for this experiment is relatively straightforward, there are a few points that must be closely considered to optimize the results. During the TCA-mediated protein precipitation step, it is important to avoid aspirating the protein pellet, which can be difficult to see. Taking extra precautions not to allow the aspirator tip to touch the walls or the bottom of the tube is critical. Additionally, when dealing with mutant strains with a lower level of T3SS activity, it is advisable to collect a larger sample to process. Lastly, if the lanes appear smeared after sample processing and gel staining instead of producing distinct bands, this may be due to either cell lysis during culturing or the carry-over of whole bacteria from the pellet into the supernatant fraction. In this case, the experiment should be repeated, and more care should be taken to avoid taking up the pellet when removing the supernatant. It is important to note that this protocol may not be sensitive enough to detect proteins that are secreted in very low amounts, in which case other detection methods may need to be employed. In addition, because many chelating agents will remove divalent cations other than iron and magnesium from the media, other divalent cations may be added back to the media following chelation to determine their effect on secretion.

Another important point to consider in these experiments is the propensity of salts in the M9 media to precipitate, resulting in variability between experimental batches. To mitigate this issue, it is possible to add filter-sterilized MgSO4 to the media immediately prior to culturing.

Overall, these methods provide a robust framework for quantifying relative Yersinia T3SS activity by measuring protein levels. Along with parallel approaches that aim to assess T3SS expression, the methods presented here allow for a comprehensive understanding of T3SS dynamics in response to host-relevant environmental cues. This protocol may also be adapted to other bacteria that can be grown in a defined media where an iron source can be omitted and for applications where measuring secreted proteins is pertinent to the scientific question.

Disclosures

The authors declare no competing financial interests.

Acknowledgements

Graphical Images created using BioRender.com. This study was supported by the National Institutes of Health (www.NIH.gov) grant R01AI119082.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
10 mL Luer-Lok Tip syringeBD301029
10x SDS Running Buffer Home made0.25 M Tris base, 1.92 M Glycine, 1% SDS in 1 L volume
12.5% SDS-Page GelHome made
15 mL culture tubesFalcon352059For initial overnight 
15 mL Falcon tubesFalcom352196For supernatant collection
250 mL culture flaskBelco251000250
500 mL Filter SystemCorning431097
6 N Hydrochloric acid solutionFisher Scientific7732185
AcetoneFisher ChemicalA949-44 L
Bio Rad ChemiDoc MP Imaging SystemBio RadModel Number: Universal Hood III
Borosilicate glass culture tubesFisherbrand14-961-34For anaerobic culturing
Chelex 100 ResinBio Rad142-1253
Chelex M9 +0.9% Glucose mediaHome made6 g/L Na2HPO4, 3 g/L KH2PO4, 0.5 g/L NaCl, 1 g/L NH4Cl, 1% casamino acids, 0.9% dextrose, 0.0005% thiamine, 5 g/L Chelex 100 Resin. Stir media for 18 h at room temp, filter using 500 mL Corning filtration unit, then add MgSO4 for 1 mM MgSO4 final solution
Final Sample Buffer (FSB)Home made0.1 M Tris-HCl, 4% SDS, 20% glycerol, 0.2% of Bromophenol Blue
FSB:DTT solutionHome madeFSB+0.2M DTT
Image Lab SoftwareBio Radhttps://www.bio-rad.com/en-us/product/image-lab-software?ID=KRE6P5E8ZSoftware
Isotemp Heat BlockFisher Scientific88860021
LB Agar PlatesHome made10 g Tryptone, 5 g Yeast extract, 10 g NaCl, 15 g Agar in 1 L total volume. Autoclaved
M9+0.2% Glucose MediaHome made6 g/L Na2HPO4, 3 g/L KH2PO4, 0.5 g/L NaCl, 1 g/L NH4Cl, 1 mM MgSO4, 1 mg/L FeSO47H2O, 1% casamino acids, 0.2% dextrose, 0.0005% thiamine 
Millex-GP PES 0.22um filter attachment for syringeMilliporeSLGPR33RSFor FeSO47H2O filtration
Millex-GV PVDF 0.22um filter attachment for syringeMilliporeSLGVR33RSFor supernatant filtration
Precision Plus Protein Unstained StandardBio Rad1610363
SDS-PAGE Gel ApparatusBio RadModel Number: Mini PROTEAN Tetra Cell
SilverXpress Silver Staining Kit InvitrogenLC6100
The BellyDancer ShakerIBI ScientificBDRAA1155
Trichloroacetic acid solution 6.1NSigma AldrichT0699
Vinyl Anaerobic ChamberCoy Lab Productshttps://coylab.com/products/anaerobic-chambers/vinyl-anaerobic-chambers/#details
qPCR Primer sequences 
yfeA forward - CAC AGT CAG CAG ACC TTA TCT T
yfeA reverse - GGC AGA CGG GAC ATC TTT AAT A
bfd forward - ccagcatcagccccatacag
bfd reverse - tggcttgtcggatgcacttc
yopE forward - CCATAAACCGGTGGTGAC
yopE reverse - CTTGGCATTGAGTGATACTG

References

  1. Deng, W., et al. Assembly, structure, function regulation of type III secretion systems. Nat Rev Microbiol. 15 (6), 323-337 (2017).
  2. Springer International Publishing. Bacterial Type III Protein Secretion Systems. 427, Springer International Publishing. Cham. (2020).
  3. Schubert, K. A., Xu, Y., Shao, F., Auerbuch, V. The Yersinia type III secretion system as a tool for studying cytosolic innate immune surveillance. Annu Rev Microbiol. 74, 221-245 (2020).
  4. Cassat, J. E., Skaar, E. P. Iron in infection and immunity. Cell Host Microbe. 13 (5), 509-519 (2013).
  5. Singhal, R., Shah, Y. M. Oxygen battle in the gut: Hypoxia and hypoxia-inducible factors in metabolic and inflammatory responses in the intestine. J Biol Chem. 295 (30), 10493-10505 (2020).
  6. Marteyn, B., et al. Modulation of Shigella virulence in response to available oxygen in vivo. Nature. 465 (7296), 355-358 (2010).
  7. Rakin, A., Schneider, L., Podladchikova, O. Hunger for iron: the alternative siderophore iron scavenging systems in highly virulent Yersinia. Front Cell Infect Microbiol. 2, (2012).
  8. Lesic, B., Carniel, E. Horizontal Transfer of the high-pathogenicity island of Yersinia pseudotuberculosis. J Bacteriol. 187 (10), 3352-3358 (2005).
  9. Green, E. R., et al. Fis is essential for Yersinia pseudotuberculosis virulence and protects against reactive oxygen species produced by phagocytic cells during infection. PLOS Pathog. 12 (9), e1005898(2016).
  10. Cornelis, G. R. The Yersinia Ysc-Yop "Type III" weaponry. Nat Rev Mol Cell Biol. 3 (10), 742-753 (2002).
  11. Cheng, L. W., Anderson, D. M., Schneewind, O. Two independent type III secretion mechanisms for YopE in Yersinia enterocolitica. Mol Microbiol. 24 (4), 757-765 (1997).
  12. Straley, S. C. The low-Ca2+ response virulence regulon of human-pathogenic yersiniae. Microbial Pathog. 10 (2), 87-91 (1991).
  13. Balada-Llasat, J. -M., Mecsas, J. Yersinia has a tropism for B and T cell zones of lymph nodes that is independent of the type III secretion system. PLoS Pathog. 2 (9), e86(2006).
  14. Adams, W., Morgan, J., Kwuan, L., Auerbuch, V. Yersinia pseudotuberculosis YopD mutants that genetically separate effector protein translocation from host membrane disruption: YopD central region promotes Yop translocation. Mol Microbiol. 96 (4), 764-778 (2015).
  15. Hooker-Romero, D., et al. Iron availability and oxygen tension regulate the Yersinia Ysc type III secretion system to enable disseminated infection. PLOS Pathog. 15 (12), e1008001(2019).
  16. Balderas, D., et al. Genome scale analysis reveals IscR directly and indirectly regulates virulence factor genes in pathogenic Yersinia. mBio. 12 (3), e00633-00721 (2021).
  17. Bearden, S. W., Perry, R. D. The Yfe system of Yersinia pestis transports iron and manganese and is required for full virulence of plague. Mol Microbiol. 32 (2), 403-414 (1999).
  18. Zhou, D., et al. Global analysis of iron assimilation and fur regulation in Yersinia pestis: Global analysis of iron assimilation and fur regulation in Yersinia pestis. FEMS Microbiol Lett. 258 (1), 9-17 (2006).
  19. Wijerathne, H., et al. a new class of [2Fe-2S] protein that functions in bacterial iron homeostasis, requires a structural anion binding site. Biochemistry. 57 (38), 5533-5543 (2018).
  20. Bearden, S. W., Staggs, T. M., Perry, R. D. An ABC transporter system of Yersinia pestis allows utilization of chelated iron by Escherichia coli SAB11. J Bacteriol. 180 (5), 1135-1147 (1998).
  21. Miller, H. K., et al. IscR is essential for Yersinia pseudotuberculosis type III secretion and virulence. PLoS Pathog. 10 (6), e1004194(2014).

Reprints and Permissions

Tags

Effector Protein SecretionSDS-PAGE AnalysisSilver StainingOxygen AvailabilityProtein PrecipitationBacterial Virulence