Here we detail an optimized protocol for mouse lateral tail-vein injection to systemically administer adeno-associated virus (AAV) in adult mice. Additionally, we describe protocols of commonly used assays to assess AAV transduction.
Method Article
Here we detail an optimized protocol for mouse lateral tail-vein injection to systemically administer adeno-associated virus (AAV) in adult mice. Additionally, we describe protocols of commonly used assays to assess AAV transduction.
Many disorders affect multiple organs or involve different regions of the body, so it is critical to deliver therapeutics systemically to target the affected cells located in different sites. Intravenous injection is a widely used systemic delivery route in preclinical studies that assess treatments intended for body-wide administration. In adult mice, it involves the intravenous administration of the therapeutic agent into the mouse's lateral tail veins. When mastered, tail-vein injections are safe and fast, and only require simple and commonly available tools. However, tail-vein injections are technically challenging and require extensive training and continuous practice to ensure the accurate delivery of the intended dose.
Here we describe a detailed, optimized, lateral tail-vein injection protocol that we have developed based on our experience and on recommendations that had been previously reported by other groups. Other than the mouse restrainers and insulin syringes, this protocol requires only reagents and equipment that are readily available in most labs. We found that following this protocol results in consistently successful intravenous delivery of adeno-associated virus (AAV) into the tail veins of unsedated 7-9 week-old mice. Additionally, we describe the optimized protocols for the histological detection of fluorescent reporter proteins and vector genome per diploid genome (vg/dg) quantification used to assess AAV transduction and biodistribution. The goal of this protocol is to aid experimenters in easily performing tail-vein injections successfully and consistently, which can reduce the practice time needed to master the technique.
Monogenic disorders make up 80% of rare diseases, which collectively affect 300 million individuals worldwide1,2. There are currently no approved curative therapies for the majority of these greatly debilitating rare disorders1,2,3. However, monogenic disorders are ideal candidates for gene therapies that can replace, supplement, correct, or silence dysfunctional genes4,5. Currently, multiple vectors are being developed and used to deliver gene therapies to specific cell types4,6. One of those vectors is adeno-associated virus (AAV). AAV is a non-pathogenic parvovirus that is increasingly being used as a gene therapy vector7. Compared to other viral vectors, AAV has lower immunogenicity, lower potential to integrate into the host genome, and the ability to efficiently transduce dividing and non-dividing cells in various tissues7,8. Additionally, multiple approaches have been developed to engineer and identify AAVs with desirable characteristics such as specific tissue tropism or further reduced immunogenicity, which greatly enhances AAV's versatility as a viral vector for different indications9. These factors have made AAV a widely investigated gene therapy vector and led to the development of multiple FDA-approved AAV-based gene therapies10.
Mouse models are commonly used to test potential gene therapies in vivo and better understand the pathomechanisms of monogenic disorders. This is due to the mouse models' recapitulation of the pathologies of different conditions, their genome's similarity to the human genome, and the relative ease of mouse handling, maintenance, and generation11,12,13. In vivo testing is particularly important when studying disorders that affect multiple systems or regions of the body, such as muscular dystrophies. For these disorders, in vitro testing might not be sufficient to comprehensively assess the safety, efficacy, pharmacokinetics, and pharmacodynamics of therapeutics intended to reach different body regions after systemic administration14.
Various systemic administration routes can be used to deliver drugs. Each route has its advantages, drawbacks, and degree of compatibility with the animal model and drug being investigated15. Intravenous (IV) lateral tail-vein injection is a commonly used route for systemic delivery of AAV in mice16. Lateral tail-vein injections allow fast and direct administration of the injectate into the mouse bloodstream ensuring high drug bioavailability in systemic circulation17. They also require relatively simple and commonly available tools to be performed. However, mainly due to the small tail vein diameter and difficulty in locating the vein, lateral tail-vein injections are technically challenging and require a high degree of skill and constant practice to avoid failed injection attempts or incomplete dose delivery16,17,18,19. These can result in the loss of expensive reagents or inaccurate results, especially if the incomplete injection is not recognized while performing the injection. Our experience summarized here is based on protocols reported in well-documented articles that we have adapted for our use, optimizing various steps of the lateral tail-vein injection procedure to ensure consistently successful injections20,21,22,23,24,25,26,27.
Here, we describe this detailed optimized lateral tail-vein injection protocol to deliver AAV into unsedated 7-9-week-old mice using simple and commonly available tools. Additionally, we provide the protocols for methods used to assess AAV delivery and biodistribution. These protocols cover post injection tissue collection, tissue fixation, DNA extraction, and digital polymerase chain reaction (dPCR) vector genome per diploid genome (vg/dg) quantification. The IV injection protocol and pointers provided here aim to enhance the ease of successfully performing lateral tail-vein injections. This will potentially help reduce the time needed to master the injection skills while simultaneously improving the accuracy and consistency of injections.
All animal handling and injection procedures were approved by the Animal Care Committee at NINDS. All animal procedures were conducted in compliance with the NINDS animal care and use guidelines.
1. Preinjection preparation
(2)
(3)
(5)
= 1.5 × 1012 vg for this mouse
= 7.5 × 109 (vg/µL)
= 53.75 (µL)2. Injection procedure
3. Dissection and tissue collection and fixation27
4. dPCR for vg/dg quantification
(7)
(8)Seven to nine weeks-old male mice were injected with AAV via lateral tail-vein injection at 1.5 × 1012 vg/mouse delivered in 150-200 µL of injectate volume. The ssDNA AAV used here delivered Cre recombinase transgene driven by CMV promoter. The injected mice were homozygous for the Cre reporter Ai14 allele. When exposed to Cre recombinase, Ai14 allele-containing cells express the fluorescent tdTomato protein. Since tdTomato expression is caused by Cre-induced genomic recombination, tdTomato-expressing cells indicate cells that were either directly transduced by the AAV or were progeny cells of transduced cells. The data shown here are of mice injected with AAV9-CMV-Cre at 1.5 × 1012 vg/mouse delivered in 160 µL (5.8-5.9 × 1013 vg/kg). The mice were sacrificed 28 days post injection, and the tissues were collected as described above. A few skeletal muscles and liver lobes were digested, and their cells were collected using FACS. A few liver lobes were frozen immediately using prechilled methylbutane for nucleic acid extraction. A few skeletal muscles and liver lobes were fixed-frozen for histological imaging of fluorescent tdTomato. tdTomato was expressed diffusely throughout the liver (Figure 2A) and quadriceps (Figure 2C) indicating that AAV9 broadly reached and transduced different regions of both tissues.
DNA extracted from fresh-frozen liver and FACS-sorted cells was used to quantify vg/dg using dPCR. Vg/dg quantification can be used to assess injection consistency and the transduction efficiency of AAV in the analyzed sample. The 1D droplet scatterplots from the fresh-frozen liver tissue sample and FACS-sorted cells were used to ensure the validity of the assay (Figure 3A,C). The scatterplot showed the presence of positive and negative partitions, clear separation between the positive and negative partitions that allows accurate determination of the detection threshold, and the presence of no-to-few droplets between the positive and negative partitions, which can reduce the accuracy of the dPCR assay. Meeting all these criteria indicated that the dPCR assay results were valid. The number of Polr2a gene copies in each sample was quantified to determine the number of mouse diploid genomes (2 Polr2a gene copies/mouse diploid genome), and primers/probe against the Cre recombinase transgene sequence were used to quantify the viral genome (1 transgene copy/viral genome, Table 1). The vg/dg value was quantified for the fresh-frozen liver tissue sample and FACS-sorted cells and showed the presence of 187.7 vg/dg and 4.7 vg/dg in each sample, respectively (Figure 3B,D). Samples from PBS-injected mice and non-template controls containing no nucleic acids were used as negative controls.

Figure 1: Intravenous injection station overview. (A) Tools needed to perform IV injection. Shown here is the (1) timer, (2) mouse tube restrainer, (3) uncut and (4) cut plastic restrainer cones, (5) alcohol swab, (6) empty pipette tips box used as a platform to elevate the mouse tube restrainer, (7) disposable absorbent pads, (8) 15 mL conical tube with warm water, (9) 15 mL tube holder, (10) gauze, and (11) insulin syringe. (B) The mouse is first placed inside the tube restrainer. Then, the cut restrainer cone is inserted to create a restraining sleeve around the mouse, if the mouse is too small to be restrained by the tube restrainer only. Ensure that the mouse's breathing is not obstructed by the restrainers. The tube restrainer is placed on top of the elevated platform to allow the placement of the mouse tail in warm water. (C) Mouse tail positioning and needle holding angle immediately before performing the injection. Pull back on the tail so the tail is stretched, and the injection site is completely horizontal. The needle is parallel to the tail and the vein, and the bevel is facing upwards. Please click here to view a larger version of this figure.

Figure 2: Detection of fluorescent reporter protein post IV injection. Seven to nine weeks-old male mice harboring the Cre reporter Ai14 allele were IV injected with either AAV9-CMV-Cre at 1.5 × 1012 vg/mouse delivered in 160 µL (5.8-5.9 × 1013 vg/kg) or PBS. Representative fluorescence images of mouse (A) liver or (C) quadriceps sections post AAV9 delivering Cre IV injection. (B) Liver or (D) quadriceps sections from PBS-injected mice were imaged to serve as negative controls. The tissues were collected and fixed-frozen 28 days post IV injection. Post-Cre exposure, fluorescent tdTomato protein is expressed in transduced cells and progeny cells of transduced cells. 10 µm-thick sections were imaged at 10x magnification. Scale bars = 100 µm. Please click here to view a larger version of this figure.

Figure 3: Vector genome per diploid genome (vg/dg) quantification. 1D scatterplot of dPCR vector genomes quantification in (A) liver tissue or (C) FACS-sorted cells collected from mice injected with either AAV9-CMV-Cre or PBS. The scatterplots show the positive and negative dPCR partitions, as well as the detection threshold indicated by the horizontal line across the samples. (B,D) vg/dg quantification after quantifying the mouse diploid genomes and vector genomes in the (B) liver tissue or (D) FACS-sorted cell samples. Results shown here are from a single AAV9-injected mouse and a single PBS-injected mouse with a technical dPCR duplicate for each mouse. Error bars indicate the 95% confidence interval for each sample. Abbreviations: NTC= Non-template control; dPCR = digital PCR; FACS = fluorescence-activated cell sorting. Please click here to view a larger version of this figure.
| Primer | Sequence |
| Cre forward primer | CTGACGGTGGGAGAATGTTAAT |
| Cre reverse primer | CATCGCTCGACCAGTTTAGTT |
| Cre probe | /56-FAM/CGCAGGTGT/ZEN/AGAGAAGGCACTTAGC/3IABkFQ/ |
| Polr2a forward primer | GACTCCTTCACTCACTGTCTTC |
| Polr2a reverse primer | TCTTGCTAGGCAGTCCATTATC |
| Polr2a probe | /5HEX/ACGAGATGC/ZEN/TGAAAGAGCCAAGGT/3IABkFQ/ |
Table 1: Sequences of primers and probes used for vg/dg quantification. Cre primers and probe were used to quantify the vector genome. Polr2a primers and probe were used to quantify the mouse diploid genome.
AAV-based therapies hold great potential for monogenic disorders due to the versatility of AAV as a gene therapy vector, which makes it possible to customize AAVs to meet the various delivery needs of different disorders4,5,7,9. AAVs are commonly administered via IV injection in preclinical mouse models to test the safety and efficacy of potential therapeutics16. As different injected AAV doses can result in marked differences in the experimental outcomes, it is critical for experimenters to be able to consistently inject the intended AAV dose to ensure the validity and robustness of the generated in vivo data28. IV injections are widely used, but they are technically challenging requiring extensive training and continuous practice to develop and maintain a skill level that ensures consistently successful injections16,17,18,19. In addition to correctly injecting AAV, it is usually desired to use assays to assess the injected AAV's biodistribution and delivery efficiency to the target tissues or cells29,30.
This protocol aims to assist experimenters to easily perform IV injections successfully and consistently by thoroughly describing the details of an optimized IV injection protocol to administer AAV in 7-9 week-old, unsedated mice. It is important to note that mice that are markedly smaller or larger than wild type mice in the age range used here may present a greater challenge due to a reduced visibility of the veins or incompatibility with the restrainers used in this method. It has been previously reported that tail IV injections are not appropriate for administering reagents intravenously in mice younger than 6 weeks old due to the small vessel size31. Although possible, it might be difficult to consistently inject mice weighing less than 22.0 g. successfully. Investigators using mice of atypical size may need to make adaptations to the procedure. This protocol also outlines several assays that can be used to assess AAV biodistribution and transduction efficiency.
Some critical points need to be kept in mind while following this protocol. During injection, 29 G needles provide greater resistance if the needle is not inside the vein. This reduces the volume lost from accidental perivascular injection of the solution during failed injection attempts. Insulin syringes have smaller dead volumes than regular syringes. If using a different syringe and/or needle than the ones listed here, additional injectate volume might need to be prepared in protocol steps 1.1.3.3 to account for larger dead space volume (e.g., add 30 µL to the intended dose instead of 15 µL).
If fine aspiration-caused air bubbles are formed on the syringe sides while aspirating the AAV dose into the syringe, slowly pull the injectate further up the syringe. This will remove most small air bubbles. Load at least an additional 10-15 µL of AAV to the intended volume to be injected. This additional volume is to account for any volume that might be lost during the expelling of air bubbles or potential failed injection attempts. (e.g., if the target volume to be injected is 150 µL, load 165 µL into the syringe (halfway between the 160 µL and 170 µL marks on the syringe scale). If the needle is correctly placed inside the vein, and the volume in the syringe is at 165 µL immediately before the successful injection attempt, deliver the reagent until 15 µL are left in the syringe (halfway between the 10 µL and 20 µL marks), thus delivering 150 µL (165 µL - 150 µL= 15 µL)). Aligning the bevel lumen (bevel facing upwards) with the syringe scale allows tracking the delivered volume during the injection.
Some experimenters might prefer to place the mouse on its side so that one of its veins is straight and easily accessible compared to a mouse on its feet. However, the tail of a mouse on its side will be slanted at different angles depending on the mouse size requiring injection-angle adjustment when injecting mice of different sizes. This might negatively impact the consistency of success of the procedure. During initial practice attempts, experimenters can try both mouse restraining orientations to determine their preferred approach. Having the mouse on its feet allows quick and easy access to both lateral tail veins. This reduces the restraining time when access to both veins is needed in the case of multiple failed injection attempts.
If injecting the lateral vein close to the tail base (closer to the mouse body) (especially for mice weighing >30 g.), adjust the injection angle from parallel to the vein to 5°-10° to the vein since the vein at the tail base is slightly deeper than it is distally.
The RNase digestion and RNA contamination check protocols listed here were verified on DNA samples isolated from fresh-frozen liver tissues containing a total of 175-700 ng of nucleic acids in 20 µL. The RNase digestion protocol was also tested on DNA samples isolated from fresh-frozen liver tissues and FACS-sorted cells to confirm the presence of the vector genome and the mouse genome after RNase digestion. The results were visualized using agarose gel electrophoresis of endpoint PCR amplification of the target amplicons.
Following the described methodology can reduce the training and practice time needed to master IV injections and result in a higher successful injection rate, which would save reagents. This protocol utilizes simple and commonly used tools without the need for advanced equipment or setups that might not be readily available. Furthermore, the IV injection steps listed here can be applied to a wide range of injectates that need to be administered intravenously, such as antisense oligonucleotides (ASOs), with the appropriate modifications made to the injectate preparation steps depending on the injectate.
The authors do not have any disclosures that are relevant to the work published in this article.
The authors would like to thank the NINDS animal care facility staff for their support. This work was supported by the Division of Intramural Research of the NIH, NINDS (Annual Report Number 1ZIANS003129). The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| 0.22 µm syringe filter | Millipore | SLGVM33RS | |
| 0.3 mL insulin syringes with 29G needle | BD Biosciences | 324702 | |
| 1.7 mL microcentrifuge tube | Crystalgen | 23-2051 | |
| 10 mL syringe | BD Biosciences | 302995 | |
| 100% EtOH | The Warner Graham Company | 201096 | |
| 10x phosphate-buffered saline (PBS) | Corning | 46-013-CM | Used to prepare 1x PBS for tissue fixation |
| 15 mL conical tube | Corning | 430766 | |
| 15 mL conical tube holder | Multiple sources | N/A | |
| 190 proof ethyl alcohol | The Warner Graham Company | 6810-01-113-7320 | Used to prepare 70% ethanol |
| 1x sterile PBS | Gibco | 10010023 | |
| 2 mL microcentrifuge tissue storage tubes | Eppendorf | 022363344 | |
| 4% paraformaldehyde (PFA) | Electron Microscopy Sciences | 157-4 | |
| Adeno-associated virus (AAV) | Charles River | N/A | Single-stranded DNA (ssDNA) AAV was packaged to deliver Cre recombinase as the transgene driven by CMV promoter |
| Alcohol swab | BD Biosciences | 326895 | |
| Bead lysis tube | Next Advance | GREENE5 | |
| BsuRI (HaeIII) restriction enzyme | Thermo Fisher Scientific | ER0151 | |
| Bullet blender | Next Advance | BBX24B | |
| Ai14-derived mice from JAX 007914 strain (genetic background: C57BL/6J) | N/A | N/A | Mice containing Ai14 Cre-reporter allele were purchased from JAX (catalog number: 007914) |
| Disposable absorbent pads | Fisherbrand | 1420662 | |
| Dissection forceps | Fine Science Tools (F.S.T) | 11251-35 | |
| Dissection scissors | Fine Science Tools (F.S.T) | 14085-08 | |
| DNA degradation reagent (DNAZap) | Invitrogen | AM9890 | |
| DNA-Extraction RNase A | Qiagen | 19101 | For RNA digestion during nucleic acid extraction |
| DNase-free RNase for DNA cleanup | F. Hoffmann-La Roche | 11119915001 | For RNA digestion after nucleic acid extraction |
| dPCR Probe PCR Kit | Qiagen | 250102 | |
| dPCR software | Qiagen | N/A | QIAcuity Software Suite |
| Elevated platform | Multiple sources | N/A | An empty pipette tips box was used to elevate the mouse restrainer during tail warming up |
| Fluorescence microscope | Multiple sources | N/A | Model used here: Nikon Eclipse Ti |
| Fluorescence microscope software | Multiple sources | N/A | Software used here: NIS-Elements |
| Gauze | Covidien | 9022 | |
| Heat block | Eppendorf | Thermomixer 5350 | |
| High-speed centrifuge | Eppendorf | 22620689 | |
| Metal container | Vollrath | 80125 | |
| Methylbutane | J.T. Baker | Q223-08 | |
| Molecular grade water | Quality Biological | 351-029-131 | |
| Mouse tube restrainer | Braintree Scientific | TV-RED-150-STD | |
| Myfuge mini centrifuge | Benchmark Scientific | C1012 | |
| Polymerase chain reaction thermal cycler | Bio-Rad Laboratories | 1851148 | Model: C1000 Touch |
| Precision wipes | Kimberly-Clark Professional | 7552 | |
| Proteinase K | Qiagen | 19131 | |
| QIAcuity dPCR Nanoplate 26k 24-well | Qiagen | 250001 | |
| QIAcuity One dPCR system | Qiagen | 911020 | |
| Qiagen DNeasy Blood & Tissue Kit | Qiagen | 69504 | Used for DNA extraction from tissues |
| Qiagen QIAamp DNA Micro Kit | Qiagen | 56304 | Used for cleanup of genomic DNA, and the isolation of DNA from small volumes of blood prtocotol was used for DNA extraction from FACS-sorted cells |
| Rodent restrainer cone | Braintree Scientific | MDC-200 | |
| Scale | Ohaus | 72212663 | |
| Styrofoam box | Multiple sources | N/A | |
| Sucrose | Sigma-Aldrich | S9378-1kg | |
| Surface cleaner and disinfectant | Peroxigard | 29101 | |
| Timer | Multiple sources | N/A | |
| Transfer forceps | Fine Science Tools (F.S.T) | 91113-10 | |
| Vortex | Daigger & Company | 22220A | Model: Daigger Vortex Genie 2 |
Request permission to reuse the text or figures of this JoVE article
Request Permission