Method Article

Understanding the Development of Compensatory Pathways in a Mutant Malaria Parasite Harbouring Hypomorphic Allele of Plant-Like Kinases

1.6K views

DOI:

10.3791/67079

November 22nd, 2024

* These authors contributed equally

In This Article

Summary

Chemical genetics involves the substitution of a gatekeeper residue with an amino acid containing a different side chain at the target locus. Here, we have generated a mutant parasite containing a hypomorphic allele of cdpk1 and identified compensatory pathways adopted by the parasite in the mutant background.

Abstract

One of the mechanisms for subverting the effect of drugs by the malaria parasite is through rewiring of its transcriptome. The effect is more pronounced for target genes belonging to the multigene family. Plasmodium falciparum protein kinases belonging to the CDPK family are essential for blood stage development. As such, CDPKs are considered good targets for the development of anti-malarial compounds. The chemical genetics approach has been historically used to elucidate the function of protein kinases in higher eukaryotes. It requires the substitution of gatekeeper residue for another amino acid with a different side chain through genetic manipulation. Amino acid substitution at the gatekeeper position modulates the activity of a protein kinase and changes its susceptibility to a specific class of compounds known as bumped kinase inhibitors (BKIs) that help in the functional identification of the target gene. Here, we have exploited the chemical genetics approach to understand compensatory mechanisms evolved by a mutant parasite harboring a hypomorphic allele of cdpk1. Overall, our approach helps in identifying compensatory pathways that may be simultaneously targeted to prevent the development of drug resistance against individual kinases.

Introduction

Malaria is one of the leading infectious diseases that is responsible for millions of deaths every year, especially in children below 5 years of age1. There is no clinically available vaccine against malaria. Moreover, Plasmodium falciparum, the deadliest human malaria parasite, is known to have acquired resistance against the frontline drug called artemisinin2,3,4,5. There is an urgent necessity to identify new drug targets and novel strategies that can be quickly deployed to avoid the spread of artemisinin resistance worldwide. A better understanding of the mechanism of drug action and the molecular basis of compensatory pathways can help in devising better strategies to avoid the development of drug resistance.

Protein kinases belonging to the family of Calcium Dependent Protein Kinases (CDPKs) are crucial at many stages of parasite development during erythrocytic, sexual, and pre-erythrocytic stages6. During asexual replication of P. falciparum, CDPK5 is known to play a critical role in the exit of merozoites from mature schizonts7. Conditional deletion of CDPK5 does not allow schizonts to release merozoites into the bloodstream, leading to the death of the parasite. The molecular mechanism of CDPK5-mediated parasite egress is not completely understood and is thought to involve protein kinase G (PKG) as an upstream regulator7,8. CDPK7 is essential for the maturation of ring-stage parasites to trophozoite9. CDPK4 is another member of the CDPK family that is critical for sexual stage development within mosquitoes. It is involved in multiple steps during the exflagellation process and is therefore critical for the formation of free, motile, male gametes10,11,12,13. CDPK1 phosphorylate components of inner membrane complex and rhoptry14,15. Moreover, conditional deletion of CDPK1 results in hypo-phosphorylation of proteins involved in invasion of RBC16. CDPK1 has been shown to regulate the discharge of apical organelles during the invasion process17. CDPK1 also helps in the egress of merozoites from infected RBC by phosphorylating SERA5 protease18. Phosphorylated CDPK1 is preferentially localized at the apical end of merozoite, where it may interact with other parasite proteins required for the invasion process19,20. CDPK1 is also involved in the formation of male and female gametes, which is a critical step for malaria transmission and the sexual development of the parasite within mosquitoes21.

The chemical genetics approach has been historically used for the identification of functional roles of mammalian kinases22,23. The approach utilizes the substitution of a residue at the gatekeeper position with an amino acid of a different side chain. The change of gatekeeper residue modulates the size of an adjacent ATP pocket that, in turn, changes the accessibility of chemical compounds called bumped kinase inhibitors (BKIs) towards the mutant enzyme compared to the wild type. Substitution of a bulky residue at the gatekeeper position with a smaller residue allows access to BKIs, while reverse substitution makes the kinase resistant to BKIs. In some cases, the substitution of gatekeeper residue is associated with a decrease in the kinase activity of the target enzyme, making the modification intolerant for functional studies24,25. The negative effect of gatekeeper substitution on the enzyme activity can be reversed by generating suppressor mutation at a second site in the intolerant kinase25. A chemical genetics approach has been utilized to study the function of Apicomplexan protein kinases. The wild-type CDPK4 containing a smaller gatekeeper residue was selectively inhibited by bumped kinase inhibitors BKI-1 and 1294, leading to a block in male gametogenesis and oocyst development11,12. Substitution of a small gatekeeper residue in CDPK4 with a bulky methionine residue led to a decrease in BKI-mediated inhibition in exflagellation11. CDPK1 of Toxoplasma gondii, an Apicomplexan parasite closely related to the malaria parasite, was shown to be involved in motility and invasion of host cells by tachyzoites26,27. A smaller gatekeeper pocket of the wild-type TgCDPK1 was exploited to design specific inhibitors that decreased the disease pathogenesis in animal models28,29. Involvement of P. falciparum Protein Kinase G (PKG) in late schizogonic development and gamete formation was demonstrated by inhibiting the activity of the enzyme using specific pharmacological inhibitors30,31. Substitution of threonine at the gatekeeper position with glutamine (T618Q) greatly decreased the sensitivity of the mutant enzyme to the inhibitors, resulting in normal gametogenesis and schizont-to-ring progression30,31.

Most of the previous studies have utilized a chemical genetics approach for the functional characterization of target kinases11,12,22,23,26,30,31 however, we have adopted this approach to understand the development of compensatory mechanisms in parasites that harbor hypomorphic allele of a protein kinase. We earlier showed that substitution of wild-type gatekeeper residue in CDPK1 with methionine (T145M) results in ~ 47% decrease in the transphosphorylation potential of the mutant enzyme32. A mutant parasite containing the hypomorphic allele of cdpk1 (cdpk1t145m) is pre-adapted for the reduced activity of CDPK1 by transcriptional rewiring of other CDPK family members. We believe that this strategy may be used in general to elucidate the compensatory mechanisms in mutant parasites containing hypomorphic alleles of essential protein kinases. Other kinases that partially compensate for the function of the target kinase may be simultaneously inhibited along with the target kinase to prevent the development of drug resistance against individual kinases. This may serve as a better strategy for malaria control.

Protocol

The P. falciparum parasite strain (NF54) was obtained from Alvaro Molina Cruz21,32,33. O+ human red blood cells used for the parasite culture were obtained from Rotary Blood Centre, New Delhi, India. The plasmids, pL6eGFP and pUF1, were obtained from Jose-Juan Lopez-Rubio. DSM267 was obtained from Margaret A. Phillips and Pradipsinh K. Rathod. WR99210 was provided by Jacobus Pharmaceutical Company.

1. Construction of plasmid for expression of recombinant CDPK1 in Escherichia coli

  1. Design the oligonucleotide primer pair to amplify the complete CDS of the cdpk1 gene (PlasmoDB accession no. PF3D7_0217500) using primer analysis software.
    1. Amplify the complete CDS using DNA polymerase with gene-specific oligonucleotide pair: Pk1fpgex and Pk1rpgex (see Table 1) using cDNA prepared from Plasmodium falciparum as a template in a reaction volume of 20 µL. Set the PCR amplification conditions as follows: Initial denaturation at 98 °C for 2 min, (Denaturation at 98 °C for 30 s, Annealing at 52 °C for 20 s, Extension at 62 °C for 20 s) x 36, Final extension at 62°C for 10 min. Store the PCR product at 4 °C until further use.
  2. Digest 1 µg of the amplified PCR product and 1 µg of the pGEX4T1 expression plasmid with BamHI (20,000 U/mL) and NotI (20,000 U/mL) restriction endonucleases for 3-4 h at 37 °C in a total reaction volume of 30 µL.
  3. To purify the double-digested PCR product and the plasmid, use a column-based PCR clean-up kit and follow the manufacturer's instructions.
  4. Ligate 100 ng of double-digested, purified pGEX4T1 plasmid with an insert at a 1:5 vector-to-insert molar ratio using 1 µL of T4 DNA ligase in a total reaction volume of 10 µL. Incubate the ligation reaction at 16 °C overnight.
  5. Transform E. coli DH5α competent cells with the ligated mixture following the manufacturer's protocol and plate on LB agar plates containing ampicillin (100 µg/mL).
  6. Screen four bacterial clones obtained from the transformation for the presence of the recombinant plasmid by purifying the plasmid using a mini plasmid purification kit according to the manufacturer's instructions. Confirm the recombinant plasmid by double restriction digestion using BamHI and NotI, as described above in step 1.3.
  7. Further verify the restriction digestion-positive clones for the correct sequence by Sanger DNA sequencing. Transform E. coli BLR(DE3) pLysS competent cells with the sequence-verified plasmid construct for CDPK1 protein expression.

2. Expression and purification of recombinant CDPK1 protein in E. coli

  1. Expression of recombinant CDPK1
    1. Inoculate a single clone of E. coli BLR(DE3) pLysS strain containing the sequence-verified plasmid construct into 10 mL of LB medium containing ampicillin (100 µg/mL). Incubate the culture overnight at 37 °C with shaking at 200-250 rpm.
    2. Inoculate the secondary culture with 1% of the primary culture and allow the bacterial cells to grow to the mid-log phase at 37 °C. When the optical density (OD) of the secondary culture reaches 0.7-0.9 at 600 nm, induce the expression of the full-length recombinant CDPK1 by adding 1 mM Isopropyl ß-D-1-thiogalactopyranoside (IPTG) and incubate for 10-12 h at 24 °C.
    3. Following the incubation, harvest the E. coli cells by centrifugation at 5,000 x g for 10 min. Decant the supernatant and retain the cell pellet.
    4. Prepare the lysis buffer with the following composition: 1 mM dithiothreitol (DTT), 0.1 mg/mL lysozyme, 1 mM EDTA, 1 mM phenylmethylsulfonyl fluoride (PMSF), and a 1x protease inhibitor cocktail in phosphate-buffered saline (PBS).
    5. Resuspend the cell pellet in 10 times the pellet weight volume of the lysis buffer. Sonicate the cell suspension for 15 min in intervals of 9 s On, 15 s Off to prevent localized heating that may lead to protein denaturation.
    6. Centrifuge the lysate at 17,000 x g for 1 h and incubate the clear supernatant with glutathione beads overnight at 4 °C. Follow the protocol mentioned below to obtain purified recombinant CDPK1 protein.
  2. Affinity chromatography using glutathione beads for purification of GST-tagged CDPK1
    1. Take 500 µL of completely resuspended glutathione beads for 250 mL of bacterial culture and centrifuge at 500 x g for 5 min at 4 °C. Carefully decant the supernatant.
    2. Wash the beads with 5 mL of binding buffer (140 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM KH2PO4, pH 7.3) and invert to mix.
    3. Centrifuge at 500 x g for 5 min at 4 °C and remove the supernatant. Repeat washing and centrifugation for 3x-4x.
    4. Add the beads to the bacteria cell lysate and incubate for 12 h at 4 °C with slight shaking (20-30 rpm).
    5. Centrifuge at 500 x g for 5 min at 4 °C and remove the supernatant. The supernatant can be saved to estimate the amount of recombinant CDPK1 that remains unbound.
    6. Wash the CDPK1-bound beads at least 5-6 times with PBS containing 1 mM DTT followed by a wash with 50 mM Tris, 100 mM NaCl, 1 mM DTT, pH 7.5.
    7. Elute the bound protein 2x first with 250 µL of elution buffer 1 (EB1) followed by 2x with 250 µL of elution buffer 2 (EB2). The composition of EB1 and EB2 is 10 mM reduced glutathione in 50 mM Tris, 100 mM NaCl, pH 7.5 and 20 mM reduced glutathione in 50 mM Tris, 100 mM NaCl, and pH 7.5, respectively.
    8. Incubate the CDPK1-bound beads in elution buffers 1 and 2 at room temperature (RT) for 5-10 min using gentle agitation or end-over-end rotation.
    9. Centrifuge at 500 x g for 5 min at 4 °C and carefully transfer the supernatant containing the eluted CDPK1 recombinant protein in a separate tube.
    10. Repeat steps 2.2.8 and 2.2.9 to obtain 2 elutes each with EB1 and EB2.

3. Site-directed mutagenesis for generation of recombinant CDPK1 gatekeeper mutant proteins

  1. Use the pGEX4T1 plasmid containing sequence verified cdpk1 gene. We prefer using the same plasmid that was used for the transformation of the E. coli BLR(DE3) pLysS strain.
  2. Design the primers to introduce a gatekeeper mutation in the wild-type cdpk1 gene sequence. The wild-type gatekeeper residue (T145) is encoded by an ACC codon in the cdpk1 gene. Replace the threonine gatekeeper with small (serine, T145S) and bulky (methionine, T145M) gatekeeper residues that are encoded by AGC and ATG codons, respectively.
  3. Follow the below-mentioned guidelines to design the forward and the reverse primers for site-directed mutagenesis.
    1. Ensure both primers are complementary to each other. Keep 15-20 nucleotides of unmodified sequence on both sides of the mutation. Ensure Tm is from 50 °C to 55 °C for the sequence, excluding the mutated site.
  4. Use the site-directed mutagenesis kit to generate the gatekeeper mutant constructs of cdpk1. Follow the manufacturer's instructions to introduce the desired mutation. The primers used for site-directed mutagenesis are listed in Table 1.
  5. Treat the reaction mixture with 0.5 µL DpnI (20,000 U/mL) enzyme to digest the parental, methylated plasmid. Incubate the reaction mixture at 37 °C for 3 h. Transform E. coli DH5α competent cells with the DpnI-treated reaction mixture.
  6. Screen four clones each of T145M and T145S plasmid constructs to verify the introduction of the desired mutation in cdpk1 gene sequence through DNA sequencing.
  7. Transform the sequence verified plasmids in the E. coli BLR(DE3) pLysS strain for expression of the recombinant CDPK1 T145M/S proteins as described in step 1.5.
  8. Express and purify the CDPK1 gatekeeper mutant proteins following the steps as described in section 2 for the wild-type CDPK1 protein.

4. In vitro kinase activity assay of CDPK1

NOTE: The kinase activity of recombinant wild-type CDPK1 and the gatekeeper mutant proteins is evaluated by a semisynthetic epitope tagging approach as described by Allen et al.34.

  1. Incubate 50 ng of recombinant protein in the buffer containing 50 mM Tris, 50 mM MgCl2, 1x phosphate inhibitor cocktail with 2 µg myelin basic protein (MBP) as an exogenous substrate of CDPK1 in the total reaction mixture of 50 µL.
  2. Depending on the conditions requiring the presence or absence of calcium, add CaCl2 or EGTA, respectively to make the final concentration of 2.5 mM each in the kinase assay buffer. Add ATPγS to the final concentration of 100 µM to the buffer to use it as the source of the transferable terminal phosphate group.
  3. Incubate the reaction mixture at 30 °C in a water bath for 1 h, followed by termination of the reaction by the addition of 5 mM EGTA. Add 5 µl of 50 mM p-nitrobenzyl mesylate (PNBM) to the reaction mixture and allow it to incubate at 20 °C in a water bath for 2 h for the alkylation of the phosphorylated serine and threonine residues in the transphosphorylation MBP and autophosphorylated CDPK1.
  4. To the total 55 µL of reaction mixture, add 19 µL of 4x SDS sample buffer and heat at 95 °C for 5 min.

5. Western blot analysis to detect the thio-phosphorylated products of the in vitro kinase assay

  1. Prepare 12% SDS-PAGE gel and load 15 µL of each sample. Separate the reaction mixture to visualize autophosphorylated CDPK1 and transphosphorylated MBP.
  2. Transfer the separated proteins from the SDS-PAGE gel to a PVDF membrane using the wet transfer method32.
  3. Block the nonspecific sites on the PVDF membrane by incubating it with 5% skim milk in Tris-buffered saline (20 mM Tris-HCL, pH 7.5, 150 mM NaCl) containing 0.05% Tween 20 for 1 h at RT.
  4. Incubate the PVDF membrane with the rabbit primary antibody against alkylated thiophosphorylated adducts at a 1:2,500 dilution overnight at 4 °C in the blocking buffer.
  5. After overnight incubation, wash the blot 3x with Tris-buffered saline with 0.05% Tween 20 for 10 min each.
  6. Incubate the blot further with goat anti-rabbit secondary antibody in blocking buffer at a 1:5,000 dilution for 1 h at RT, followed by washing with Tris-buffered saline containing 0.05% Tween 20.
  7. Overlay the blot with chemiluminescent substrate by mixing an equal proportion of solution A and solution B according to the manufacturer's instruction and expose on X-ray film in a dark room to obtain signals of CDPK1 autophosphorylation and MBP transphosphorylation.

6. Cloning of guide sequence for targeting  cdpk1 locus for introducing gatekeeper substitution

NOTE: The guide sequence of 20 nucleotides was selected by manual curation and cloned in pL6eGFP plasmid at BtgZI site by employing the following steps.

  1. Digestion of pL6eGFP using BtgZI enzyme
    1. Digest 1 µg of pL6eGFP plasmid35 with 1 µL of BtgZI enzyme (5,000 units/mL) for 4 h at 60 °C in a reaction mixture of 20 µL, following the enzyme manufacturer's protocol for reaction conditions.
    2. After the 4 h incubation period, run the digested plasmid on a 1% agarose gel and excise out the gel piece (~ 9.8 kb) containing the digested plasmid. Purify the digested plasmid using a column-based gel extraction kit according to the manufacturer's instructions.
  2. Annealing of oligos
    1. Reconstitute the oligonucleotides (Ck1GUIDEFWD and Ck1GUIDEREV) in DNase/RNase-free water to prepare a 100 µM stock solution.
    2. Combine 20 µM of each oligonucleotide in a solution containing 10 mM Tris (pH 8.0), 50 mM NaCl, and 1 mM EDTA. Incubate the mixture at 95 °C in a dry bath for 5 min and allow the reaction to cool down to room temperature. It usually takes 1 h for the temperature of the reaction mixture to attain RT.
    3. Dilute the annealed oligonucleotides to 0.5 µM in Tris pH 8.0, resulting in a total reaction mixture volume of 100 µL.
  3. In-fusion reaction
    1. Combine 1.5 µL of diluted oligonucleotides with 100 ng of BtgZI-digested linearized plasmid in 5x In-Fusion enzyme premix in a total reaction volume of 10 µL to generate a CDPK1 guide containing pL6CK1G plasmid.
    2. Incubate the reaction for 15 min at 50 °C. Store the reaction at 4 °C until proceeding with the transformation of E. coli.
      NOTE: For long-term storage, the reaction mix can be stored at -20 °C.
  4. Transformation of E. coli Stellar competent cells
    1. Add 2.5 µL of the reaction mixture to the E. coli Stellar competent cells and proceed with the transformation process following the manufacturer's protocol.
    2. Plate the transformed competent cells on LB ampicillin (100 µg/mL) plate and allow the transformed bacteria to grow at 37 °C overnight.
    3. Select the transformed colonies and extract the plasmid using a commercially available plasmid miniprep kit. Follow the manufacturer's instructions for plasmid purification. Validate the insertion of the guide into the plasmid through Sanger DNA sequencing.

7. Cloning of homology arm for repair of Cas9 endonuclease restricted cdpk1 locus

NOTE: A homology arm comprising the SNPs to be introduced in the target locus is commercially synthesized. We usually take a homology arm of 400-1000 bp in length. The homology arm contains silent mutations in the guide RNA region and PAM to prevent the re-cutting of the modified locus after the incorporation of the desired SNPs. The homology arm (corresponding to nucleotides 133 to 553 of CDPK1), incorporating Met or Ser gatekeeper mutation and silent mutations, is flanked by AflII and SpeI restriction sites.

  1. Double digest 1 µg of pL6CK1G and the plasmid containing the homology arm using 0.5 µL each of AflII (20,000 U/ml) and SpeI (20,000 U/ml) restriction enzymes for 4 h at 37 °C in a reaction mixture of 20 µL.
  2. Run the complete reaction of double-digested plasmids on 1.5 % agarose gel and purify the bands corresponding to the homology arm and plasmid backbone of pL6CK1 using a gel extraction kit following the manufacturer's instructions.
  3. Ligate the digested homology arm with 100 ng of pL6CK1 plasmid in a vector-to-insert ratio of 1:5 in a total reaction volume of 10 µL using T4 DNA ligase. Incubate the ligation reaction overnight at 16 °C. Transform E. coli DH5α competent cells with the complete ligation mixture according to the manufacturer's instructions.
  4. Plate the transformed cells on LB agar plates containing ampicillin (100 µg/mL) to select positive transformants. Select single colonies from the LB ampicillin plate and purify the plasmid using a plasmid extraction kit.
  5. Confirm the clone for the presence of the homology arm by digesting the purified plasmid with AflII and SpeI enzymes using the same digestion condition as described in step 7.3. Confirm the double digestion positive clones further by Sanger DNA sequencing to validate the complete sequence of the homology arm.

8. Purification of pL6CK1Met, pL6CK1Ser and pUF1 plasmids for malaria parasite transfection

  1. Set 5 mL of primary cultures of sequence-verified clones of pL6CK1Met, pL6CK1Ser, and pUF1 in LB media containing ampicillin (100 µg/mL) and incubate for 10 h. Transfer the primary culture into the secondary culture at a ratio of 1:1000 and incubate for an additional 12 h.
  2. Pellet the bacterial culture by centrifugation at 5000 x g for 10 min in a centrifuge bottle.
  3. Isolate the plasmids using a plasmid purification kit according to the manufacturer's protocol. Dissolve the plasmid DNA in DNase/RNase-free water for direct transfection of the parasite.

9. In vitro culturing of Plasmodium falciparum and sorbitol synchronization for transfection

NOTE: P. falciparum in vitro culture in human red blood cells (RBCs) is performed according to the method outlined by Trager and Jensen36.

  1. Propagate NF54 strain of P. falciparum by culturing in O+ human RBCs at a hematocrit of 2% in complete RPMI (cRPMI) medium containing RPMI 1640 supplemented with L-glutamine, 25 mM HEPES, 25 mM sodium bicarbonate, and 50 µg/mL hypoxanthine. Supplement the medium with 0.5 % AlbuMAX II and 10 µg/mL gentamicin and maintain the culture at 37 °C under an atmosphere of 5% O2, 5% CO2, and 90% N2.
  2. For sorbitol synchronization to obtain ring stage parasite, pellet the asynchronous parasites in a 50 mL conical tube by centrifugation at 2,300 x g for 3 min at RT. Discard the supernatant.
  3. Incubate the parasitized RBCs with 9 volumes of 5% sorbitol for 10 min at 37 °C. Following incubation, pellet down the RBCs by centrifugation at 2,300 x g for 3 min and discard the sorbitol.
  4. Wash the sorbitol-treated parasites with incomplete RPMI, iRPMI (RPMI media without albumax and sodium bicarbonate) and subsequently incubate them in cRPMI. Use the ring stage parasites in the next cycle for plasmid transfection.

10. Transfection of ring stage parasite with pL6CK1Met, pL6CK1Ser and pUF1 plasmids

NOTE: The following steps are employed for the direct transfection of ring-stage parasites with plasmid DNA.

  1. Prepare 2x cytomix buffer37 by dissolving in 30 mL of water, 240 mM KCl, 0.3 mM CaCl2, 4 mM EGTA, 10 mM MgCl2, 20 mM K2HPO4/KH2PO4, and 50 mM HEPES. Adjust the pH to 7.6. Adjust the final volume to 50 mL. Filter sterilize the buffer using a 0.22 µm syringe filter. Then, dilute the 2x cytomix buffer with sterile water to obtain a 1x cytomix buffer.
  2. In a sterile 15 mL conical tube, add 100 µL of packed ring-staged parasitized RBCs and wash them 2x with 5 mL of 1x cytomix buffer. Perform the washes by centrifugation at 994 x g for 3 min at RT.
  3. After washing, remove the buffer and add 50 µg of each plasmid (pL6CK1Met/pUF1 for generating T145M mutation and pL6CK1Ser/pUF1 for generating T145S mutation) into the packed parasitized RBCs. Then, add 2x buffer according to the volume of plasmid and adjust the volume to 400 µL with 1x buffer concentration.
  4. Transfer 400 µL of the above solution into 0.2 cm cuvettes for each transfection. Electroporate using the following conditions: 0.31 kV, 950 µF, and resistance set to Infinite.
  5. Following electroporation, remove the transfected parasites from the cuvette, mix them with cRPMI, and transfer them into a T25 flask with a total volume of 15 mL. Incubate the parasites for 2 h under the conditions mentioned in step 9.1.
  6. After incubation, transfer the transfected parasites into a 50 mL conical tube and centrifuge at 994 x g for 3 min. Remove the supernatant and wash the parasites with 10 mL of incomplete RPMI. Culture them with fresh cRPMI for 2 days, replenishing the culture medium after 24 h.
  7. After 48 h, remove the cRPMI from each flask and resuspend the culture in cRPMI containing 2 nM of WR99210 and 150 nM of DSM26738. Then, transfer the culture into a T75 flask by adding 400 µL of fresh RBCs. Replenish the media daily with cRPMI containing WR99210 and DSM267 for 7 days. Subsequently, add cRPMI containing both drugs every other day until day 14 after the transfection.
  8. On day 14, aliquot 200 µL of transfected culture in a 1.5 mL of microcentrifuge tube (MCT) for slide preparation. Pellet down the cells by centrifugation at 500 x g for 5 min at RT. Aspirate the supernatant and transfer the cells onto the slide. Make a smear using another slide by placing it at a 45° angle.
  9. Fix the slide in methanol and prepare the Giemsa stain by diluting it 1:10 in ultrapure water. Then, stain the slide by completely immersing it in the Giemsa stain for 20 min. Wash the slide under running water and dry it thoroughly. Then, observe the slide under a light microscope at 100x magnification by applying immersion oil.
  10. Once the parasites are visualized, replenish the media daily and allow them to grow for 2-3 days. Then, remove the parasites to verify the desired modification in the target gene sequence at the targeted locus.
    NOTE: If the parasites are not visible on day 14, replenish the media (containing both the drugs) after 4 days. Cut the parasite by 30% and add fresh blood to maintain 2% hematocrit every 7 days until the parasites reappear.

11. PCR verification of transgenic parasite with desired modification of cdpk1 locus

  1. Following 2-3 days of parasite growth, take out 500 µL of culture and transfer it into a 1.5 mL MCT.
  2. Pellet the cells by centrifugation at 2,400 x g for 5 min. Then, lyse the RBCs by saponin treatment.
    1. For saponin treatment, add 10 µL of 10% saponin solution to 1 mL of resuspended parasite pellet and keep at 4 °C for 5 min. Centrifuge the cells at 2,400 x g for 5 min at 4 °C and discard the supernatant. Repeat this step until the redness disappears completely and a black-colored pellet of parasites is obtained.
  3. Wash the parasite pellet with 1 mL of 1x PBS by centrifugation at 2,400 x g for 5 min. Afterward, resuspend the pellet in 50 µL of DNase/RNase-free water. Heat the resuspended parasite pellet at 95 °C for 5 min, followed by centrifugation at 16,200 x g for 10 min at 4 °C. Transfer the supernatant containing parasite DNA to a fresh tube.
  4. Utilize the above genetic material to PCR amplify the full-length gene employing the primer set ck1f1 and ck1r3wt (see Table 1), specifically targeting the region outside of the homology arm as described above in step 1.2. Sequence the homology region containing the T145M mutation using the ck1f1 primer.

12. Limiting dilution for obtaining clonal transgenic parasites

  1. After sequence verification, dilute the transfected parasite culture to achieve a final concentration of 1 parasite per 200 µL. Then, add 100 µL of the diluted culture to the wells of a 96-well tissue culture plate. Perform the following steps (12.2-12.4) to achieve 1 parasite/200 µL.
  2. Prepare 10 mL of parasitized RBCs with 2% hematocrit. Estimate the percent parasitemia of the culture using the Giemsa staining method described above. Then, count the total number of RBCs in a 1:100 diluted culture using a hemocytometer.
    Total Number of RBCs/mL = Average number of RBCs counted x Dilution factor x 104
    Number of parasitized RBCs/mL = (percent parasitemia x Total Number of RBCs/mL)/100
  3. Prepare 1:10,000 dilution of parasitized RBCs by serially diluting the initial culture 2x (1:100 dilution each).
  4. Add an appropriate volume (in microliters) from the diluted culture to achieve a total of 50 parasites in 10 mL of media, ensuring 2% hematocrit. Then, add 100 µL of the media containing 50 parasites to each well of the 96-well plate. Place the plate in an airtight secador flushed with mixed gas (composition as described above in step 9.1) and incubate at 37 °C. Replace the media after every 2 days.
  5. Replace the media with cRPMI containing 2% hematocrit every 7th day until the parasites appear.
    1. Tilt the 96-well plate to a 45° angle and allow the RBCs to settle down. Using a serological pipette, carefully remove the media from each well and observe a color change to yellow in wells containing parasites, contrasting with the pink color of media in parasite-free wells. This color change occurs because the parasites acidify the medium.
  6. After observing the color change, take out a small amount of culture from the well exhibiting color change and prepare a smear on a slide, labeling it with a number corresponding to the well position. Stain the slide with Giemsa stain and observe it under a microscope as described above.
  7. Transfer the contents of the well into a T25 flask where parasites were observed under the microscope. Allow the parasites to grow in the T25 flask for 4-5 days and replenish the media every other day.
  8. Once the parasitemia reaches 2-3%, extract 500 µL of parasite culture. Then, saponin-lyse the RBCs and proceed to extract parasite genetic material using the method described in section 11.
  9. To confirm the generation of clonal transgenic parasites, set up a PCR reaction as described above in step 1.1.1 and send the PCR product for DNA sequencing to confirm the introduction of the desired SNPs in the target locus.

13. Transcript analysis using Real-Time PCR

  1. Percoll/Sorbitol purification and synchronization of the parasites
    1. Prepare a Percoll/Sorbitol Gradient39,40 by sequentially layering 3 mL each of 70% followed by 40% solutions of percoll/sorbitol in a 15 mL conical tube.
    2. Gently layer 1-2 mL of parasite culture containing predominantly the schizont-stage parasite of WT and CDPK1 T145M on top of the gradient.
    3. Centrifuge the gradient at 2,300 x g for 15 min at RT using the deacceleration set to 4 in centrifuge in a swinging bucket rotor.
    4. Collect the middle ring containing trophozoite and schizont stages of the parasite from the interface of the gradient in a fresh 50 mL conical tube.
    5. Wash the parasites by adding an equal volume of 9:1 (cRPMI:10xPBS), then centrifuge at 994 x g for 3 min to pellet the parasites.
    6. Wash the pellet again with a solution of 19:1 (cRPMI:10xPBS), then centrifuge at 994 x g for 3 min.
    7. Add each parasite pellet to separate flasks containing cRPMI with 2% hematocrit (pre-incubated at 37 °C). Incubate the flasks for 4 h under conditions as described above in step 9.1 to allow the invasion of merozoites from the enriched schizonts into fresh RBCs.
    8. After 4 h, treat the parasites with sorbitol as described above in steps 9.2-9.4 to obtain highly synchronized 0 - 4 h ring stage parasites.
    9. Incubate the synchronized parasites for 44 h after the sorbitol treatment to obtain the 44 - 48 h schizont stage of the parasite.
  2. RNA isolation from schizonts of both WT and CDPK1 T145M parasites
    1. Harvest the WT and CDPK1 T145M parasites at 44-48 h post-invasion. Wash the parasite pellets with 1x PBS at 994 x g for 5 min at 4 °C.
    2. Resuspend the parasite pellets in 1 mL of 1x PBS and treat them with saponin to lyse the surrounding RBCs as described in step 11.2.1.
    3. Resuspend the parasite pellet in 1 mL of RNA extraction reagent and store at -80 °C until further processing.
    4. Thaw the frozen pellet at 15-30 °C for complete dissociation of nucleoprotein complexes.
    5. Add 200 µL of chloroform per mL of RNA extraction reagent and shake the tubes vigorously by hand for 15 s. Incubate at RT for 2-3 min.
    6. Centrifuge the mixture at 16,200 x g for 15 min at 4 °C. RNA will exclusively remain in the colorless upper aqueous layer. Isolate RNA using a kit according to the manufacturer's instructions.
  3. cDNA synthesis from the RNA of WT and CDPK1 T145M parasite
    1. Treat the RNA-containing samples with a DNA removal kit following the manufacturer's instructions to remove contaminating DNA.
    2. Synthesize cDNA from the isolated RNA samples using a cDNA Synthesis kit according to the manufacturer's protocol. We use random hexamer primers for the reverse transcription process instead of oligo-dT primers.
    3. Ensure NO-RT (reactions set up without adding the reverse transcriptase enzyme) controls for each RNA sample used for cDNA preparation to exclude the carryover of genomic DNA contamination from purified RNA during the cDNA preparation.
    4. Test the cDNA by amplifying any gene segment containing an intervening intronic sequence, such as the full-length cdpk1 gene, to rule out genomic DNA contamination. Use the PCR condition as described in step 1.1.1.
  4. Transcript expression analysis of WT and CDPK1 T145M parasite
    1. Use the cDNA prepared from the WT and CDPK1 T145M parasites to conduct transcript expression analysis of 11 different genes through real-time PCR. The 11 target genes include 7 members of the CDPK family and 4 kinases involved in the invasion of RBC (see Table 2 for genes and corresponding primers used for real-time PCR).
    2. Design primers using primer synthesis software. Amplify approximately 120 bp of each selected gene using gene-specific primers with similar melting temperatures.
    3. Amplify target genes using a pre-mix and run the plate on a real-time PCR system using the following cycling parameters: initial denaturation at 95 °C for 3 min followed by 40 cycles of denaturation at 95 °C for 10 s, annealing at 52 °C for 20 s and extension at 62 °C for 30 s.
    4. Normalize the expression level of each gene using two housekeeping genes, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and threonine tRNA ligase (ThrRS)32. Calculate the relative expression of each target kinase in the CDPK1 T145M parasite compared to the WT control.
    5. Perform the statistical analysis using the R statistical analysis package. Alternatively, use any other analysis software.
      NOTE: Global transcriptomics methods such as RNA-Seq or microarray are superior approaches for obtaining a broader view of transcriptome rewiring in mutant parasites compared to WT.

Results

Recombinant WT CDPK1 is expressed as a fusion protein with an N-terminal Glutathione S-transferase (GST) tag and purified using GST affinity chromatography. The purified CDPK1 protein was detected through Western blot using anti-CDPK1 and anti-GST antibodies (Figure 1). The threonine gatekeeper residue (T145) in WT CDPK1 was replaced with Met and Ser using site-directed mutagenesis to generate CDPK1T145M and CDPK1T145S mutant recombinant proteins, respectively (Figure 2). In vitro kinase assay was done to evaluate the kinase activity of all the recombinant CDPK1 proteins. The kinase activity was tested using a semisynthetic epitope tagging approach34 by detecting the thio-phosphate ester group using a specific antibody in a Western blot format (Figure 3). The impact of gatekeeper substitution on the autophosphorylation activity of CDPK1 and the transphosphorylation of MBP used as an exogenous substrate of CDPK1 was assessed by quantifying the intensity of the respective autophosphorylation and transphosphorylation bands. Mutant CDPK1 with methionine gatekeeper retained ~ 53% transphosphorylation activity, while the presence of a serine at the gatekeeper position led to complete abrogation of substrate transphosphorylation (Figure 3). SNPs leading to gatekeeper substitution from Thr to Met (T145M) were engineered in the endogenous cdpk1 locus through CRISPR-Cas9 using a two-plasmid system (Figure 4 and Figure 5). Mutant parasites with T145S substitution could not be generated, possibly due to the lethal effect of the Ser gatekeeper on CDPK1 activity. The CDPK1T145M mutant parasites were subcloned using the limiting dilution method, and the gatekeeper substitution was confirmed through Sanger sequencing to verify the generation of the CDPK1T145M mutant parasite. Transcript levels of 11 different kinases, including 7 members of the CDPK family and 4 other kinases involved in the late schizogonic development of the parasite, were tested using real-time PCR (Figure 6). The expression levels of 11 different kinases were compared between the CDPK1T145M mutant and wild-type (WT) parasites, normalized to the housekeeping genes. The transcript expression of CDPK family members was altered in the CDPK1T145M mutant compared to the WT parasite (Figure 6). Transcripts showing higher expression in the CDPK1T145M mutant may be compensating for the function of CDPK1 in the CDPK1T145M mutant parasite.

Western blot analysis of CDPK1 protein; anti-CDPK1/anti-GST antibody detection; protein size markers.
Figure 1: Characterization of full-length recombinant wild type (WT) PfCDPK1. Full-length WT CDPK1 protein fused with N-terminal Glutathione S transferase (GST) tag was purified by affinity chromatography and separated on 10% SDS-PAGE. CDPK1 migrated to the predicted molecular mass of ~ 87 kDa, as shown in the Coomassie Brilliant Blue R-250 stained polyacrylamide gel. Recombinant protein separated on the SDS-PAGE was transferred to a PVDF membrane and processed for Western blot analysis with anti-CDPK1 and anti-GST antibodies. Band corresponding to the full-length recombinant CDPK1 on SDS-PAGE was detected with both the antibodies, confirming the identity of the protein. Please click here to view a larger version of this figure.

Gene editing diagram: DNA sequence alignment(A), nucleotide substitution process(B), protein bands(C), blot analysis(D).
Figure 2: Characterization of purified recombinant CDPK1 gatekeeper mutant proteins. (A) Alignment of the primary amino acid sequence of TgCDPK1 and PfCDPK1 (Plasmodb accession no. PF3D7_0217500). Threonine at position 145 of PfCDPK1 corresponds to glycine 128, the gatekeeper position in TgCDPK1 (highlighted in red). (B) Cartoonist representation of Thr gatekeeper residue (highlighted in red) encoded by triplet codon ACC (black circle) in WT CDPK1. Substitution of the gatekeeper residue by site-directed mutagenesis to generate recombinant mutant CDPK1 proteins with Met (highlighted in yellow) in CDPKT145M and Ser (highlighted in blue) in CDPKT145S. (C) SDS-PAGE profile of recombinant WT and mutant proteins of CDPK1. The recombinant WT and gatekeeper mutant proteins were purified by GST affinity chromatography and separated on SDS-PAGE. All the recombinant proteins conform to the expected molecular weight of ~87 kDa. M- molecular weight ladder. (D) Characterization of recombinant CDPK1 WT and mutant proteins through Western blotting. The recombinant WT and gatekeeper mutant proteins of CDPK1 were separated on SDS-PAGE and transferred to the PVDF membrane for Western blotting. Bands corresponding to the full-length recombinant WT and mutant CDPK1 proteins on SDS-PAGE were detected with anti-CDPK1 and anti-GST antibodies, confirming the identity of all the recombinant proteins. Please click here to view a larger version of this figure.

Thio-phosphorylation diagram and Western blot analysis, CDPK1 kinase activity, Ca²⁺ dependency.
Figure 3: Gatekeeper substitution in CDPK1 leads to a decrease in the kinase activity of mutant enzymes. (A) Cartoonist representation of the semi-synthetic epitope tagging approach for detecting kinase activity of CDPK1 protein. Only transphosphorylation activity is depicted here. CDPK1 protein thiophosphorylates an exogenous substrate (S, solid green square) in the presence of ATPγS (solid yellow triangle), a source of transferable terminal thiophosphate group). The thiophosphorylated residue is alkylated by treatment with p-nitrobenzyl mesylate (PNBM), forming a thiophosphate ester that is then detected with an antibody that specifically recognizes alkylated thiophosphate adduct. (B) In vitro kinase activity assay using a semisynthetic epitope tagging approach was used to test the effect of gatekeeper substitution on the autophosphorylation and transphosphorylation potential of recombinant CDPK1 mutant proteins. All the recombinant proteins exhibit calcium-dependent kinase activity. Auto-phosphorylation of CDPK1 and trans-phosphorylation of myelin basic protein (MBP), an exogenous substrate, was evident only in the presence of calcium chloride (Ca2+), while no phosphorylation was detected in the presence of EGTA, a specific chelator of Ca2+ ions. The gatekeeper mutants show reduced autophosphorylation activity, while the transphosphorylation of MBP was completely abrogated in CDPK1T145S. CDPK1T145M retains transphosphorylation potential (~ 53 %) as reported earlier32. Please click here to view a larger version of this figure.

CRISPR gene editing diagram; process of guide sequence cloning for gene substitution in CDPK1 locus.
Figure 4: Construction of plasmids for introducing SNPs at gatekeeper position in cdpk1 locus using CRISPR-Cas9. A guide sequence of 20 nucleotides corresponding to 432 to 451 bp was cloned in the BtgZI restriction site in pL6eGFP plasmid to generate pL6CK1G. A homology arm (421 bp) incorporating the desired SNPs (T145M or T145S, corresponding codon shown in green) along with shield mutations (shown in red) was cloned in pL6CK1G within AflII and SpeI restriction enzyme sites to generate pL6CK1GT145M and pL6CK1GT145M, respectively. Shield mutations prevent the re-cutting of the modified locus after the desired editing. Cas9 endonuclease encoded in a second plasmid, pUF1 is directed to the target site within cdpk1 locus with the help of guide RNA expressed from pL6CK1GT145M/S plasmid. Cas9 introduces double strand break in the target site towards the 5' side of PAM sequence. The DSB is repaired using homology arm in the pL6CK1GT145M/S plasmid. Please click here to view a larger version of this figure.

Parasite transfection process diagram with electroporation, DNA analysis, and microscope visualization.
Figure 5: Schematic representation of P. falciparum transfection with CRISPR plasmids for the introduction of gatekeeper mutation (T145M) in cdpk1 locus. i) Asynchronous P. falciparum culture is sorbitol treated to obtain synchronized ring-stage parasites. ii) Synchronized ring-stage parasites are taken in an electroporation cuvette along with pL6CK1GT145M/S and pUF1 plasmids resuspended in buffer solution. iii) The parasites are electroporated at 310 volts, 950 µF, and infinite resistance. iv) Following transfection, the parasites are transferred into a T25 flask containing fresh complete RPMI medium (cRPMI) and cultured for 48 h. After 48 h, the transfected parasites are switched to cRPMI supplemented with the drugs WR99210 and DSM267 and expanded in the T75 flask. v) On day 14, slides are prepared and stained using Giemsa stain. vi) Subsequently, the blood smear is visualized under a light microscope to assess the presence of parasitized RBCs. vii) Upon visualization, the parasites are allowed to grow in the presence of drugs. Subsequently, the parasites are processed to obtain the template for PCR and DNA sequencing for verification of the desired modification of the target cdpk1 locus. viii) Subsequent to the verification, clonal transgenic parasites are obtained by setting up limiting dilution in a 96-well plate. ix) Clonal transgenic parasites from positive wells are transferred into T25 flasks and allowed to grow. x) Clonal transgenic parasites are further validated through PCR and presence of desired SNPs at the gatekeeper position through DNA sequencing and analysis of the chromatogram. The figure is modified from32. Please click here to view a larger version of this figure.

Plasmodium falciparum synchronicity process; purification, RNA isolation, qPCR; experimental diagram.
Figure 6: Schematic representation of the steps used for transcript analysis of target genes through real-time PCR (RT-PCR). i) P. falciparum culture with predominantly mature schizont stage parasites is obtained through sorbitol treatment in the same cycle. ii) The parasites are gently layered onto a gradient of 70/40 Percoll/sorbitol in a 15 mL conical tube for enrichment of mature schizont stage parasites. iii) The black-colored ring at the interphase of 40 % and 70 % personal/sorbitol is transferred to a fresh 50 mL tube, processed, and resuspended in cRPMI. The schizont-stage enriched parasites are incubated with fresh RBCs preincubated at 37 °C for invasion. iv) The parasites are cultured for 4 h and then treated with 5 % sorbitol to obtain highly synchronized 0-4 h ring stage parasites. v) The parasites are further cultured for an additional 44 h post-sorbitol treatment to obtain highly synchronized 44-48 h schizont stage parasites. vi) The synchronized parasites are treated with saponin to release them from the RBCs and stored in RNA extraction reagent. Total RNA is isolated from the RNA extraction resuspended parasites. vii) cDNA is prepared from the isolated RNA. viii) A real-time PCR experiment is set up with the cDNA template to amplify the target genes using gene-specific primers. The plate is run on a real-time PCR system. ix) The transcript expression data is analyzed using a analysis software. The graph represents differential transcript expression levels of 11 kinases in CDPK1 T145M parasites compared to the wild type (WT). This figure is modified from32. Please click here to view a larger version of this figure.

Gene namePrimer sequence
Pk1fpgexATGCGCGGATCCATGGGGTGTTCACAAAGTTCAAACG
Pk1rpgexATGCGCGCGCGGCCGCTTATGAAGATTTATTATCACAAATTTTGTGCATC
Ck1T145SGTTTGATGTTTTTGAAGATAAGAAATATTTTTATTTAGTAAGCGAATTTTATGAAGGTGGGGAA
Ck1T145S_antisenseTTCCCCACCTTCATAAAATTCGCTTACTAAATAAAAATATTTCTTATCTTCAAAAACATCAAAC
CK1T145MGTTTGATGTTTTTGAAGATAAGAAATATTTTTATTTAGTAATGGAATTTTATGAAGGTGGGGAA
Ck1T145M_antisenseTTCCCCACCTTCATAAAATTCCATTACTAAATAAAAATATTTCTTATCTTCAAAAACATCAAAC
Ck1GUIDEFWDTAAGTATATAATATTAACCGAATTTTATGAAGGTGGTTTTAGAGCTAGAA
Ck1GUIDEREVTTCTAGCTCTAAAACCACCTTCATAAAATTCGGTTAATATTATATACTTA
ck1f1 ATTTTCTTTTCTGAACGTGTAACATG
ck1r3wtTGCATCTCTTAATCTCTCCTCACTG

Table 1: List of Primers used in the study.

Gene NameForward PrimerReverse Primer
CDPK1 (PF3D7_0217500)GGAAGAATTAGCAAATTTATTTGGTTTGACATCATGTTAACGAATTCATCAAAGTCAATCATGT
CDPK2 (PF3D7_0610600)GGAACAGGAGAATTTACAACGACTGTATACATAATAACACCACTAGACCAG
CDPK3 (PF3D7_0310100)CACGAAATATTGAGCATGGTAAAGAAGGCAGCGTCCATTGTAAG
ACATCTTTTTATTAAATC
CDPK4 (PF3D7_0717500)ATACTTCTCTCAGGGTGCCCCTTATCACTAATTTTTTT
GAATTGTGGTAAATCG
CDPK5 (PF3D7_1337800)GGAGGTCGAAGATATGGATACGAATAGTATCGGCTAACGTACTCTTTGTCG
CDPK6 (PF3D7_1122800)CCTCCCGTAGATAAGAATATATTATCTATCGATCTGCTTCAATAAATCCCAATACATTTGC
CDPK7 (PF3D7_1123100)AGTCCTAAAAAAGATATA
TAAAGAACTAGGTAGTAG
TTTAAAAATAATCTTTCTCCCCACAACCC
PKA (PF3D7_0934800)   AATCATCCATTTTGTGTAAATTTACATGGCTTTTGTTTCTTCTTAAA
AATGTAAAAAATTCTCC
PKG (PF3D7_1436600)   AAAGGGAATGAAAGAAATAAAAAGAAGGCCATATCAATATCTTCTGAAAGCTTTTCCC
PKB (PF3D7_1246900)   CACAATAGAAGAAATGATGTTCTTTTTTACGGAGAGCGCAATTAGCCATATTG
PI3K (PF3D7_0515300)  CCCCTTCAATTTGTTTGTGAAACAGATCACATTTGTTATACTT
ATTATCATCACATTTGTT
GAPDH (PF3D7_1462800)GGAAGGAAAGATATCGAAGTAGGGGTTACCTCACATGG
ThrRS (PF3D7_1126000)CTTGGGAACTGCAGAGTAGAATTTTAAAAATCCTCCGAACAATTTTTCTAAACTAC 

Table 2: List of target genes (PlasmoDB identification number) along with the sequence of the primers used for the real-time PCR analysis.

Discussion

The generation of a mutant transgenic parasite containing a hypomorphic allele of cdpk1 is based on the in vitro kinase activity data with recombinant enzymes. It is better to generate as many mutant recombinant proteins with different gatekeeper residues as possible. Since the P. falciparum genome is highly AT-rich, therefore, expression of recombinant proteins in E. coli may require codon optimization. This will help in a comprehensive evaluation of gatekeeper substitution on the kinase activity of the mutant enzyme. Gatekeeper substitution that results in the reduction of the transphosphorylation potential is selected for generating an allelic exchange transgenic parasite. In parallel, a gatekeeper substitution that completely abrogates the transphosphorylation activity of the kinase should be taken as a negative control. Another important consideration while generating the allelic exchange parasite is to introduce a synonymous mutation along with the test mutation and the negative control. Generation of the parasite containing a synonymous mutation in the cdpk1 locus serves as an important internal control to rule out any technical errors while introducing the test mutation. Moreover, the transgenic parasite carrying synonymous mutation can be employed as a control for all the comparative studies instead of the WT parasite.

We have employed a two-plasmid system for generating the gatekeeper mutant parasite32,35. However, the efficiency of introducing the SNP in the target locus can be increased by using a single plasmid system instead of two-plasmid system41. In the single plasmid system, all the critical elements that are required for CRISPR-Cas9 mediated gene editing are incorporated in a single plasmid instead of two. The single plasmid encodes Cas9 endonuclease, transcribes sgRNA constituted of tracrRNA and the guide RNA, and contains a homology arm for the repair of the double-strand break introduced by the Cas9 endonuclease at the target site. In a two-plasmid system, the parasites are co-transfected with both plasmids. Since the number of parasites receiving both plasmids simultaneously in a two-plasmid system will be low compared to a single-plasmid system therefore, the efficiency of CRISPR-mediated gene editing is lower in a two-plasmid system compared to a single-plasmid system. Alternatively, a suicide-rescue strategy42 can also be employed wherein the homology arm is provided as a linear fragment or in a plasmid without a drug selection marker (rescue plasmid). The Cas9 endonuclease and the sgRNA encoding guide RNA are provided in a plasmid containing a drug selection cassette (suicide plasmid). Since a linear fragment or a plasmid without a drug selection cassette is more likely to be lost during parasite replication, the double-strand break introduced by the Cas9 endonuclease in the target locus must be readily repaired using the homology arm that can be available for a limited duration. This strategy has some advantages over a two-plasmid system since it is more efficient, and there is no need to sub-clone the homology arm in a different plasmid. Other variations of CRISPR-Cas9 gene editing may also be considered for introducing SNP in the target locus43.

We manually selected the guide region for introducing T145M substitution in the cdpk1 locus. An appropriate guide sequence for introducing double-strand break in target locus can be selected using various freely available online software such as Chopchop44, CRISPOR45, CCTop46, Cas-OFFinder47. These software, in addition to providing the efficiency of each guide sequence, also provides the off-target and specificity scores, which increase the success rate of a CRISPR-Cas9-mediated gene editing experiment.

There are different methods available for the transfection of malaria parasites. We use ring-stage parasites for transfection experiments48,49, however, pre-loading of RBCs with plasmids has also been used successfully for parasite transfection studies50. In this method, RBCs are transfected with plasmids under a specific set of parameters through electroporation and are subsequently used for infection with purified late-stage parasites. The parasites invade RBCs that are pre-loaded with plasmids. During their growth within the RBCs pre-loaded with plasmids, the parasite takes up plasmid DNA through an unknown mechanism50. There is another method that can be employed for parasite transfection that requires very mature purified schizont-stage parasites for direct transfection with the plasmids. The instrument used for the transfection of the purified schizonts is 4D-nucleofector51. The choice of a transfection method varies amongst different research groups depending on the available resources and success rate. It is a good idea to check which of the three methods work for a group and employ that for subsequent transfection experiments. Two methods may be applied consecutively to further increase the transfection efficiency. For instance, the first transfection step may employ ring-stage parasites followed by the addition of fresh RBCs pre-loaded with the plasmids.

We selected only a few genes for transcript analysis in the CDPK1T145M parasites compared to the control based on previous literature or the presence of members of the CDPK family. However, to get a comprehensive view of global transcriptional rewiring in the transgenic parasite containing a hypomorphic allele of CDPK1 approaches such as RNA-Seq or microarray may be employed.

The method used in this study can be applied to other kinases of the malaria parasite to understand the development of compensatory mechanisms under drug pressure. The information obtained through this technique may be useful in the strategic deployment of combination drugs to avoid the development and spread of drug resistance. Targeting two or multiple kinases that show functional complementation is a better strategy than targeting individual kinases for malaria control and elimination.

Disclosures

The authors have no conflict of interest.

Acknowledgements

We acknowledge the support and facilities available through the Central Instrumentation Facility, School of Life Sciences, JNU. Financial support from the Department of Biotechnology (BT/PR28256/MED/29/1313/2018) to AB is also gratefully acknowledged. We thank Jose-Juan Lopez-Rubio for providing pL6eGFP and pUF1 plasmids. The funding agency has no role in the preparation and decision to publish the work. MS is a recipient of JRF-SRF Fellowship from the Council for Scientific and Industrial Research.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
1x phosphate inhibitor cocktailSigma-Aldrich04906 845001
AflIINEBR0520S
Albumax II Gibco11021-037
Anti-GST antibodyThermoFisher ScientificG7781
Anti-Mouse HRPSigma-AldrichA4416
Anti-Rabbit HRPSigma-AldrichA6154
BamHINEBR3136S
BtgZ1NEBR0703S
CentrifugeThermoFisher ScientificSorvall legend micro 17R
Centrifuge ( For pelleting Bacterial cell)ThermoFisher ScientificSorvall ST 8R
Centrifuge ( For pelleting/processing parasite)ThermoFisher ScientificSorvall ST 8R (TX-400 rotor)
DpnINEBRO1765
D-Sorbitol Sigma-AldrichS1876
E. coli BLR(DE3) pLysS competent cellsSigma-Aldrich69956
E. coli DH5a Competent CellsTakara Bio9057
Electroporation Cuvettes, 0.2 cm gapBioRad1652086
ElectroporatorBioRadGenePulser Xcell
femtoLUCENTTM PLUS HRP chemiluminescent reagentG-Bioscience7860-003
GentamicinThermoFisher Scientific15750078
Giemsa StainHimediaS011-100ML
Glutathione Sepharose 4BGE Healthcare17075601
HEPES, Free AcidMerck391338
HypoxanthineMerck4010CBC
In-fusion HD cloning KitTakara Bio1711641A
iQ SYBR Green SupermixBioRad1708880EDU
MBP, dephosphorylated Merck13-110
NotINEBR3189S
Nucleobond Xtra Maxi EF  Takara Bio740424
NucleoSpin Gel and PCR clean-up Mini kitTakara Bio740609
PercollGE Healthcare17-0891-01
p-nitrobenzyl mesylate (PNBM)AbcamAb138910
Primestar Max DNA PolymeraseTakara BioR045A
Protease inhibitor cocktailRoche11836170001
Qiaprep Spin Miniprep Kit Qiagen27106
QuikChange II XL site-directed mutagenesis kitAgilent200521
RNeasy Mini kitQiagen74104
RPMI-1640ThermoFisher Scientific31800-105
SaponinSigma-Aldrich47036
Sodium BicarbonateSigma-AldrichS5761
SpeI-HFNEBR3133S
SuperScript III First-Strand Synthesis kitThermoFisher Scientific18080-051
T4 DNA LigaseThermoFisher Scientific15224017
Thiophosphate ester antibodyAbcamAb92570

References

  1. World Health Organization. World Malaria Report 2023. , World Health Organization. Geneva. (2023).
  2. Rosenthal, P. J., Asua, V., Conrad, M. D. Emergence, transmission dynamics and mechanisms of artemisinin partial resistance in malaria parasites in Africa. Nat Rev Microbiol. 22 (6), 373-384 (2024).
  3. Rosenthal, P. J., et al. The emergence of artemisinin partial resistance in Africa: how do we respond. Lancet Infect Dis. S1473-3099 (24), 00141-00145 (2024).
  4. Woodrow, C. J., White, N. J. The clinical impact of artemisinin resistance in Southeast Asia and the potential for future spread. FEMS Microbiol Rev. 41 (1), 34-48 (2017).
  5. Amaratunga, C., Witkowski, B., Khim, N., Menard, D., Fairhurst, R. M. Artemisinin resistance in Plasmodium falciparum. Lancet Infect Dis. 14 (6), 449-450 (2014).
  6. Sharma, M., et al. CDPKs: The critical decoders of calcium signal at various stages of malaria parasite development. Comput Struct Biotechnol J. 19, 5092-5107 (2021).
  7. Dvorin, J. D., et al. A plant-like kinase in Plasmodium falciparum regulates parasite egress from erythrocytes. Science. 328 (5980), 910-912 (2010).
  8. Absalon, S., et al. Calcium-dependent protein kinase 5 is required for release of Egress-specific organelles in Plasmodium falciparum. mBio. 9 (1), e00130-e00218 (2018).
  9. Kumar, P., et al. Regulation of Plasmodium falciparum development by calcium-dependent protein kinase 7 (PfCDPK7). J Biol Chem. 289 (29), 20386-20395 (2014).
  10. Kumar, S., et al. Plasmodium falciparum calcium-dependent protein kinase 4 is critical for male gametogenesis and transmission to the mosquito vector. mBio. 12 (6), e0257521(2021).
  11. Ojo, K. K., et al. A specific inhibitor of PfCDPK4 blocks malaria transmission: chemical-genetic validation. J Infect Dis. 209 (2), 275-284 (2014).
  12. Ojo, K. K., et al. Transmission of malaria to mosquitoes blocked by bumped kinase inhibitors. J Clin Inves. 122 (6), 2301-2305 (2012).
  13. Fang, H., et al. Multiple short windows of calcium-dependent protein kinase 4 activity coordinate distinct cell cycle events during Plasmodium gametogenesis. Elife. 6, e26524(2017).
  14. Green, J. L., et al. The motor complex of Plasmodium falciparum: phosphorylation by a calcium-dependent protein kinase. J Biol Chem. 283 (45), 30980-30989 (2008).
  15. Ekka, R., Gupta, A., Bhatnagar, S., Malhotra, P., Sharma, P. Phosphorylation of Rhoptry protein RhopH3 is critical for host cell invasion by the malaria parasite. mBio. 11 (5), e00166-e00220 (2020).
  16. Kumar, S., et al. PfCDPK1 mediated signaling in erythrocytic stages of Plasmodium falciparum. Nat Commun. 8 (1), 63(2017).
  17. Bansal, A., et al. Characterization of Plasmodium falciparum calcium-dependent protein kinase 1 (PfCDPK1) and its role in microneme secretion during erythrocyte invasion. J Biol Chem. 288 (3), 1590-1602 (2013).
  18. Iyer, G. R., et al. Calcium-dependent phosphorylation of Plasmodium falciparum serine repeat antigen 5 triggers merozoite egress. J Biol Chem. 293 (25), 9736-9746 (2018).
  19. Alam, M. M., et al. Phosphoproteomics reveals malaria parasite Protein Kinase G as a signalling hub regulating egress and invasion. Nat Commun. 6, 7285(2015).
  20. More, K. R., et al. Phosphorylation-dependent assembly of a 14-3-3 mediated signaling complex during red blood cell invasion by Plasmodium falciparum merozoites. mBio. 11 (4), e01287-e01320 (2020).
  21. Bansal, A., et al. PfCDPK1 is critical for malaria parasite gametogenesis and mosquito infection. Proc Natl Acad Sci U S A. 115 (4), 774-779 (2018).
  22. Hengeveld, R. C., et al. Development of a chemical genetic approach for human aurora B kinase identifies novel substrates of the chromosomal passenger complex. Mol Cell Proteomics. 11 (5), 47-59 (2012).
  23. Bishop, A. C., et al. Design of allele-specific inhibitors to probe protein kinase signaling. Curr Biol. 8 (5), 257-266 (1998).
  24. Alaimo, P. J., Knight, Z. A., Shokat, K. M. Targeting the gatekeeper residue in phosphoinositide 3-kinases. Bioorg Med Chem. 13 (8), 2825-2836 (2005).
  25. Zhang, C., et al. A second-site suppressor strategy for chemical genetic analysis of diverse protein kinases. Nat Methods. 2 (6), 435-441 (2005).
  26. Ojo, K. K., et al. Toxoplasma gondii calcium-dependent protein kinase 1 is a target for selective kinase inhibitors. Nat Struct Mol Biol. 17 (5), 602-607 (2010).
  27. Lourido, S., et al. Calcium-dependent protein kinase 1 is an essential regulator of exocytosis in Toxoplasma. Nature. 465 (7296), 359-362 (2010).
  28. Rutaganira, F. U., et al. Inhibition of calcium dependent protein kinase 1 (CDPK1) by Pyrazolopyrimidine analogs decreases establishment and reoccurrence of central nervous system disease by Toxoplasma gondii. J Med Chem. 60 (24), 9976-9989 (2017).
  29. Lourido, S., et al. Optimizing small molecule inhibitors of calcium-dependent protein kinase 1 to prevent infection by Toxoplasma gondii. J Med Chem. 56 (7), 3068-3077 (2013).
  30. McRobert, L., et al. Gametogenesis in malaria parasites is mediated by the cGMP-dependent protein kinase. PLoS Biol. 6 (6), e139(2008).
  31. Taylor, H. M., et al. The malaria parasite cyclic GMP-dependent protein kinase plays a central role in blood-stage schizogony. Eukaryot Cell. 9 (1), 37-45 (2010).
  32. Bansal, A., et al. Reduced activity of mutant calcium-dependent protein kinase 1 is compensated in Plasmodium falciparum through the action of protein kinase G. mBio. 7 (6), e02011-e02016 (2016).
  33. Bansal, A., Molina-Cruz, A., Brzostowski, J., Mu, J., Miller, L. H. Plasmodium falciparum calcium-dependent protein kinase 2 is critical for male gametocyte exflagellation but not essential for asexual proliferation. mBio. 8 (5), e01656-e01717 (2017).
  34. Allen, J. J., et al. A semisynthetic epitope for kinase substrates. Nat Methods. 4 (6), 511-516 (2007).
  35. Ghorbal, M., et al. Genome editing in the human malaria parasite Plasmodium falciparum using the CRISPR-Cas9 system. Nat Biotechnol. 32 (8), 819-821 (2014).
  36. Trager, W., Jensen, J. B. Human malaria parasites in continuous culture. Science. 193 (4254), 673-675 (1976).
  37. van den Hoff, M. J., Moorman, A. F., Lamers, W. H. Electroporation in 'intracellular' buffer increases cell survival. Nucleic Acids Res. 20 (11), 2902(1992).
  38. Coteron, J. M., et al. Structure-guided lead optimization of triazolopyrimidine-ring substituents identifies potent Plasmodium falciparum dihydroorotate dehydrogenase inhibitors with clinical candidate potential. J Med Chem. 54 (15), 5540-5561 (2011).
  39. Krugliak, M., Ginsburg, H. The evolution of the new permeability pathways in Plasmodium falciparum--infected erythrocytes--a kinetic analysis. Exp Parasitol. 114 (4), 253-258 (2006).
  40. Ginsburg, H., Landau, I., Baccam, D., Mazier, D. Fractionation of mouse malarious blood according to parasite developmental stage, using a Percoll-sorbitol gradient. Ann Parasitol Hum Comp. 62 (5), 418-425 (1987).
  41. Zhang, W. W., Lypaczewski, P., Matlashewski, G. Optimized CRISPR-Cas9 genome editing for Leishmania and its use to target a multigene family, induce chromosomal translocation, and study DNA break repair mechanisms. mSphere. 2 (1), e00340-e00416 (2017).
  42. Lu, J., et al. A redesigned CRISPR/Cas9 system for marker-free genome editing in Plasmodium falciparum. Parasit Vectors. 9, 198(2016).
  43. Sharma, M., Bansal, A. CRISPR: a revolutionary tool for genome engineering in the protozoan parasites. , Genome Engineering via CRISPR-Cas9 System, Academic Press. (2020).
  44. Montague, T. G., Cruz, J. M., Gagnon, J. A., Church, G. M., Valen, E. CHOPCHOP: a CRISPR/Cas9 and TALEN web tool for genome editing. Nucleic Acids Res. 42 (Web Server issue), W401-W407 (2014).
  45. Haeussler, M., et al. Evaluation of off-target and on-target scoring algorithms and integration into the guide RNA selection tool CRISPOR. Genome Biol. 17, 148(2016).
  46. Stemmer, M., Thumberger, T., Del Sol Keyer, M., Wittbrodt, J., Mateo, J. L. CCTop: An intuitive, flexible and reliable CRISPR/Cas9 target prediction tool. PLoS One. 10 (4), e0124633(2015).
  47. Bae, S., Park, J., Kim, J. S. Cas-OFFinder: a fast and versatile algorithm that searches for potential off-target sites of Cas9 RNA-guided endonucleases. Bioinformatics. 30 (10), 1473-1475 (2014).
  48. Wu, Y., Sifri, C. D., Lei, H. H., Su, X. Z., Wellems, T. E. Transfection of Plasmodium falciparum within human red blood cells. Proc Natl Acad Sci U S A. 92 (4), 973-977 (1995).
  49. Fidock, D. A., Wellems, T. E. Transformation with human dihydrofolate reductase renders malaria parasites insensitive to WR99210 but does not affect the intrinsic activity of proguanil. Proc Natl Acad Sci U S A. 94 (20), 10931-10936 (1997).
  50. Deitsch, K., Driskill, C., Wellems, T. Transformation of malaria parasites by the spontaneous uptake and expression of DNA from human erythrocytes. Nucleic Acids Res. 29 (3), 850-853 (2001).
  51. Moon, R. W., et al. Adaptation of the genetically tractable malaria pathogen Plasmodium knowlesi to continuous culture in human erythrocytes. Proc Natl Acad Sci U S A. 110 (2), 531-536 (2013).

Reprints and Permissions

Tags

Protein KinasesCDPK FamilyChemical GeneticsCRISPR-Cas9 EditingDrug ResistanceKinase InhibitionTranscriptional Rewiring