Method Article

Visualization of Neutrophil Extracellular Traps in Mesenteric Venules After Mesenteric Ischemia-Reperfusion Injury via Intravital Microscopy

1.2K views

DOI:

10.3791/67264

September 27th, 2024

* These authors contributed equally

In This Article

Summary

This protocol presents a method for inducing mesenteric ischemia-reperfusion injury and visualizing neutrophil extracellular traps (NETs) in mesenteric venules using intravital microscopy. Blood flow in the superior mesenteric artery was restricted for 1 h, followed by reperfusion, allowing direct quantification of leukocyte adhesion and NETosis.

Abstract

Intestinal ischemia-reperfusion (I/R) injury is an acute condition characterized by tissue damage resulting from restricted blood flow to the mesenteric vessels, leading to both local and systemic pathologies with a poor prognosis. Both ischemia and reperfusion trigger a series of cellular and molecular responses, with inflammatory cells serving as key regulators of the pathology. These interactions with the ischemic endothelium are mediated by multiple adhesion receptors. Several animal models have been established to mimic this pathology and investigate the involved molecular pathways. In this study, a microsurgical model of I/R injury is combined with intravital microscopy to visualize leukocyte rolling, adhesion, and neutrophil extracellular trap (NET) formation. This model is applied to transgenic mice deficient in endothelial PAR1 (F2r) to assess the impact of PAR1 on leukocyte rolling and NET formation 1 h after ischemia and immediately following reperfusion. In vivo, Acridine Orange leukocyte staining was employed, and NETs were visualized using a nucleic acid stain. Interestingly, reduced leukocyte adhesion and NET formation were observed in mice lacking the endothelial PAR1 receptor. This model enables the in vivo analysis of key regulators involved in I/R injury.

Introduction

Acute mesenteric ischemia (AMI) is a rare pathology1 with a high mortality risk2, characterized by reduced blood flow in the mesentery due to thrombi in the celiac axis, or the superior or inferior mesenteric artery. In 60%-70% of the cases, acute occlusions of the superior mesenteric artery due to thrombosis or embolization are responsible for acute bowel ischemia3. In contrast, in 5-15% of cases, mesenteric venous thrombosis accounts for mesenteric ischemia involving the superior mesenteric vein and, more rarely, the inferior mesenteric vein4. The hypoxia and malnutrition arising from ischemia lead to energy metabolism disorders at the cellular level5. For instance, impaired mitochondrial function activates multiple signaling pathways, initiating cellular death mechanisms6. Although rapid reperfusion enables the restoration of aerobic metabolism, the restoration of blood flow to an ischemic region often causes extensive tissue injury due to reactive oxygen species (ROS) production7, calcium overload8, endothelial dysfunction9, and inflammatory responses10.

Many experimental animal models employing temporary vascular occlusion of the superior mesenteric artery have been established to elucidate the molecular mechanisms during ischemia-reperfusion (I/R) injury11. The use of such models in combination with intravital microscopy (IVM) is fundamental for gaining insights into the underlying cellular interactions and disease progression11. Gut barrier dysfunction is observed shortly after ischemia12, with the epithelium losing its integrity13, resulting in bacterial translocation to extraintestinal sites such as the mesenteric lymph nodes, spleen, liver, and kidney12,14. Reperfusion further aggravates the mucosal injury15. An inflammatory response in the arterioles is manifested by the rolling and firm adhesion of leukocytes on the endothelial cell layer, which is dependent on molecules such as L-selectin16, P-selectin (CD62P)17, platelet GPIIb/IIIa, and fibrinogen18. Interestingly, leukocyte adhesion to mesenteric venules is influenced by the presence of gut microbiota19 and Toll-like receptor 4 signaling10. I/R injury also triggers neutrophil extracellular trap (NET) formation10. Therapeutic targeting of the extracellular DNA, originating from activated leukocytes such as neutrophils, improves the outcome of intestinal I/R injury20. In the liver, I/R injury is ignited by resident microphages21, and microRNA inhibition notably attenuates apoptosis22. Of note, I/R injury in the mesentery results in gut dysbiosis, which is reversible and resolved after revascularization23.

The endothelium is also influenced by the damaging effects of I/R injury, with ROS playing a pivotal role in the process24. Leukocyte adhesion to the endothelial cell layer, endothelial damage, and alterations of nitric oxide (NO) metabolism are observed9. However, the molecular pathways involved have not yet been fully explored.

Protease-activated receptor 1 (PAR1, F2r), is a membrane receptor expressed by a variety of cells, including endothelial cells, and is activated during inflammatory conditions25. Its activation occurs when serine proteases cleave the receptor at the N-terminus, exposing the tethered ligand that, in turn, activates the receptor by binding to the second extracellular loop of the molecule26. The endothelial protein C receptor (EPCR)-PAR1 signaling pathway impacts endothelial NO homeostasis and facilitates the restoration of blood flow in peripheral ischemia27.

In this study, I/R injury was applied to a genetic mouse model characterized by endothelial cell-specific PAR1 deficiency to visualize leukocyte rolling, adhesion, and NET formation. The combination of a genetic mouse model and intravital microscopy after I/R microsurgery provides valuable insights by highlighting the specific cell types involved in the disease progression. Applying I/R injury to genetic mouse models is instrumental in identifying potential therapeutic targets that can be used to improve the course of the disease. Moreover, the significance of endothelial PAR1 in NETosis was shown.

Protocol

All procedures involving mice were approved by the local committee on the legislation of animals (Landesuntersuchungsamt Rheinland-Pfalz, Koblenz, Germany; G21-1-041). 6-8 week-old male and female B6.FVB-F2rtm1a(EUCOMM) Tg/Cdh5-cre)7Mlia/Tarc mice were used for the study. The endothelial cell-specific regulation of F2r (PAR1) occurs via the VE-Cadherin Cre promoter28. In this study, flox-F2r x VE-Cadherin Cre+ (F2RΔEC) exhibited reduced F2r (PAR1) expression on endothelial cells, and flox-F2r x VE-Cadherin Cre- (WT) express normal endothelial F2r (PAR1) levels. The details of the reagents and the equipment used in this study are listed in the Table of Materials.

1. Preparation for the surgery

  1. Sterilize the necessary surgical instruments (extra narrow scissors straight, forceps, vascular clamp, etc.).
  2. Prepare the oxygen and isoflurane-based anesthesia system with a nose cone and a heating plate.

2. Animal preparation

  1. Weigh the animal.
  2. Perform anesthesia: Anesthetize mice via intraperitoneal (i.p.) injection of a solution containing midazolam (5 mg/kg), medetomidine (0.5 mg/mL), and fentanyl (0.5 mg/kg) (following institutionally approved protocols).
  3. Remove hair from the neck and abdomen operation area with an electric shaver for small animals.
  4. Position the mouse in dorsal recumbency on the heating pad and connect it to the oxygen system via a nose cone. Secure limbs of the mouse to a heated pad with surgical tape. Ensure that the latex nose cone membrane fits firmly over the head of the mouse. Monitor the animal's body temperature rectally using a rodent-specific thermometer.
  5. Apply hair removal cream to remove any remaining hair from the neck surgical area and wipe the skin of the operation area with 70% ethanol.
  6. Perform a toe pinch test (pedal reflex) to ensure that the animal is fully anesthetized.

3. Surgical procedure

  1. Catheter implantation in the jugular vein
    1. Make a transverse incision (~0.5 cm) over the trachea, remove the skin covering the neck, and isolate the right jugular vein.
    2. Use a silk thread of about 5 cm, close the distal end of the vein, and fix it with surgical forceps. Place three silk threads about 2 cm below the vein: one close to the distal end and two close to the proximal end of the jugular vein. Tie a surgical knot, but do not close the vessel.
    3. Prepare a polyethylene catheter (0.28 mm ID, 0.61 mm OD) filled with 0.9% NaCl and plugged with a 1 mL syringe. Use scissors to cut a hole between the second and third knots and implant the catheter into the jugular vein. Aspirate the syringe to ensure that blood is present in the catheter.
    4. Fix the catheter in the vein by tying the silk thread, ensuring it is securely fastened. Use medical tape to secure the syringe.
    5. Prepare Acridine orange: dilute 1:4 a 2 mg/mL stock solution with sterile saline (0.5 mg/mL final concentration) in a 1 mL syringe. Keep the syringe in the dark and inject 50 µL in the mouse.
    6. Prepare nucleic acid dye: dilute 1:1000 a 5 mM stock solution with sterile saline (5 µM final concentration) in a 1 mL syringe. Keep the syringe in the dark and inject 50 µL in the mouse.
    7. Inject in vivo Acridine orange (50 µg/µL, 50 µL per mouse) via the jugular vein catheter to visualize stained leukocytes and an extracellular DNA fluorescent dye similarly to stain neutrophil extracellular traps (NETs) (5 µM, 50 µL per mouse). NETs and leukocytes are imaged simultaneously.
  2. Mesenteric I/R injury model
    1. Disinfect the abdominal skin with 70% ethanol.
    2. Perform a 3-5 cm laparotomy along the linea alba using surgical scissors.
    3. Using two saline-moistened cotton tips, gently remove the intestine and identify a location with minimal fat coverage. Position small intestinal branches on a black dough to reduce the background signal.
    4. Acquire the videos before I/R (pre ischemia).
    5. Make a compress moisture with NaCl and place the intestine in it. Ensure that the intestine is surrounded by the compress and maintained moisture during step 5.6.
    6. Occlude the superior mesenteric artery with a small vascular clamp.
    7. Gently push the intestine back into the abdominal cavity using saline-moistened cotton swabs, and use a 7-0 suture to close the abdominal wall to prevent loss of moisture and temperature. Maintain ischemia for 60 min, checking anesthesia at least every 20 min.
    8. After 1 h, initiate reperfusion by removing the clamp.
      NOTE: Proper execution of the ischemia procedure results in a visible change. Initially, the affected area will appear pale or white due to the lack of blood flow. Upon removal of the clamp, blood flow will gradually return to the ischemic region, which will regain its normal color, signifying successful occlusion. It is imperative to closely observe the mouse continuously throughout the ischemia stage.
    9. Following the ischemic period, apply a few drops of saline to the clipped area, then gently remove the microvascular clips using a clip applier.
    10. Using saline-moistened cotton tips, gently remove the intestine again, position the small branches of the vein on a black dough, inject 50 µL of Acridine orange again, and capture the videos of the same vein in the same location (post-ischemia).

4. Intravital high-speed video epifluorescence microscopy

  1. Visualize leukocytes and NETs with a high-speed wide-field fluorescence microscope equipped with a long-distance condenser, a monochromator, a 10x water immersion objective, and a charge-coupled device camera. The image acquisition was performed with a 30 ms exposure time and Alexa Fluor 488(495/519) and Rhodamine Red (570/590) filters.
  2. Use imaging software for image acquisition and analysis.
  3. Quantify cell recruitment within a 0.06 mm² region of interest.
  4. Quantify adherent leukocytes as cells remaining stationary or attached to the endothelial lining for a 20 s observation period.
  5. Identify NETs as extracellular structures labeled with both leukocyte and extracellular nucleic acid fluorescent dyes.
  6. Euthanize animals by cervical dislocation at the end of the experiment (following institutionally approved protocols).

5. Liver endothelial cell (LEC) isolation and quantitative RT-PCR

  1. Isolate LECs via magnetic cell sorting (MACS)29.
  2. Isolate total RNA.
  3. Perform complementary DNA (cDNA) synthesis27 by mixing 2 µg of total RNA with 2 µL of RT Buffer, 0.8 µL of dNTP Mix, 2 µL of RT Random Primers, 1 µL of Reverse Transcriptase, and 4.2 µL sterile distilled H2O.
  4. cDNA transcription was performed applying the following conditions: 25 °C for 10 min, 37 °C for 120 min, 85 °C for 5 min.
  5. Use 20 ng of cDNA for qPCR.
  6. Use the following primers: F2r (forward): TGAACCCCCGCTCATTCTTTC, F2r (reverse): CCAGCAGGACGCTTTCATTTTT, L32 (forward): CCTCTGGTGAAGCCCAAGATC, L32 (reverse): TCTGGGTTTCCGCCAGTTT. Use the following conditions: 95 °C 30 s, 45 cycles of (95 °C for 10 s, 60 °C for 25 s), 60 °C to 95 °C for 6 s with ΔΤ 1 °C.

Results

To study the endothelial cell-dependent effects on leukocyte rolling and adhesion as well as on NET formation, initially, the efficacy of the VE-Cadherin Cre inducible F2r-deficiency was examined in endothelial cells. Magnetic cell sorting was employed to isolate hepatic endothelial cells. Subsequently, RNA was isolated, followed by quantitative real-time PCR (qRT-PCR). The F2rΔEC mice, in which the Cre recombinase expressed under the control of the VE-Cadherin promoter is absent, showed significantly reduced F2r (PAR1) mRNA levels (approx. by one-third) compared to WT controls (Figure 1).

After confirming the deficiency in the mouse line, mesenteric I/R injury was performed to examine the impact of PAR1 expressed by vascular endothelial cells on leukocyte rolling and adhesion, visualized by intravital microscopy (Figure 2A,B). After 1 h of ischemia, the clamp was removed, and the vessel was allowed to reperfuse. Leukocyte rolling and adhesion were observed and recorded (stained green, indicated by white arrows). Although both groups showed increased numbers of adherent leukocytes after I/R injury, the deficiency of endothelial F2r (PAR1) resulted in a markedly but not significantly decreased leukocyte adhesion to the I/R-activated mesenteric endothelium, suggesting an active role of endothelial PAR1 activation in leukocyte recruitment to the ischemic mesenteric venules (Figure 2C).

The next objective was to examine whether endothelial PAR1 expression regulates I/R injury-induced NET formation. Therefore, extracellular nucleic acids were stained with a cell-impermeable dye30, and visualized the generated NETs using intravital microscopy (indicated by black arrows) (Figure 2A,B). After I/R injury, NETs were observed only in the WT group expressing normal levels of PAR1 on the endothelial cells, indicating a regulatory role of PAR1 in NETosis (Figure 2C,D). Notably, when endothelial F2r expression was suppressed, no NETs were present in the I/R-injured mesenteric venules.

F2r mRNA expression graph; WT vs F2rΔEC, relative to L32; statistical significance marked.
Figure 1: F2r (PAR1) mRNA expression. F2r liver endothelial cell expression of WT (n = 6) and F2rΔEC (n = 9) mice relative to the L32 housekeeping gene. Data are presented as a median with a 95% confidence interval. The Mann-Whitney test was used to compare two independent groups, *p < 0.05. Please click here to view a larger version of this figure.

Leukocyte adhesion, NETosis results in microscopy image and bar chart for WT, F2rΔEC pre/post-exposure.
Figure 2: Endothelial PAR1 affects leukocyte adhesion and NET formation in I/R-injured mesenteric venules. Representative intravital microscopy images of adhering leukocytes stained with Acridine orange (white arrows) and NETs stained with Sytox Orange (black arrows) of WT and F2rΔEC mice before (pre) and after (post) I/R injury (A) 10x and (B) 20x magnification. Scale bars: A, 50 µm; B, 20 µm. (C) Leukocyte adhesion and (D) NETs per mm2 of WT (n = 7) and F2rΔEC (n = 4) mice before (pre) and after (post) I/R injury. All data were represented as median with a 95% confidence interval. Statistical comparisons were performed using the Two-way ANOVA test, **p< 0.01, and Sídák's multiple comparison tests to compare the means of different genotypes in every time point (pre and post-ischemia). Please click here to view a larger version of this figure.

Discussion

The mesenteric I/R injury combined with intravital microscopy was applied to a genetic mouse model of F2r (PAR1) deficiency in endothelial cells for the in vivo analysis of leukocytes and NETs after 1 h of ischemia. The mesenteric I/R injury model is frequently used in rodents with both ischemia and reperfusion times varying from minutes to several hours23,31, influencing the inflammatory outcome32 and mortality33. The model also depends on several factors, including microbiota19,34, immune receptors10,35,36,37, sex38,39, and age35. Aside from varying I/R times, another variable in this model is the differential response of different parts of the intestine to injury, with the small intestine showing greater mucosal damage than the colon40. The positioning of the microvascular clip affecting the ischemic region is crucial for the reproducibility of the method32,33. Importantly, superior mesenteric artery occlusion combined with collateral flow interruption yields mortality rates that are consistently related to the duration of ischemia41.

In this study, mice were subjected to 1 h of ischemia, and in vivo leukocyte adhesion and NET formation were visualized immediately after reperfusion to examine the early inflammatory response triggered by the ischemic state in the absence of endothelial F2r expression. Applying these methods to genetic mouse models allows for the investigation of how certain target molecules affect cellular behavior and the inflammatory response both after ischemia and during reperfusion.

There are several critical steps in the protocol, including the maintenance of intestinal integrity. Handling the intestine must be done gently to avoid tissue damage. For this purpose, moist cotton swabs are the appropriate tool for temporarily detaching the intestine from the abdominal cavity. It is crucial that the intestine remains moist until it is repositioned in the abdomen. Minor handling injuries can trigger the activation of various cell types, such as platelets and endothelial cells, which can affect the results.

For consistency, it is crucial to visualize the same site of intestinal segments before and after ischemia. This can be challenging because the intestine is repositioned in the abdominal cavity after ischemia. To address this issue, one approach is to place a small piece of moist compress on the part of the gut that was visualized before ischemia.

To visualize leukocyte rolling and adhesion as well as NET formation in vivo, mice were injected with both a leukocyte and a nucleic acid fluorescence dye via the jugular vein. The leukocyte dye (see Table of Materials) is a cell-permeable metachromatic fluorescence dye that binds to white blood cells but not red blood cells and has been widely used for staining leukocytes in vivo17,42. The dye is applied intravenously and provides strong leukocyte staining within seconds. However, specificity can be a limitation as it also stains other nucleated cells, such as endothelial cells. Nonetheless, circulatory cells retain the staining longer due to a washout effect43. The nucleic acid fluorescence dye (see Table of Materials) is a cell-impermeable nucleic acid stain commonly used to visualize NET formation30,44,45. It can also be applied intravenously, binds with high affinity, and is quick and easy to use. Again, specificity is a drawback as the dye will bind to any cell with a non-intact membrane. Ideally, it should be combined with a neutrophil marker (e.g., CD15, CD11b) or a NETosis marker (e.g., anti-citH3 antibodies) to enhance specificity. These dyes enable in vivo imaging of leukocytes in the mesenteric venules of laboratory animals.

The major limitation of the technique is the presence of visceral fat, which restricts the visualization of intestinal capillaries and greatly hampers image acquisition. To avoid this complication, it is necessary to use young experimental animals (6-8 weeks old) that have reduced visceral fat formation. Additionally, ex vivo histological analysis is hampered by the use of in vivo staining. Another limitation is the impact of the gut microbiota and diet on this model, which may vary strongly between different mouse husbandries46. To address this limitation, the study of gnotobiotic mouse models could be considered10.

In this study, the immediate cellular response was investigated after ischemia, and reduced leukocyte deposition to the activated mesenteric endothelium and NET formation was observed in vivo. NET degradation by intravenous administration of DNase 1 h after ischemia reduces the early proinflammatory response and ameliorates the gut barrier disruption47. Of note, treatment with thrombomodulin, a transmembrane glycoprotein that inhibits thrombin activity48, improved the survival of mice with severe intestinal I/R injury, attenuating the inflammatory response of endothelial dysfunction and reducing the intense histone accumulation in remote organs49. Here, the endothelial thrombin receptor was shown to influence the I/R outcome, highlighting the significance of combining the intestinal I/R injury model with intravital microscopy in genetically engineered mice to investigate important mediators of the disease pathology.

Disclosures

The authors disclose no conflict of interest.

Acknowledgements

C.R. acknowledges funding from the Forschungsinitiative Rheinland-Pfalz and ReALity (project MORE), the BMBF Cluster4Future CurATime (project MicrobAIome; 03ZU1202CA), the Wilhelm Sander-Stiftung (Nr. 2022.131.1), and the Deutsche Zentren der Gesundheitsforschung (DZG) Innovation Fund "Microbiome" (81X2210129). C.R. is a scientist at the German Center for Cardiovascular Research (DZHK). C.R. is a member of the Center for Translational Vascular Biology (CTVB), the Research Center for Immunotherapy (FZI), and the Potentialbereich EXPOHEALTH at the Johannes Gutenberg-University Mainz. C.R. is a member of the DFG Research Unit 5644 INFINITE (RE 3450/15-1). C.R. was awarded a Fellowship from the Gutenberg Research College at the Johannes Gutenberg-University Mainz. K.K. is supported by the DZHK "Promotion of Women Scientists" Excellence Programme and is a member of Young DZHK. Z.G and O.D. are PhD students at the Mainz Research School of Translational Biomedicine (TransMed).

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
Acridine orangeSigma-Aldrich  A-6014
96-well plate Multiply PCR-Platten Sarstedt721977202.00
Anaesthesia Systems for RodentsGROPPLER medizintechnikUni Vet -Porta T-8
Aqua ad injectabilia IVMB Braun Melsungen53402101
black doughStaedtlermodelling clay
CD146 Microbeads, mouseMiltenyi Biotec130-092-007
cellSensOlympusOlympus cellSense Dimension Desktop 2.3software
charge-coupled device cameraHamamatsu PhotonicsORCA-R2camera
cotton swabsBöttger09-119-9100
Curved Hemostat 125mm/5"Indigo Instruments 22466
Depilatory creamBaleanot applicable
Dorbene Vetzoetis
Dumont ForcepsFine Science Tools11251-35
Ethanol p.a. 99,5 %Roth5504.20
Extra Narrow Scissors – Straight/Sharp-Sharp/10.5FST14088-10
FentanylJanssen-Cilag GmBH
Forceps "Dumont #5" (Inox, tip 0.1mm, length 11 cm)FST11251-20
GentleMACS C TubesMiltenyi Biotec130-093-236
GraphpadprismGraphpadPrism 10software
isoflurane Piramal4150097146757.00
iTaq UniversalSYBR Green Supermix 10x5mlBioRad1725125.00
Leukofix medical tapeBSNMedical0213600
Liver Dissociation Kit, mouseMiltenyi Biotec130-105-807
LS-Separation columns MACSMiltenyi Biotec130-042-401
MACS Smart Strainer 100 µmMiltenyi Biotec130-098-463
Microseal B Seal SealsBioradMSB1001
Midazolamhameln5918501.00
NaClBraun2350748
Needle holderFST12001-13
Nonabsorbable Braided Silk Suture, Size: 7/0, 91 Meters Fine Science Tools18020-70
Olympus BX51WI fluorescence microscopeOlympusmicroscope
PCR for Tube StripsSarstedt72985002.00
PCR Tube LidsSarstedt65989002.00
Plyethylene CatheterSmith Medical Deutschland GmbH800/100/100
Prolene (8648G), Polypropylen 6-0, Nahtmaterial Johnson & Johnson Medical GmbH 8695H
Relia Prep RNA Miniprep SystemsPromegaZ6112
Reverse Tanscription Kit (High Capacity cDNA)Applied Biosystems4368813.00
School scale KERN & SOHN GmbHEMB 500-1
Spring Scissors - Angled to SideFST15006-09
Stereo microscopeLeicaM50
Straight Hemostats 135mm/5.5"Indigo Instruments 22468
Syringe 1 mLBraun9166017V
SYTOX OrangeThermo Fisher ScientificS11368
Temperature Controller TC-1000FMI Föhr Medical Instruments GmbHnot applicable
Tissue Forceps - 1x2 TeethFST18057-14
vascular clampFine Science Tools18055-02
Vetiva miniWAHL1584-0480

References

  1. Cudnik, M. T., et al. The diagnosis of acute mesenteric ischemia: A systematic review and meta-analysis. Acad Emerg Med. 20 (11), 1087-1100 (2013).
  2. Kassahun, W. T., Schulz, T., Richter, O., Hauss, J. Unchanged high mortality rates from acute occlusive intestinal ischemia: Six-year review. Langenbecks Arch Surg. 393 (2), 163-171 (2008).
  3. Florim, S., Almeida, A., Rocha, D., Portugal, P. Acute mesenteric ischemia: A pictorial review. Insights Imaging. 9 (5), 673-682 (2018).
  4. Kumar, S., Sarr, M. G., Kamath, P. S. Mesenteric venous thrombosis. N Engl J Med. 345 (23), 1683-1688 (2001).
  5. Dugbartey, G. J. Cellular and molecular mechanisms of cell damage and cell death in ischemia-reperfusion injury in organ transplantation. Mol Biol Rep. 51 (1), 473(2024).
  6. Ikeda, H., et al. Apoptosis is a major mode of cell death caused by ischemia and ischemia/reperfusion injury to the rat intestinal epithelium. Gut. 42 (4), 530-537 (1998).
  7. Gutierrez-Sanchez, G., Garcia-Alonso, I., Gutierrez Saenz De Santa Maria, J., Alonso-Varona, A., Herrero De La Parte, B. Antioxidant-based therapy reduces early-stage intestinal ischemia-reperfusion injury in rats. Antioxidants (Basel). 10 (6), 853(2021).
  8. Jia, Z., Chen, Q., Qin, H. Ischemia-induced apoptosis of intestinal epithelial cells correlates with altered integrin distribution and disassembly of f-actin triggered by calcium overload. J Biomed Biotechnol. 2012, 617539(2012).
  9. Gordeeva, A. E., et al. Vascular pathology of ischemia/reperfusion injury of rat small intestine. Cells Tissue Organs. 203 (6), 353-364 (2017).
  10. Ascher, S., et al. Gut microbiota restricts netosis in acute mesenteric ischemia-reperfusion injury. Arterioscler Thromb Vasc Biol. 40 (9), 2279-2292 (2020).
  11. Kiouptsi, K., Casari, M., Mandel, J., Gao, Z., Deppermann, C. Intravital imaging of thrombosis models in mice. Hamostaseologie. 43 (5), 348-359 (2023).
  12. Wang, B., Huang, Q., Zhang, W., Li, N., Li, J. Lactobacillus plantarum prevents bacterial translocation in rats following ischemia and reperfusion injury. Dig Dis Sci. 56 (11), 3187-3194 (2011).
  13. Guan, Y., Worrell, R. T., Pritts, T. A., Montrose, M. H. Intestinal ischemia-reperfusion injury: Reversible and irreversible damage imaged in vivo. Am J Physiol Gastrointest Liver Physiol. 297 (1), G187-G196 (2009).
  14. Joao, S. A., Medeiros, A. C., Diniz, S. O. F., Cardoso, V. N., Brandt, C. T. Translocation of 99mTc labelled bacteria after intestinal ischemia and reperfusion. Acta Cir. Bras. 19 (4), (2004).
  15. Parks, D. A., Granger, D. N. Contributions of ischemia and reperfusion to mucosal lesion formation. Am J Physiol. 250 (6 Pt 1), G749-G753 (1986).
  16. Kurose, I., et al. Molecular determinants of reperfusion-induced leukocyte adhesion and vascular protein leakage. Circ Res. 74 (2), 336-343 (1994).
  17. Massberg, S., et al. Platelet-endothelial cell interactions during ischemia/reperfusion: The role of p-selectin. Blood. 92 (2), 507-515 (1998).
  18. Salter, J. W., Krieglstein, C. F., Issekutz, A. C., Granger, D. N. Platelets modulate ischemia/reperfusion-induced leukocyte recruitment in the mesenteric circulation. Am J Physiol Gastrointest Liver Physiol. 281 (6), G1432-G1439 (2001).
  19. Bayer, F., et al. Colonization with altered schaedler flora impacts leukocyte adhesion in mesenteric ischemia-reperfusion injury. Microorganisms. 9 (8), 1601(2021).
  20. Boettcher, M., et al. Therapeutic targeting of extracellular DNA improves the outcome of intestinal ischemic reperfusion injury in neonatal rats. Sci Rep. 7 (1), 15377(2017).
  21. Li, T. T., et al. Fbxw5 aggravates hepatic ischemia/reperfusion injury via promoting phosphorylation of ask1 in a traf6-dependent manner. Int Immunopharmacol. 99, 107928(2021).
  22. Huang, Z., et al. Inhibition of mir-450b-5p ameliorates hepatic ischemia/reperfusion injury via targeting cryab. Cell Death Dis. 11 (6), 455(2020).
  23. Munley, J. A., et al. Chronic mesenteric ischemia-induced intestinal dysbiosis resolved after revascularization. J Vasc Surg Cases Innov Tech. 9 (2), 101084(2023).
  24. Rubio-Gayosso, I., Platts, S. H., Duling, B. R. Reactive oxygen species mediate modification of glycocalyx during ischemia-reperfusion injury. Am J Physiol Heart Circ Physiol. 290 (6), H2247-H2256 (2006).
  25. Grimsey, N. J., et al. Ubiquitin plays an atypical role in gPCR-induced p38 map kinase activation on endosomes. J Cell Biol. 210 (7), 1117-1131 (2015).
  26. Weithauser, A., Rauch, U. Role of protease-activated receptors for the innate immune response of the heart. Trends Cardiovasc Med. 24 (6), 249-255 (2014).
  27. Bochenek, M. L., et al. EPCR-PAr1 biased signaling regulates perfusion recovery and neovascularization in peripheral ischemia. JCI Insight. 7 (14), e157701(2022).
  28. Alva, J. A., et al. Ve-cadherin-cre-recombinase transgenic mouse: A tool for lineage analysis and gene deletion in endothelial cells. Dev Dyn. 235 (3), 759-767 (2006).
  29. Formes, H., et al. The gut microbiota instructs the hepatic endothelial cell transcriptome. iScience. 24 (10), 103092(2021).
  30. Tanaka, K., et al. In vivo characterization of neutrophil extracellular traps in various organs of a murine sepsis model. PLoS One. 9 (11), e111888(2014).
  31. How, C. K., et al. Induced pluripotent stem cells alleviate lung injury from mesenteric ischemia-reperfusion. J Trauma Acute Care Surg. 79 (4), 592-601 (2015).
  32. Gubernatorova, E. O., Perez-Chanona, E., Koroleva, E. P., Jobin, C., Tumanov, A. V. Murine model of intestinal ischemia-reperfusion injury. J Vis Exp. 111, e53881(2016).
  33. Henein, L., Clevenger, R., Keeran, K., Brinster, L. Rodent model of intestinal ischemia-reperfusion injury via occlusion of the superior mesenteric artery. J Vis Exp. (200), e64314(2023).
  34. Yoshiya, K., et al. Depletion of gut commensal bacteria attenuates intestinal ischemia/reperfusion injury. Am J Physiol Gastrointest Liver Physiol. 301 (6), G1020-G1030 (2011).
  35. Watanabe, T., et al. Activation of the myd88 signaling pathway inhibits ischemia-reperfusion injury in the small intestine. Am J Physiol Gastrointest Liver Physiol. 303 (3), G324-G334 (2012).
  36. Watanabe, T., et al. Toll-like receptor 2 mediates ischemia-reperfusion injury of the small intestine in adult mice. PLoS One. 9 (10), e110441(2014).
  37. Tatum, P. M., Harmon, C. M., Lorenz, R. G., Dimmitt, R. A. Toll-like receptor 4 is protective against neonatal murine ischemia-reperfusion intestinal injury. J Pediatr Surg. 45 (6), 1246-1255 (2010).
  38. Wu, M., Rowe, J. M., Fleming, S. D. Eicosanoid production varies by sex in mesenteric ischemia-reperfusion injury. Clin Immunol. 220, 108596(2020).
  39. Mester, A., et al. gender-related hemorheological alterations in intestinal ischemia-reperfusion in the rat. J Surg Res. 225, 68-75 (2018).
  40. Leung, F. W., Su, K. C., Passaro, E., Guth, P. H. Regional differences in gut blood flow and mucosal damage in response to ischemia and reperfusion. Am J Physiol. 263 (3 Pt 1), G301-G305 (1992).
  41. Megison, S. M., Horton, J. W., Chao, H., Walker, P. B. A new model for intestinal ischemia in the rat. J Surg Res. 49 (2), 168-173 (1990).
  42. Von Bruhl, M. L., et al. Monocytes, neutrophils, and platelets cooperate to initiate and propagate venous thrombosis in mice in vivo. J Exp Med. 209 (4), 819-835 (2012).
  43. Cahoon, J. M., et al. Acridine orange leukocyte fluorography in mice. Exp Eye Res. 120, 15-19 (2014).
  44. Jiang, D., Saffarzadeh, M., Scharffetter-Kochanek, K. In vitro demonstration and quantification of neutrophil extracellular trap formation. Bio Protoc. 7 (13), e2386(2017).
  45. Westhorpe, C. L., et al. In vivo imaging of inflamed glomeruli reveals dynamics of neutrophil extracellular trap formation in glomerular capillaries. Am J Pathol. 187 (2), 318-331 (2017).
  46. Rausch, P., et al. Analysis of factors contributing to variation in the c57bl/6j fecal microbiota across German animal facilities. Int J Med Microbiol. 306 (5), 343-355 (2016).
  47. Wang, S., et al. DNase-1 treatment exerts protective effects in a rat model of intestinal ischemia-reperfusion injury. Sci Rep. 8 (1), 17788(2018).
  48. Li, Y. H., Kuo, C. H., Shi, G. Y., Wu, H. L. The role of thrombomodulin lectin-like domain in inflammation. J Biomed Sci. 19 (1), 34(2012).
  49. Hayase, N., et al. Recombinant thrombomodulin on neutrophil extracellular traps in murine intestinal ischemia-reperfusion. Anesthesiology. 131 (4), 866-882 (2019).

Reprints and Permissions

Tags

Leukocyte AdhesionEndothelial PAR1Germ-Free MiceFluorescence MicroscopyLeukocyte Rolling