CRISPR-Cas9 Mediated Gene Deletion in Human Pluripotent Stem Cells Cultured Under Feeder-Free Conditions

Summary

The presented method describes the generation of a CRISPR-mediated gene knockout in the human embryonic stem cell (hESC) line H9, which stably expresses sgRNAs targeting the L2HGDH gene using a highly efficient lentiviral-mediated gene delivery system.

Abstract

The CRISPR-Cas9 system for genome editing has revolutionized gene function studies in mammalian cells, including stem cells. However, the practical application of this technique, particularly in pluripotent stem cells, presents certain challenges, such as being time- and labor-intensive and having low editing efficiency. Here, we describe the generation of a CRISPR-mediated gene knockout in a human embryonic stem cell (hESC) line stably expressing sgRNAs for the L2HGDH gene, using a highly efficient and stable lentiviral-mediated gene delivery system. The sgRNAs targeting exon 1 of the L2HGDH gene were chemically synthesized and cloned into the lentiCRISPR v2-puro vector, which combines the constitutive expression of sgRNAs with Cas9 in a highly efficient single-vector system to achieve higher lentiviral titers for hESC infection and stable selection using puromycin. Puromycin-selected cells were further expanded, and single-cell clones were obtained using the limited dilution method. The single clones were expanded, and several homozygous knockout clones for the L2HGDH gene were obtained, as confirmed by a 100% reduction in L2HGDH expression using Western blot analysis. Furthermore, using MSBSP-PCR, the CRISPR mutation site was mapped upstream of the PAM recognition sequence of Cas9 in the selected homozygous clones. Sanger sequencing was performed to analyze the exact insertions/deletions, and functional characterization of the clones was conducted. This method produced a significantly higher percentage of homozygous deletions compared to previously reported non-viral gene delivery methods. Although this report focuses on the L2HGDH gene, this robust and cost-effective approach can be used to create homozygous knockouts for other genes in pluripotent stem cells for gene function studies.

Introduction

Human embryonic stem cells (hESCs) and induced pluripotent stem cells (iPSCs) are stem cells with the potential to differentiate into all cell types in the body. These cells serve as valuable tools for studying human development, as well as for understanding the underlying mechanisms of various diseases, thus offering tremendous promise for regenerative medicine, disease modeling, and drug discovery. Such studies involve investigating how specific genes contribute to the development, functioning, and regulation of organisms^1,2.

Various techniques and approaches are employed to decipher gene function, including genetic manipulation, such as gene knockout or overexpression, and genome editing. Among these, CRISPR-Cas9 technology has emerged as the most efficient approach for gene knockout and gene editing studies^1,2,3. The CRISPR-Cas9 system works by utilizing a single guide RNA (sgRNA) molecule specifically designed to identify and bind to a particular DNA sequence of interest. Acting as a molecular guide, the sgRNA directs the Cas9 enzyme to the precise location in the genome that requires modification. Once bound, Cas9 initiates a double-stranded break in the DNA at the designated site. Following the cleavage of DNA, the cell's inherent repair mechanisms are activated. These include two main repair pathways: non-homologous end joining (NHEJ) and homology-directed repair (HDR). NHEJ often results in insertions or deletions (indels) at the break site, leading to gene disruption or inactivation. Conversely, HDR enables the insertion of new DNA sequences at the break site, facilitating the introduction of targeted genetic alterations⁴.

Given the importance of gene deletions in pluripotent stem cells, several protocols have been published on CRISPR-Cas9-mediated gene knockouts in hESCs/iPSCs. However, many of these protocols face significant limitations, such as being extremely time-consuming, labor-intensive, and having low efficiency due to the use of non-viral gene delivery methods⁵. These challenges are even more pronounced in hESCs/iPSCs, as these cells are known to have lower editing efficiency compared to other cell types⁵. Some of these limitations can be addressed by increasing the efficiency of plasmid delivery containing Cas9 and sgRNAs. This can be successfully achieved using a lentiviral vector system, which can significantly improve gene editing outcomes. Lentivirus packaging protocols are well-established and straightforward, allowing easy adoption in laboratories, even by researchers with limited experience. Lentiviruses exhibit high infection efficiency across various cell types, including hESCs and iPSCs. Therefore, utilizing a lentiviral system for Cas9-sgRNA expression is ideal for routine gene editing experiments in hESCs/iPSCs for gene function studies.

Here, we provide a simple and straightforward method for highly efficient CRISPR-Cas9-based gene deletions in hESCs in a comparatively shorter time duration than conventional protocols (Figure 1). Although a lentiviral vector with constitutive expression of Cas9 and sgRNA has been used, it could easily be replaced with drug-inducible Cas9 expression for controllable Cas9 expression.

Protocol

The details of the gene sequences, reagents, and equipment used in this study are listed in the Table of Materials.

1. Single guide RNA (sgRNA) design, cloning, and lentiviral vector production

NOTE: Two different sgRNA sequences targeting the exon 1 of the L2HGDH gene, both adapted from Qiu et al.⁶with PAM sites of AGG and TGG for sequences 1 and 2, respectively, are used. Both sgRNAs were 20 bp in length, and ends were modified to add linker sequences for restriction enzyme Bsmb1 to be cloned in the target vector (LentiCRISPRv2) as described in the previous report⁶. Linker sequences were added during the designing of sgRNAs for cloning purposes.

1. Anneal chemically synthesized sgRNAs⁶ and clone into Bsmb1 single cut lentiviral vector, LentiCRISPRv2 using optimized protocol as previously reported⁷.
2. Proceed with lentiviral packaging and concentration using standardized and optimized protocol⁷.
3. For lentivirus production, seed HEK293T cells (1 × 10⁵ cells/cm²) using DMEM, 10% FBS and 1x penicillin/streptomycin (P/S) and incubate overnight in tissue culture incubator at 37 °C in an atmosphere of 5% CO₂ under humid conditions.
4. When 90% confluent, co-transfect HEK293T cells with entry vector (empty backbone or sgRNA expressing plasmids) and packaging plasmids using low-cost cationic polymer PEI as described previously⁷.
5. Collect the conditioned media containing Lentiviral supernatant (LVS) particles at 48 h and 72 h post-transfection and proceed with ultracentrifugation using sucrose cushion and spin the tubes at 1,25,000 x g for 2 h at 4 °C.
6. Proceed with the LVS particle concentration to at least 200 times the original volume in PBS, aliquot, and store at -80 °C until use.
7. Determine the titer of lentiviral particles by using the qPCR Lentivirus Titer Kit following the manufacturer's instructions (see Table of Materials).

2. Lentiviral infections and single-cell clonal propagation

1. For infections with LVS particles, seed hESC (H9) cell suspension having 1 × 10⁵ cells/0.5 mL of hESC culture media (Basal media + P/S + 10 µM of Rock Inhibitor) on complete Matrigel (1:50) coated P24 well plates in 500 µL of media and incubate overnight to allow the cells to attach. Seed extra wells that would not be infected with LVS but treated with puromycin to serve as non-infected control.
   NOTE: Cell counting can be performed using a manual hemocytometer or automated cell counter.
2. The following day, infect the cells at Multiplicity of Infection (MOI) of 10 along with 8 µg/mL of polybrene and incubate at 37 °C for 8 h followed by media replacement with fresh hESC media + P/S without Rock Inhibitor and continue culturing until cells are 90% confluent.
3. Start puromycin selection by supplementing the media with 0.8 µg/mL concentration of puromycin when cells reach 90% confluency, which is usually 48-72 h post-infection, and continue the selection until all cells die in the non-infected cells (control group).
4. After the selection is complete (usually 4-6 days), split stable cells (1:4) and expand for cryopreservation and further analysis.
5. Perform single-cell selection and clonal expansion using cells expressing L2HGDH-sgRNA-1⁶.
6. For this purpose, prepare a cell suspension equivalent to 500 cells/10 mL of complete growth media and seed 100 µL of this suspension in each well of a 96-well plate.
7. Leave the cells undisturbed for 3 days and then observe.
8. Mark the wells that yield single clones and change the media every other day until a sufficient size is achieved for the colonies (usually 2 weeks) to expand further, cryopreserve, and analyze.

3. gDNA extraction, MS-BSP PCR, and Sanger sequencing

1. Isolate gDNA from cells using the genomic DNA isolation Kit following the manufacturer's instructions (see Table of Materials).
2. Proceed with the mapping of mutation sites upstream of the PAM recognition sequences using Mutation Sites Based Specific Primers (MS-BSP) analysis⁸.
3. For this, an unbiased right primer L2H-UMSBSP-R1 is designed to amplify the region outside the Exon1 to amplify any targets.
4. Design a biased left primer L2H-BMSBSP-F1 with an identical sequence to sgRNA to amplify the target sequence close to PAM recognition sequences.
   NOTE: At very high stringent conditions of PCR, the product will be observed on the gel in unmutated clones. No product would be observed in CRISPR-knockout clones exhibiting mutations close to upstream of PAM recognition sequences.
5. In order to map single base pair mutations, PCR amplify a 468 bp sequence spanning the whole exon 1 of L2HGDH and subject to Sanger sequencing followed by multiple sequence alignment analysis using clustalw⁸.

4. hESC-differentiation and embryoid body (EB) formation assay

1. Proceed with the directed differentiation of control and different CRISPR clones of hESCs (H9) towards neuro-ectoderm fate following established protocols as previously described using dual smad inhibition method^9,10,11.
2. When at 90% confluency, treat the cells with LDN193189 (200 nM) and SB431542 (10 µM) for an initial 24 h in 100% KSR media followed by the addition of XAV939 (2 µM) for additional 2 days.
3. After 3 days, reduce the percentage of KSR media (Knockout DMEM supplemented with 15% (v/v) KSR, 1% (v/v) L-glutamine, 1% (v/v) P/S, 1% (v/v) 10 mM MEM, and 0.1% (v/v) 2-mercaptoethanol (75%, 50%, 25%) by combining with N2 media (DMEM/F12 supplemented with 1x N2 supplement, 1x P/S,) to 100% N2 media over a period of 8 days.
4. At the beginning of Day 12, fix the cells for immunostaining using PAX6 as a neuro-ectoderm marker.
5. For mesoderm and endodermal fate determination studies, employ a small molecule CHIR99021-based approach described in previous publications^12,13.
6. For this, when the cells reach 70% confluency, treat with 3 µM of CHIR99021 in Definitive Endoderm (DE) media for 24 h followed by fixation for immunostaining using Brachuary as mesoderm-specific marker.
7. For the endodermal stage, culture the cells for an additional 24 h in DE media alone without the addition of CHIR99021 before fixing for immunostaining using FOXA2.
8. For EB formation assay, seed the cells on low attachment cell surfaces without using Matrigel to culture cells under suspension conditions for 24 h before taking micrographs.

5. Western blot analysis

1. Wash the cells twice using PBS and lyse using 1x RIPA buffer containing 1% SDS and 1x protease and phosphatase inhibitor cocktail.
2. Clear the lysates by centrifugation at 16,000 x g for 10 min at 4 °C followed by collection of the supernatants.
3. Quantify the total cell protein using the BCA protein assay kit following the manufacturer's instructions. Adjust the samples to 2 µg/µL using 4× loading dye sample buffer.
4. Denature the protein samples at 70 °C for 10 min, load equal amounts of each sample, and resolve using 4%-12% gradient SDS-PAGE gels⁷ followed by transfer to PVDF membrane at a constant voltage of 100 V for 1 h at 4 °C.
5. Block the membranes using 5% non-fat milk and incubate in primary antibody dilutions at 4 °C overnight with rotation.
6. Next, wash the membranes 5x using PBST buffer and incubate in HRP-conjugated appropriate secondary antibodies for 1 h at room temperature.
7. Wash the membranes again with PBST 5x, incubate with chemiluminescent substrate, and develop using X-ray films.

6. Immunostaining

1. Seed the cells on P4 well plates and incubate for at least 24 h before fixation to allow proper attachment of cells to surfaces.
2. Wash the cells 3x with PBS to remove any dead cells as well as media components, followed by fixation using 4% PFA for 15 min at room temperature.
3. Permeabilize the cells by using 0.3% triton X-100 followed by blocking for nonspecific binding by using 2% BSA in PBS for 1 h at room temperature.
4. Incubate the samples with primary antibodies (OCT4, NANOG, SOX2, KI67, PAX6, Brachuary, FOXA2) diluted in 1% BSA overnight at 4 °C.
5. Wash the cells 3x with PBS and incubate with appropriate secondary antibodies (Goat anti-mouse 488, Goat anti-rabbit 488, Goat anti-mouse 546, Goat anti-rabbit 546) diluted in 1% BSA for 1 h at room temperature.
6. Finally, wash the samples with PBS 3x and counterstain them with DAPI and image using a fluorescence microscope.

Results

Cloning of L2HGDH sgRNAs in lentiCRISPRv2 puro
lentiCRISPRv2 puro vector was commercially obtained (see Table of Materials) and digested with BsmB1, which resulted in the release of a 1.8 Kb stuffer fragment. As shown in Figure 2A, a complete digestion of the vector was observed. For each construct, six clones were screened for the presence or absence of insert using reverse sgRNA sequence as a primer and a forward primer (U6-459F) from within the vector sequence. Using this approach, only those clones having the insert yielded a PCR product of 288 bp, and negative clones that did not contain the reverse sequence of sgRNA resulted in no PCR product, as shown in Figure 2B.

H9 infections, stable selections, and Western blot
hESCs were infected with lentiviral particles expressing two different sgRNAs targeting the exon 1 of the L2HGDH gene and selected with puromycin. Western blot analysis was performed from heterogenous populations of stably co-expressing sgRNA and Cas9 cells to establish which of the two sgRNAs used was more efficient in inducing gene deletion. As shown in Figure 3A, L2HGDH-sgRNA-1 was more efficient than the other sequence in reducing the expression of L2HGDH in heterogeneous cell populations.

Clonal selection, expansion, and protein analysis
Single-cell selection and clonal expansion were made for cells expressing L2HGDH-sgRNA-1. The wells that yielded single clones were marked and grown until a sufficient size was achieved for the colonies (usually 2 weeks) to expand further, cryopreserve and analyze (Figure 3B). A total of 22 clones were analyzed using Western blot analysis, which yielded five homozygous knockouts (23%) for L2HGDH. This result shows a high efficiency of gene knockout using lentiviral-mediated gene delivery for stable co-expression of both sgRNA and Cas9 from a single cassette. Figure 4 shows a Western blot analysis of the five homozygous knockout clones along with control cells, showing 100% reduced expression compared to the control in the selected clones.

Analysis at the DNA level
In order to map the CRISPR mutation site upstream of the PAM recognition sequence of Cas9, Mutation Sites Based Specific Primers Polymerase Chain Reaction (MS-BSP PCR) was performed using genomic DNA from control cells and from five different clones. As shown in Figure 5, two clones (A5 and B4) have mutations immediately close to the PAM recognition sequence, while the other three clones (A1, A9, and B12) showed the mutation might not be very close to the PAM site and is further upstream of the 20bp sgRNA sequence within the exon 1 of L2HGDH gene.

In order to find the exact mutations in the DNA, purified PCR products from control cells (vector only infected H9) as well as three different CRISPR clones, A5, A1, and B4, were subjected to Sanger sequencing, and mutation sites were mapped using the multiple alignments tool clustalw upstream of the PAM site⁸. The results revealed deletion mutation in the A5 clone upstream of the PAM site. The other two clones, A1 and B4, showed insertional mutation upstream of the PAM site, as highlighted in Figure 6.

Functional analysis of clones
Upon generation of CRISPR knockout cell lines in hESCs, the next step is to confirm their pluripotency and differentiation potential. For that purpose, we tested different pluripotency markers for three different clones, A1, A5, and B4, and compared the results to control (vector-only infected H9) cells. The results showed no change in the pluripotency potential of knockout cell lines as determined by immunostaining for OCT4, NANOG, and SOX2 markers. Next, the control and knockout cell lines were also stained for the cell proliferation marker, KI67, which also showed no change in knockout cell lines compared to the control. These results show that CRISPR knockout did not affect the self-renewal properties of these cells. In addition, EB and colony formation were also not affected (Figure 7). Using in vitro methods established in our lab, all clones were successfully differentiated into three germ layer cells as confirmed by immunostaining for PAX6 (neuroectoderm marker), Brachyury (mesoderm marker), and FOXA2 (endoderm marker). No change in the differentiation potential of knockout cell lines was observed compared to control cells, which showed that knockout cells retained their differentiation potential (Figure 8).

Figure 1: Schematic diagram showing the study design in 5 steps. Step 1: Designing and cloning of sgRNAs into Bsmb1 digested V2 CRISPR vector. Step 2: Generation of lentiviral particles using entry vector carrying sgRNA along with packaging plasmids by co-transfecting HEK293T cells using polyfections and viral concentration using ultracentrifugation. Step 3: Infection of hESCs using lentiviral particles at MOI of 10-20 and stable cell selection using puromycin followed by analysis of heterogenous cell populations to see the efficiency of sgRNAs. Step 4: Single cell cloning by limiting dilution method from the cells that showed maximum knockdown in heterogenous populations and selection of single clones. Step 5: Expansion of single clones and analysis at DNA level, protein, and functional analysis of clones for stemness and differentiation potential. Please click here to view a larger version of this figure.

Figure 2: Cloning of sgRNAs in lentiCRISPR V2.puro vector. (A) Digestion of lentiCRISPR V2.puro vector with the restriction enzyme, BsmB1. The arrow indicates a 1.8 Kb stuffer fragment released upon the digestion of the vector. (B) Colony PCR analysis for different clones of L2HGDH sgRNA constructs 1 and 2. Please click here to view a larger version of this figure.

Figure 3: Western blots and clonal propagation using single-cell selection. (A) Western blot analysis from two different biological replicates (S1 and S2) of heterogenous populations of stably co-expressing sgRNA (L2H-1 and L2H-2) and Cas9 along with Control (C) H9 hESCs. (B) Single-cell selection and clonal expansion of H9 cells stably expressing L2HGDH-sgRNA-1. Arrows indicate wells of 96 well plates showing only single clones. Scale bar = 100 µM. Please click here to view a larger version of this figure.

Figure 4: Western blot analysis from different clones of H9. (A-C) Western blot analysis from total cell lysates of 22 clones yielded five homozygous knockouts (23%) for L2HGDH. (D) Confirmation of L2HGDH knockouts from a different biological replicate experiment using Western blot. Please click here to view a larger version of this figure.

Figure 5: MSBSP PCR analysis of different H9 clones. (A) Sequence analysis of L2HGDH exon 1 used for MSBSP PCR analysis. (B) Optimization of annealing temperature for MSBSP PCR analysis using control and H9 V2 L2HGDH KO Clone B4. At 96.8, the control shows a band, but B4 does not show a band, as shown by arrows. (C) Analysis of all homozygous KO clones resulted in the below mapping of the mutation site within exon 1. A1 = In/Del not close to the PAM site; A5 = In/Del Close to PAM site; A9 = In/Del Fairly Close to PAM site; B4 = In/Del Very close to PAM site B12 = In/Del not close to the PAM site. Please click here to view a larger version of this figure.

Figure 6: Alignment of Sanger sequenced PCR products with reference L2HGDH exon 1 sequence. Multiple alignments of Sanger-sequenced PCR products from A1, A5, and B4, and control cells were done along with a reference sequence within the first exon of L2HGDH from the NCBI database. Please click here to view a larger version of this figure.

Figure 7: Functional characterization of CRISPR knockout cell lines. (A) The cells were immunostained for pluripotency markers (OCT4, NANOG, SOX2), self-renewal (KI67), EBs, and colony formation with respect to the control infected H9 hESCs. Scale bars: 100 µM. (B) The percentage of positively (+ve) expressing cells was calculated relative to DAPI staining. Please click here to view a larger version of this figure.

Figure 8: Differentiation potential of CRISPR knockout cell lines. Functional characterization of CRISPR knockout cell lines in terms of their differentiation potential using markers for PAX6 (neuroectoderm), Brachyury (mesoderm), and FOXA2 (Endoderm) with respect to the control infected H9 cells. Scale bars: 100 µM. Please click here to view a larger version of this figure.

Protocol step	Time required
Cloning of sgRNAs in LentiCRISPRv2	4 days
Lentivirus production and titer determination	5 days
hESC infections, stable cell selections, and expansion	2 weeks
Single cell clonal selection and expansion	2 weeks
Functional analysis of clones	2 weeks

Table 1: Timeline for protocol steps and estimated time required.

Discussion

This study has standardized a method that enables highly efficient and cost-effective gene deletions in hESCs through CRISPR-Cas9 technology. This method successfully achieved homozygous deletion of the L2HGDH gene in hESCs within 3-4 weeks, starting from hESC infection to single-cell clonal selection and propagation (Table 1). Although CRISPR-Cas9-mediated gene manipulations can be achieved by transient transfections in most cells, this becomes challenging in stem cells due to poor transfection efficiency and high cell toxicity. Different studies have reported up to 10% of the recovered clones showing deletions. For example, Mali et al. reported 2% to 4 % genome editing efficiency in human induced pluripotent stem cells after targeting AAVS1 locus³. Another study reported editing efficiencies of 1.3%-8.4% in naïve hESCs to target TUNA, a long non-coding RNA involved in pluripotency and neural differentiation¹⁴. Up to 10% efficiency was reported after targeting the CFTR gene in human pluripotent stem cells by Ocana et al.¹⁵Thus, an efficient delivery method of Cas9-gRNA is required to achieve efficient gene editing, and this is especially true for stem cells as these cells exhibit an increased level of sensitivity and resistance to transient delivery methods compared to typical somatic cells and immortalized cell lines⁵.

In the present study, a highly efficient way to get homozygous CRISPR knockout cell lines is reported by using lentiviral-mediated delivery of sgRNAs into hESCs. Using lentiviral vectors to deliver CRISPR-Cas9 into the hESCs proved much more efficient and less time-consuming in achieving gene deletion than using non-viral vector transfections through chemical or mechanical means (data not shown). This resulted in significantly higher genome editing efficiency (~23%) after clonal selection and propagation of individual clones. Therefore, by combining lentiviral mediated delivery of sgRNAs and Cas9 into hESCs as well as a cost-effective approach for the production of lentivirus, the present method is not only highly efficient and less time-consuming but also cost-effective.

Here are some of the recommendations for a successful approach: (1) Using a single lentiviral vector system expressing both Cas9 and sgRNAs. (2) The presence of an antibiotic selection marker, such as puromycin, on the same plasmid that expresses Cas9 and sgRNAs ensures that nearly 100% of the cells are positive for Cas9-sgRNA expression. This significantly increases the likelihood of successful gene editing events. (3) In order to be useful for infections in hESCs, it is indispensable to concentrate the lentiviral vectors to yield high titers of viruses. Among the various techniques used, the most economical approach is to use large volumes of LVS and concentrate them by 100-500 times the original volume to achieve titers in the range of 10⁷ to 10⁸ IU/mL. (4) For the cost-effective and efficient method of HEK293T cell transfections with the plasmids, using PEI (polyethyleneimine) for lentiviral vector transfection for virus packaging is equally efficient and, therefore, cost-effective compared to the commonly used transfection reagent lipofectamine⁷. (5) Average lentiviral titers must be in the range of 5 × 10⁷ IU/mL. (6) Clonal propagation by single-cell selection is required to achieve homozygous deletions of the gene of interest in these cells. (7) Although previous studies have indicated that CRISPR-Cas9 mediated gene editing in human pluripotent stem cells results in very few off-target mutations^16,17, it is still prudent to check for off-target sites. This can be achieved through efficient gRNA design tools to minimize off-target effects and genome-wide sequencing of edited cell lines¹⁸, especially for experiments of clinical importance. (8) Finally, the normal karyotype of selected clones should be verified using methods such as G-banding and high-resolution analysis to ensure there are no large-scale genomic changes. A micronucleus assay can also be performed to assess the frequency of micronuclei formation, which may indicate genomic instability.

One of the major limitations of this method is the use of a lentiviral vector system, which led to the stable genomic integration of Cas9 and sgRNAs, leading to their constitutive expression post-editing, which is undesirable. In the future, this method can be improved by replacing constitutive promoters with a drug-inducible promoter driving the expression of the Cas9 gene, such as the Tet-on system with doxycycline treatment for controlled expression of Cas9.

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
2-MERCAPTOETHANOL	Invitrogen	31350010
38.5 mL, Sterile + Certified Free Open-Top Thinwall Ultra-Clear Tubes	Beckman Coulter	C14292
Accutase	Stem cell technologies	7920
bFGF Recombinant human	Invitrogen	PHG0261
Brachyury Rabbit mAb	Abclonal	A5078
BsmBI-v2	NEB	R0739S
chir99021	Tocris	4423/10
Corning Matrigel Basement Membrane Matrix, LDEV-free	Corning	354234
Cyclopamine	Stem cell technologies	72074
DMEM media	Invitrogen	11995073
DMEM NUTRIENT MIX F12	Invitrogen	11320033
DPBS w/o: Ca and Mg	PAN Biotech	P04-36500
Fetal bovie serum	Invitrogen	10270106
FoxA2/HNF3β	CST	8186
GAPDH (14C10) Rabbit mAb Antibody	CST	2118S
Gentle Cell Dissociation Reagent	Stem cell technologies	7174
HyClone Non Essential Amino Acids (NEAA) 100x Solution	GE healthcare	SH30238.01
Ki-67 (D3B5) Rabbit mAb	CST	9129
KnockOut Serum Replacement	Invitrogen	10828028
L GLUTAMINE, 100x	Invitrogen	2924190090
L2H-BMSBSP-F1	Macrogen		CGTGCGGGTTCGCGTCTGGG
L2HGDH Polyclonal antibody	Proteintech	15707-1-AP
L2HGDH-SgRNA1-F	Macrogen		CACCGCGTGCGG GTTCGCGTCTGGG
L2HGDH-SgRNA1-R	Macrogen		AAACCCCAGACGC GAACCCGCACGC
L2HGDH-SgRNA2-F	Macrogen		CACCGCCCGCGG GCTTTTCGCCGG
L2HGDH-SgRNA2-R	Macrogen		AAACCCGGCGAA AAGCCCGCGGGC
L2H-SeqF1	Macrogen		GCTAAAGAGCGC GGGTCCTCGG
L2H-SeqR1	Macrogen		GTGGACGGGTTG TTCAAAGCCAGAG
L2H-UMSBSP-R1	Macrogen		GTGGACGGGTTG TTCAAAGCCAGAG
LentiCRISPRv2	Addgene	52961
mTesR1 complete media	Stem cell technologies	85850
Nanog Antibody	CST	3580
NEUROBASAL MEDIUM 1x CTS	Invitrogen	A1371201
Neuropan 2 Supplement 100x	PAN Biotech	P07-11050
Neuropan 27 Supplement 50x	PAN Biotech	P07-07200
Oct-4 Antibody	CST	2750
Pax6 (D3A9V) XP Rabbit mAb	CST	60433
PENICILLIN STREPTOMYCIN SOL	Invitrogen	15140122
pMD2.G	Addgene	12259
Polybrene infection reagent	Sigma	TR1003- G
Polyethylenimine, branched	Sigma	408727
psPAX2.0	Addgene	12260
Puromycin	Invitrogen	A1113802
qPCR Lentivirus Titer Kit	Abm	LV900
Rock inhibitor Y-27632 dihydrochloride	Tocris	1254
SB 431542	Tocris	1614/10
Sox2 Antibody	CST	2748
Sucrose	Sigma	57-50-1
TRYPSIN .05% EDTA	Invitrogen	25300062
U6-459F	Macrogen		GAGGGCCTATT TCCCATGATTC
Wizard Genomic DNA Purification Kit	Promega	A1120
XAV 939	Tocris	3748/10