Method Article

A High-Throughput Screening Approach for Evaluating the Binding Affinity of Environmental Pollutants to Nuclear Receptors

834 views

DOI:

10.3791/67327

September 20th, 2024

In This Article

Summary

This protocol describes a high-throughput screening system that uses fluorescence polarization of a specific fluorescent probe binding to a nuclear receptor as a readout for screening environmental pollutants.

Abstract

Increasing levels of compounds have been detected in the environment, causing widespread pollution and posing risks to human health. However, despite their high environmental occurrence, there is very limited information regarding their toxicological effects. It is urgent to develop high-throughput screening (HTS) methods to guide toxicological studies. In this study, a receptor-ligand binding assay using an HTS system was developed to determine the binding potency of environmental pollutants on nuclear receptors. The test is conducted using a microplate reader (i.e., a 96-well plate containing various chemicals) by measuring the fluorescence polarization (FP) of a specific fluorescent probe. This assay consists of four parts: the construction and transformation of recombinant vectors, the expression and purification of the receptor protein (ligand-binding domain), receptor-probe binding, and competitive binding of chemicals with the receptor. The binding potency of two environmental pollutants, perfluorooctanesulfonic acid (PFOS) and triphenyl phosphate (TPHP), with peroxisome proliferator-activated receptor gamma (PPARγ) was determined to illustrate the assay procedure. Finally, the advantages and disadvantages of this method and its potential applications were also discussed.

Introduction

A large number of chemicals have been widely detected in the environment and human bodies, raising significant concerns about their impact on the ecological environment and human health1,2,3. Despite their high environmental occurrence, information regarding their toxicological effects is scarce. Therefore, it is urgent to develop high-throughput screening (HTS) methods to facilitate the assessment of chemical toxicity.

Several high-throughput screening (HTS) methods have been reported for chemical toxicity assessment, such as the HTS bioassays used in the Tox21 and ToxCast programs4,5. These methods can rapidly identify potential toxicants and provide valuable information on the mechanisms of chemical toxicity. However, these HTS bioassays mainly rely on cell-based systems, which can be complex and expensive. Additionally, high-throughput sequencing methods have also been used for chemical toxicity assessment, but achieving high-throughput evaluation of chemicals remains challenging6. Previous studies have developed fluorescence polarization (FP)-based receptor-ligand competitive binding assays to determine the binding potency of several environmental pollutants, including per- and polyfluoroalkyl substances (PFAS)7,8,9, bisphenol A (BPA)10,11, and particulate matter (PM)12, with nuclear receptors such as peroxisome proliferator-activated receptor (PPAR)7,8,9,10,13, farnesoid X receptor (FXR)11,12, and thyroid receptor (TR)14,15. This approach is efficient, cost-effective, and provides mechanistic insights.

In this study, the protocol for the receptor-ligand binding assay is described based on detecting the fluorescence polarization (FP) of a small fluorescent probe. The principle of the FP-based receptor-ligand binding assay is illustrated in Figure 1. When a small fluorescent molecule is excited by plane-polarized light, the emitted light becomes highly depolarized due to rapid molecular rotation. However, when the tracer binds to a larger receptor, its rotation is slowed. A high FP value is detected when the tracer is bound to the large receptor, whereas a low FP value is observed when the tracer is free. Peroxisome proliferator-activated receptor gamma (PPARγ) was purified for the binding of the probe to the receptor. Rosiglitazone (Rosi), perfluorooctanesulfonic acid (PFOS), and triphenyl phosphate (TPHP) were used to compete for the binding of the probe with the receptor. Rosi, a specific agonist of PPARγ, was used as a positive control in the receptor competitive binding assays. Additionally, PFOS and TPHP have been previously identified as weak agonists of PPARγ in past studies8,9,10,11,12,13,14,15,16,17. Furthermore, they belong to different structural categories of compounds known for environmental exposure and are notable for their relatively high detection rates in human populations. These compounds were used to further validate the broad applicability of the competition binding assay. The procedure consists of four steps: construction and transformation of recombinant vectors, expression and purification of the receptor protein (ligand-binding domain), receptor-probe binding, and competitive binding of chemicals with the receptor.

Protocol

The details of the reagents and the equipment are listed in the Table of Materials.

1. Construction and transformation of recombinant vectors

NOTE: PPARγ is a ligand-dependent transcription factor with a classical nuclear receptor structure, comprising a DNA-binding domain that regulates target genes and a ligand-binding domain activated by ligands. Upon ligand activation, PPARγ forms a heterodimer with another nuclear receptor, retinoid X receptor (RXR), and binds to response elements of PPARγ, thereby regulating the transcription of downstream target genes9,16.

  1. Design primers for the PPARγ-LBD (see Table 1) and amplify the PPARγ-LBD DNA segment (see Table 2 and Table 3).
  2. Linearize the His×6-tagged pET28a vector by digesting it with restriction endonucleases XhoI and BamHI18.
  3. Clone the PPARγ-LBD DNA segment into the His×6-tagged pET28a vector using the commercially available cloning kit, resulting in the recombinant plasmid pET28a-PPARγ-LBD-6×His18.
  4. Transfect the recombinant expression plasmid pET28a-PPARγ-LBD-6×His into BL21 (DE3) Escherichia coli cells for protein expression18.
  5. Add 5 µL of the recombinant vector to competent BL21(DE3) cells, incubate on ice for 30 min, perform a heat shock at 42 °C for 45 s, then immediately return to the ice.
  6. Add 900 µL of LB medium, shake at 37 °C for 1 h (160-200 rpm), then centrifuge at ~3000 x g for 5 min at room temperature.
  7. Discard the supernatant, resuspend the bacterial pellet in 100 µL of LB medium, and spread onto a solid medium. Invert the plates and culture at 37 °C for 12-16 h.
  8. Select individual colonies for sequencing identification and subsequent protein expression and purification.

2. Expression and purification of the receptor protein

  1. Incubate the transformed BL21 (DE3) cells in 200 mL LB medium supplemented with 100 µg/mL ampicillin on an orbital shaker (230 rpm) for 1-2 h at 37 °C.
  2. Induce the cells when the OD600 reaches 0.4-0.6 absorbance units by adding 10 µM isopropyl β-D-1-thiogalactopyranoside (IPTG) and incubate at 16 °C for 16 h.
  3. Collect the bacterial suspension and centrifuge at 8000 × g, 4 °C, for 10 min.
  4. Lyse the cells in 20 mL soluble lysis buffer (50 mM of NaH2PO4, 300 mM of NaCl, 10 mM of imidazole, pH 8.0), adding 200 µL of phenylmethylsulfonyl fluoride (PMSF) and 200 µL of lysozyme. Resuspend the bacterial pellet using a 5 mL pipette, then proceed with sonication at 30% power for 20 min.
  5. Add lysis buffer equal to 5 times the column volume to equilibrate the nickel column. Repeat this process twice and set aside.
  6. Centrifuge the sonicated bacterial suspension at 8000 × g for 15 min at 4 °C to obtain the bacterial supernatant lysate (CL).
  7. Load the CL onto the nickel column (for protein adsorption) to obtain the flow-through (FT).
  8. Wash the column with 5 times the column volume of wash buffer (50 mM of NaH2PO4, 300 mM of NaCl, 20 mM of imidazole, pH 8.0) to obtain the wash eluate (W1-W6).
  9. Wash the column with 1 mL of elution buffer (50 mM NaH2PO4, 300 mM NaCl, 250 mM imidazole, pH 8.0) to elute the target protein and obtain the protein fractions (E1-E5).
  10. Take a 20 µL aliquot of each fraction (CL, FT, W1-W6, and E1-E5) and analyze using SDS-PAGE18 with Coomassie Brilliant Blue staining. PPARγ-LBD runs as a 34.9 kDa protein on a denaturing gel.

3. Receptor binding assay

NOTE: In this assay, C1-BODIPY-C12 was used as a site-specific fluorescent probe to establish the receptor-ligand binding system. C1-BODIPY-C12, a specific ligand for PPARγ, is a fluorescent analog of fatty acid with the BODIPY fluorescent group incorporated into the fatty acid at the C1 position.

  1. Dilute the purified human PPARγ-LBD in Tris-HCl buffer (20 mM of Tris, 100 mM of NaCl, pH 8.0) to a concentration range of 1 nM to 6400 nM. Also, dilute the C1-BODIPY-C12 probe in Tris-HCl buffer to a concentration of 50 nM.
  2. Mix the diluted PPARγ-LBD solution (55 µL per well) and the C1-BODIPY-C12 probe solution (55 µL per well) in a 96-well black plate. Incubate at room temperature for 5 min.
  3. Measure fluorescence polarization (FP) with the microplate reader.
  4. Plot the FP values against the receptor concentration, fit the curve using the specific binding with the Hill slope equation using statistical and graphing software, and calculate the Kd value.

4. Competitive binding assay

NOTE: In this assay, 800 nM of human PPARγ-LBD and 50 nM C1-BODIPY-C12 probe were used for receptor binding. Rosiglitazone (Rosi), triphenyl phosphate (TPHP), and perfluorooctanesulfonic acid (PFOS) were used to compete with the binding of the probe to PPARγ.

  1. Dilute the three compounds in Tris-HCl buffer within a concentration range from 0-200 µM.
  2. Prepare the receptor-probe binding solution with a final concentration of 800 nM of human PPARγ-LBD and 50 nM of C1-BODIPY-C12 probe.
  3. Mix the receptor-probe binding solution (55 µL per well) and compound solution (55 µL per well) in a 96-well black plate. Incubate at room temperature for 5 min.
  4. Measure fluorescence polarization (FP) with the microplate reader.
  5. Plot the FP values as a function of the ligand concentration. Obtain the half-maximal inhibitory concentration (IC50) of each ligand from the competition curve using the sigmoidal model processed by a graphing and analysis software.

Results

Protein expression and purification of PPARγ-LBD
PPARγ-LBD was heterologously expressed in BL21 (DE3) as a histidine-tagged protein. The protein was detected in the soluble fractions, and the purified PPARγ-LBD showed a single band on SDS-PAGE with an apparent molecular weight of approximately 34.9 kDa (Figure 2), consistent with the predicted molecular weight of the protein.

The binding of C1-BODIPY-C12 probe to PPARγ-LBD
In the receptor binding assay, C1-BODIPY-C12, a BODIPY-labeled fatty acid that can bind to PPARγ-LBD, was used as a fluorescence probe to study the binding potency of environmental pollutants with hPPARγ-LBD. As shown in Figure 3A, the fluorescence polarization (FP) values increased from 20 to 250 upon the addition of PPARγ-LBD, indicating the binding of C1-BODIPY-C12 to the receptor. The binding curve reached saturation at 800 nM PPARγ-LBD, with a dissociation constant (Kd) of 253.5 nM ± 10.05 nM. Therefore, 800 nM PPARγ-LBD was chosen for the subsequent competitive binding assays.

The competitive binding of environmental pollutants to PPARγ-LBD
Rosiglitazone (Rosi), a specific agonist of PPARγ, was used as a positive control to displace the fluorescent probe in the competitive ligand binding assays. As shown in Figure 3B, Rosi inhibited the binding of the C1-BODIPY-C12 probe to PPARγ-LBD in a dose-dependent manner, with an IC50 of 6.89 µM, demonstrating the feasibility of the assay. Next, the binding affinities of TPHP and PFOS to PPARγ-LBD were determined. As shown in Figure 3C,D, TPHP and PFOS also inhibited the binding of the C1-BODIPY-C12 probe to PPARγ-LBD in a dose-dependent manner, with IC50 values of 60.45 µM and 37.27 µM, respectively.

Fluorescence polarization diagram; excitation, ligand binding, probe kinetics, optical analysis.
Figure 1: Schematic illustration of fluorescence polarization (FP)-based receptor competitive binding assays. Please click here to view a larger version of this figure.

SDS-PAGE gel electrophoresis result; protein bands; molecular weight markers; purification analysis.
Figure 2: SDS-PAGE analysis of the purified PPARγ-LBD. M is the protein molecular weight marker. Cl is the cell lysate, FT is the flow-through fraction, W1-W6 are the wash solutions, E1 is the eluate, and E2-E4 are the purified PPARγ-LBD proteins. Please click here to view a larger version of this figure.

Fluorescence polarization; binding curves; PPARγ-LBD; Rosi, TPHP, PFOS; graph analysis.
Figure 3: Fluorescence polarization (FP)-based receptor binding curve and competitive binding curves. (A) FP-based binding curve of C1-BODIPY-C12 to human PPARγ-LBD. (B-D) FP-based competitive binding curves of Rosi, TPHP, and PFOS to Human PPARγ-LBD. Error bars denote the standard deviation (SD) for three independent experiments. Please click here to view a larger version of this figure.

IDseq
pET28a-Human PPARG-P1CAAATGGGTCGCGGATCCATGATCGACCAGCTGAATCCAGAGTCC
pET28a-Human PPARG-P2GTGGTGGTGGTGCTCGAGTCAGTACAAGTCCTTGTAGATCTC
PPARγ-LBD nucleotide sequenceAGACGACATTCCCTCTAGAATAATTTTGTTTAACTTTAAGAAGGAGAT
ATACCATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCCTG
GTGCCGCGCGGCAGCCATATGGCTAGCATGACTGGTGGACAGCAAA
TGGGTCGCGGATCCATGATCGACCAGCTGAATCCAGAGTCCGCTGAC
CTCCGGGCCCTGGCAAAACATTTGTATGACTCATACATAAAGTCCTTCC
CGCTGACCAAAGCAAAGGCGAGGGCGATCTTGACAGGAAAGACAACA
GACAAATCACCATTCGTTATCTATGACATGAATTCCTTAATGATGGGAGA
AGATAAAATCAAGTTCAAACACATCACCCCCCTGCAGGAGCAGAGCAA
AGAGGTGGCCATCCGCATCTTTCAGGGCTGCCAGTTTCGCTCCGTGG
AGGCTGTGCAGGAGATCACAGAGTATGCCAAAAGCATTCCTGGTTTTG
TAAATCTTGACTTGAACGACCAAGTAACTCTCCTCAAATATGGAGTCCA
CGAGATCATTTACACAATGCTGGCCTCCTTGATGAATAAAGATGGGGT
TCTCATATCCGAGGGCCAAGGCTTCATGACAAGGGAGTTTCTAAAG
AGCCTGCGAAAGCCTTTTGGTGACTTTATGGAGCCCAAGTTTGAGT
TTGCTGTGAAGTTCAATGCACTGGAATTAGATGACAGCGACTTGGCAA
TATTTATTGCTGTCATTATTCTCAGTGGAGACCGCCCAGGTTTGCTGAA
TGTGAAGCCCATTGAAGACATTCAAGACAACCTGCTACAAGCCCTGG
AGCTCCAGCTGAAGCTGAACCACCCTGAGTCCTCACAGCTGTTTG
CCAAGCTGCTCCAGAAAATGACAGACCTCAGACAGATTGTCACGGA
ACACGTGCAGCTACTGCAGGTGATCAAGAAGACGGAAACCGACATG
AGTCTTCACCCGCTCCTGCAGGAGATCTACAAGGACTTGGACTGG
CTCGAGGCCACCCACCC

Table 1: The primer and nucleotide sequence of PPARγ ligand-binding domain.

Experimental Reagents namesVolume/Dose
pET28a-Human PPARG-P11 μL
pET28a-Human PPARG-P21 μL
2×phanta Max Master Mix12.5 μL
cDNA2 μL
ddH2O8.5 μL

Table 2: PCR experimental reagent system.

Experiment namesTemperatureTime
Pre-denaturation95 °C3 min
Denaturation95 °C15 s
Annealing65 °C15 s
Extension72 °C6 min
Store12 °C--

Table 3: PCR experimental reaction program.

Discussion

Fluorescence polarization (FP), surface plasmon resonance (SPR), and nuclear magnetic resonance (NMR) are common techniques used for assessing direct binding interactions between proteins and compounds19,20. FP has been widely employed in the investigation of molecular interactions for drug discovery and chemical screening21,22,23. In comparison, SPR and NMR assays are expensive and time-consuming, making them less suitable for high-throughput screening (HTS) applications. This protocol describes a receptor-ligand analysis method based on FP with a multi-well plate detection system, enabling the HTS of chemicals.

Choosing the appropriate probe for a receptor binding assay is crucial. The probe should consist of two components: a specific ligand for the nuclear receptor and a fluorescent group. Typically, such probes can be commercially obtained, as exemplified by the C1-BODIPY-C12 probe used in this study. C1-BODIPY-C12 is a fluorescent analog of fatty acid, with the BODIPY fluorescent group incorporated at the C1 position, and is a specific ligand for PPARγ. If a commercially available fluorescent probe is not an option, it should be chemically synthesized by attaching a fluorescent group to a known specific ligand.

The classic structure of a nuclear receptor includes a DNA-binding domain responsible for regulating target gene expression and a ligand-binding domain (LBD), typically located at the receptor's C-terminus24. The coregulator binding site is generally found within the transcriptional activation function domain of the nuclear receptor, where it interacts with nuclear coregulatory factors25. These coregulators can either enhance or suppress the receptor's transcriptional activity, thereby modulating gene expression. The LBD, located in a specific region of the receptor protein, regulates the receptor's conformational changes upon ligand binding, which in turn activates or inhibits its transcriptional activity. Since the LBD is a well-defined domain crucial for recognizing and binding specific small molecule ligands24, only the receptor-LBD was used in the receptor competitive binding assay in this study. This approach, which involved expressing and purifying the ligand-binding domain of PPARγ, reduced assay costs.

The reagents used in this method, including buffers for protein purification, C1-BODIPY-C12 probe, and Tris-HCl, are commercially available and inexpensive, which is a significant advantage for the assay. Fluorescence polarization (FP) detection is performed in a multi-well plate (either 96-well or 384-well), with a rapid read time of 3-5 min per plate, enhancing testing throughput and efficiency. The receptor-ligand binding approach is highly flexible and can be easily adapted to various receptors, provided the receptor proteins are available. This adaptability broadens the scope of research that can be conducted using this method. Overall, the combination of these advantages-ease of use, cost efficiency, high-throughput capacity, rapid processing, and flexibility in receptor adaptation - makes this method a promising option for screening toxic environmental pollutants.

The present results demonstrate that PFOS and TPHP can bind to PPARγ, which is consistent with previous findings from molecular docking and reporter gene assays9,26. Additionally, the method described in this manuscript has been utilized to assess the binding potency of several environmental pollutants with nuclear receptors. For instance, using the FP-based receptor-ligand competitive binding assay, the binding potency of 19 per- and polyfluoroalkyl substances (PFASs) and 7 bisphenol A (BPA) compounds to peroxisome proliferator-activated receptor β/δ (PPARβ/δ)7,10, 12 PFASs to PPARγ9,13, 7 BPA compounds and 3 particulate matter (PM2.5) components to farnesoid X receptor (FXR)11,12, and 8 polybrominated diphenyl ethers (PBDEs) and 6 polychlorinated biphenyls (PCBs) to thyroid receptor (TR)14,15 have been determined. These findings highlight the potential of this method for screening the binding interactions between environmental pollutants and nuclear receptors.

Previous studies have reported fluorescence polarization (FP) assay methods for PPARγ that involve using gel filtration to measure binding, which requires at least 1.5 h to detect the binding of a single compound23. In contrast, this method allows the detection of binding affinities for at least 12 compounds with PPARγ within 10 min. Additionally, some commercially available assay kits (see Table of Materials) are priced at over $3000 for an 800 × 20 µL format. These methods are notably expensive and time-consuming. This study presents improvements over these existing methods.

One potential limitation of this method is that the fluorescence probe must be a ligand for the receptor, and fluorescence probes do not interact with environmental pollutants directly. Therefore, it is crucial to ensure that the probe and environmental pollutants are kept separate in the solution. Additionally, this assay reflects an in vitro situation and cannot fully capture in vivo interactions, as receptors are heterodimeric in vivo27. Consequently, while this method serves as a rapid screening tool, further investigation of receptor activation and related toxicological mechanisms in vivo is necessary.

Another drawback is the "rightward shift" phenomenon observed in fluorescence polarization (FP) assays when evaluating binding affinity, which may lead to a systematic underestimation of the measured affinities. In previous studies, the binding affinity of rosiglitazone with PPARγ was assessed using the time-resolved fluorescence resonance energy transfer (TR-FRET) assay28, which is a highly sensitive method for measuring ligand-receptor binding affinity. However, the TR-FRET assay is relatively time-consuming and cumbersome, requiring a 4 h incubation of the reaction solution at room temperature before detection. Although the FP assay exhibits lower sensitivity compared to the TR-FRET assay, it is more suitable for high-throughput screening of environmental ligands that bind to nuclear receptors. Nevertheless, the FP assay may miss some weak environmental ligands. Additionally, in previous studies, the binding affinity of PFOS with PPARγ was determined using equilibrium dialysis (EqD)29, another highly sensitive method for measuring ligand-receptor binding affinity. However, EqD relies on expensive analytical equipment (LC-MS/MS), which limits its application and precludes high-throughput screening capabilities.

Although this fluorescence polarization (FP) assay exhibits a "right-shift" phenomenon, which may result in generally higher calculated IC50 values, it does not affect the relative affinity ranking or subsequent risk assessment predictions. Furthermore, the FP assay is cost-effective, time-efficient, and capable of screening a wide range of compounds for their affinity towards multiple nuclear receptors. Overall, FP-based high-throughput screening of environmental ligands facilitates the rapid identification of toxic environmental pollutants.

Disclosures

The authors declare that there are no conflicts of interest.

Acknowledgements

This work was supported by the National Natural Science Foundation of China (Grant No. 82103875).

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
C1-BODIPY-C12 ProbeThermo Fisher Scientific, China102209-82-3Binds to PPARγ-LBD and emits fluorescence.
Coomassie Brilliant Blue R-250Solarbio, China6104-59-2Stain the protein bands.
GraphPad prismDotmaticshttps://www.graphpad.com/features
imidazoleSolarbio, ChinaI8090Prepare buffers for the protein purification process.
Isopropyl β-D-1-thiogalactopyranosideSolarbio, China367-93-1Induce the expression of PPARγ-LBD
Microplate readerBiotek , USASynergy H1 Detecting FP value
NaClShanghai Reagent7647-15-5Prepare buffers for the protein purification process.
NaH2PO4 · 2H2OShanghai Reagent13472-35-0Prepare buffers for the protein purification process.
Ni NTA Beads 6FFSmart-Lifesciences, ChinaSA005005Protein purification.
Origin 8.5 OriginLab, Northampton, MA, U.S.A.
Perfluorooctanesulfonic acid (PFOS)J&K Scientific Ltd, China1763-23-1The detected environmental pollutants
Phenylmethylsulfonyl fluoride (PMSF)Solarbio, ChinaP0100Inhibit protein degradation.
PPARγ-Competitor Assay KitThermo Fisher ScientificPV6136https://www.thermofisher.com/order/catalog/product/PV6136
PPARγ-LBD Ligand Screening Assay KitCayman600616https://www.caymanchem.com/product/600616
Rosiglitazone (Rosi)aladdin, China122320-73-4The agonists of PPARγ
ShakerZHICHENG, ChinaZWY-211CBacterial culture expansion and induction of protein expression
Triphenyl phosphate (TPHP)Macklin, ChinaT819317The detected environmental pollutants
TrisSolarbio, ChinaT8230Prepare buffers for the protein purification process.
TryptoneOXOID Limited, ChinaLP0042BPrepare Lysogeny Broth (LB) medium.
Ultrasonic CleanerKimberly, ChinaLHO-1Disrupt the bacteria to achieve complete lysis
UreaSolarbio, ChinaU8020Prepare buffers for the protein purification process.
Yeast extractOXOID Limited, ChinaLP0021BPrepare Lysogeny Broth (LB) medium.

References

  1. Maddela, N. R., Ramakrishnan, B., Dueñas-Rivadeneira, A. A., Venkateswarlu, K., Megharaj, M. Chemicals/materials of emerging concern in farmlands: sources, crop uptake, and potential human health risks. Environ Sci Process Impacts. 24 (12), 2217-2236 (2022).
  2. Naidu, R., et al. Chemical pollution: A growing peril and potential catastrophic risk to humanity. Environ Int. 156, 106616(2021).
  3. Ryu, H., Li, B., De Guise, S., McCutcheon, J., Lei, Y. Recent progress in the detection of emerging contaminants PFASs. J Hazard Mater. 408, 124437(2021).
  4. Alofe, O., et al. Determining the endocrine disruption potential of industrial chemicals using an integrative approach: Public databases, in vitro exposure, and modeling receptor interactions. Environ Int. 131, 104969(2019).
  5. Bajard, L., et al. Endocrine disrupting potential of replacement flame retardants - Review of current knowledge for nuclear receptors associated with reproductive outcomes. Environ Int. 153, 106550(2021).
  6. Chen, Q., Chou, W. C., Lin, Z. Integration of toxicogenomics and physiologically based pharmacokinetic modeling in human health risk assessment of perfluorooctane sulfonate. Environ Sci Technol. 56 (6), 3623-3633 (2022).
  7. Li, C. H., Ren, X. M., Cao, L. Y., Qin, W. P., Guo, L. H. Investigation of binding and activity of perfluoroalkyl substances to the human peroxisome proliferator-activated receptor β/δ. Environ Sci Process Impacts. 21 (11), 1908-1914 (2019).
  8. Li, C. H., et al. Chlorinated polyfluorinated ether sulfonates exhibit higher activity toward peroxisome proliferator-activated receptors signaling pathways than perfluorooctanesulfonate. Environ Sci Technol. 52 (5), 3232-3239 (2018).
  9. Li, C. H., Shi, Y. L., Li, M., Guo, L. H., Cai, Y. Q. Receptor-bound perfluoroalkyl carboxylic acids dictate their activity on human and mouse peroxisome proliferator-activated receptor γ. Environ Sci Technol. 54 (15), 9529-9536 (2020).
  10. Li, C. H., Zhang, D. H., Jiang, L. D., Qi, Y., Guo, L. H. Binding and activity of bisphenol analogues to human peroxisome proliferator-activated receptor β/δ. Ecotoxicol Environ Saf. 226, 112849(2021).
  11. Zhang, D., et al. Binding activity and risk assessment of bisphenols toward farnesoid X receptor pathway: In vitro and in silico study. Sci Total Environ. 869, 161701(2023).
  12. Zhang, D., et al. Fine particulate matter disrupts bile acid homeostasis in hepatocytes via binding to and activating farnesoid X receptor. Toxicology. 506, 153850(2024).
  13. Li, C. H., Ren, X. M., Guo, L. H. Adipogenic activity of oligomeric hexafluoropropylene oxide (perfluorooctanoic acid alternative) through peroxisome proliferator-activated receptor γ pathway. Environ Sci Technol. 53 (6), 3287-3295 (2019).
  14. Qin, W. P., Li, C. H., Guo, L. H., Ren, X. M., Zhang, J. Q. Binding and activity of polybrominated diphenyl ether sulfates to thyroid hormone transport proteins and nuclear receptors. Environ Sci Process Impacts. 21 (6), 950-956 (2019).
  15. Ren, X. M., Li, C. H., Zhang, J. Q., Guo, L. H. Binding and activity of sulfated metabolites of lower-chlorinated polychlorinated biphenyls towards thyroid hormone receptor alpha. Ecotoxicol Environ Saf. 180, 686-692 (2019).
  16. Evans, N., et al. In vitro activity of a panel of per- and polyfluoroalkyl substances (PFAS), fatty acids, and pharmaceuticals in peroxisome proliferator-activated receptor (PPAR) alpha, PPAR gamma, and estrogen receptor assays. Toxicol Appl Pharmacol. 449, 116136(2022).
  17. Kim, S., et al. Triphenyl phosphate is a selective PPARγ modulator that does not induce brite adipogenesis in vitro and in vivo. Arch Toxicol. 94 (9), 3087-3103 (2020).
  18. Matsumoto, H., Haniu, H., Komori, N. Determination of protein molecular weights on SDS-PAGE. Methods Mol Biol. 1855, 101-105 (2019).
  19. Nguyen, H. H., Park, J., Kang, S., Kim, M. Surface plasmon resonance: A versatile technique for biosensor applications. Sensors (Basel). 15 (5), 10481-10510 (2015).
  20. Hu, J., Kim, J., Hilty, C. Detection of protein-ligand interactions by 19F nuclear magnetic resonance using hyperpolarized water. J Phys Chem Lett. 13 (17), 3819-3823 (2022).
  21. LeBlanc, E. V., Shekhar-Guturja, T., Whitesell, L., Cowen, L. E. Fluorescence polarization-based measurement of protein-ligand interaction in fungal cell lysates. Curr Protoc. 1 (1), e17(2021).
  22. Huang, X., Aulabaugh, A. Application of fluorescence polarization in HTS assays. Methods Mol Biol. 1439, 115-130 (2016).
  23. Seethala, R., et al. A rapid homogeneous fluorescence polarization binding assay for peroxisome proliferator-activated receptors alpha and gamma using a fluorescein-tagged dual PPARalpha/gamma activator. Anal Biochem. 363 (2), 263-274 (2007).
  24. Hu, W., et al. Activation of peroxisome proliferator-activated receptor gamma and disruption of progesterone synthesis of 2-ethylhexyl diphenyl phosphate in human placental choriocarcinoma cells: Comparison with triphenyl phosphate. Environ Sci Technol. 51 (7), 4061-4068 (2017).
  25. Weatherman, R. V., Fletterick, R. J., Scanlan, T. S. Nuclear-receptor ligands and ligand-binding domains. Annu Rev Biochem. 68, 559-581 (1999).
  26. Khazaee, M., et al. Perfluoroalkyl acid binding with peroxisome proliferator-activated receptors α, γ, and δ and fatty acid binding proteins by equilibrium dialysis with a comparison of methods. Toxics. 9 (3), 45(2021).
  27. de Vera, I. M. S., et al. Synergistic regulation of coregulator/nuclear receptor interaction by ligand and DNA. Structure. 25 (10), 1506-1518.e4 (2017).
  28. Hendrickson, O. D., Taranova, N. A., Zherdev, A. V., Dzantiev, B. B., Eremin, S. A. Fluorescence polarization-based bioassays: New horizons. Sensors (Basel). 20 (24), 7132(2020).
  29. Liu, C., et al. Identification of a novel selective agonist of PPARγ with no promotion of adipogenesis and less inhibition of osteoblastogenesis. Sci Rep. 5, 9530(2015).

Reprints and Permissions

Tags

Receptor Ligand BindingFluorescence PolarizationMicroplate ReaderProtein ExpressionCompetitive BindingPPAR Gamma

This article has been published

Video Coming Soon