This protocol describes a high-throughput screening system that uses fluorescence polarization of a specific fluorescent probe binding to a nuclear receptor as a readout for screening environmental pollutants.
Method Article
This protocol describes a high-throughput screening system that uses fluorescence polarization of a specific fluorescent probe binding to a nuclear receptor as a readout for screening environmental pollutants.
Increasing levels of compounds have been detected in the environment, causing widespread pollution and posing risks to human health. However, despite their high environmental occurrence, there is very limited information regarding their toxicological effects. It is urgent to develop high-throughput screening (HTS) methods to guide toxicological studies. In this study, a receptor-ligand binding assay using an HTS system was developed to determine the binding potency of environmental pollutants on nuclear receptors. The test is conducted using a microplate reader (i.e., a 96-well plate containing various chemicals) by measuring the fluorescence polarization (FP) of a specific fluorescent probe. This assay consists of four parts: the construction and transformation of recombinant vectors, the expression and purification of the receptor protein (ligand-binding domain), receptor-probe binding, and competitive binding of chemicals with the receptor. The binding potency of two environmental pollutants, perfluorooctanesulfonic acid (PFOS) and triphenyl phosphate (TPHP), with peroxisome proliferator-activated receptor gamma (PPARγ) was determined to illustrate the assay procedure. Finally, the advantages and disadvantages of this method and its potential applications were also discussed.
A large number of chemicals have been widely detected in the environment and human bodies, raising significant concerns about their impact on the ecological environment and human health1,2,3. Despite their high environmental occurrence, information regarding their toxicological effects is scarce. Therefore, it is urgent to develop high-throughput screening (HTS) methods to facilitate the assessment of chemical toxicity.
Several high-throughput screening (HTS) methods have been reported for chemical toxicity assessment, such as the HTS bioassays used in the Tox21 and ToxCast programs4,5. These methods can rapidly identify potential toxicants and provide valuable information on the mechanisms of chemical toxicity. However, these HTS bioassays mainly rely on cell-based systems, which can be complex and expensive. Additionally, high-throughput sequencing methods have also been used for chemical toxicity assessment, but achieving high-throughput evaluation of chemicals remains challenging6. Previous studies have developed fluorescence polarization (FP)-based receptor-ligand competitive binding assays to determine the binding potency of several environmental pollutants, including per- and polyfluoroalkyl substances (PFAS)7,8,9, bisphenol A (BPA)10,11, and particulate matter (PM)12, with nuclear receptors such as peroxisome proliferator-activated receptor (PPAR)7,8,9,10,13, farnesoid X receptor (FXR)11,12, and thyroid receptor (TR)14,15. This approach is efficient, cost-effective, and provides mechanistic insights.
In this study, the protocol for the receptor-ligand binding assay is described based on detecting the fluorescence polarization (FP) of a small fluorescent probe. The principle of the FP-based receptor-ligand binding assay is illustrated in Figure 1. When a small fluorescent molecule is excited by plane-polarized light, the emitted light becomes highly depolarized due to rapid molecular rotation. However, when the tracer binds to a larger receptor, its rotation is slowed. A high FP value is detected when the tracer is bound to the large receptor, whereas a low FP value is observed when the tracer is free. Peroxisome proliferator-activated receptor gamma (PPARγ) was purified for the binding of the probe to the receptor. Rosiglitazone (Rosi), perfluorooctanesulfonic acid (PFOS), and triphenyl phosphate (TPHP) were used to compete for the binding of the probe with the receptor. Rosi, a specific agonist of PPARγ, was used as a positive control in the receptor competitive binding assays. Additionally, PFOS and TPHP have been previously identified as weak agonists of PPARγ in past studies8,9,10,11,12,13,14,15,16,17. Furthermore, they belong to different structural categories of compounds known for environmental exposure and are notable for their relatively high detection rates in human populations. These compounds were used to further validate the broad applicability of the competition binding assay. The procedure consists of four steps: construction and transformation of recombinant vectors, expression and purification of the receptor protein (ligand-binding domain), receptor-probe binding, and competitive binding of chemicals with the receptor.
The details of the reagents and the equipment are listed in the Table of Materials.
1. Construction and transformation of recombinant vectors
NOTE: PPARγ is a ligand-dependent transcription factor with a classical nuclear receptor structure, comprising a DNA-binding domain that regulates target genes and a ligand-binding domain activated by ligands. Upon ligand activation, PPARγ forms a heterodimer with another nuclear receptor, retinoid X receptor (RXR), and binds to response elements of PPARγ, thereby regulating the transcription of downstream target genes9,16.
2. Expression and purification of the receptor protein
3. Receptor binding assay
NOTE: In this assay, C1-BODIPY-C12 was used as a site-specific fluorescent probe to establish the receptor-ligand binding system. C1-BODIPY-C12, a specific ligand for PPARγ, is a fluorescent analog of fatty acid with the BODIPY fluorescent group incorporated into the fatty acid at the C1 position.
4. Competitive binding assay
NOTE: In this assay, 800 nM of human PPARγ-LBD and 50 nM C1-BODIPY-C12 probe were used for receptor binding. Rosiglitazone (Rosi), triphenyl phosphate (TPHP), and perfluorooctanesulfonic acid (PFOS) were used to compete with the binding of the probe to PPARγ.
Protein expression and purification of PPARγ-LBD
PPARγ-LBD was heterologously expressed in BL21 (DE3) as a histidine-tagged protein. The protein was detected in the soluble fractions, and the purified PPARγ-LBD showed a single band on SDS-PAGE with an apparent molecular weight of approximately 34.9 kDa (Figure 2), consistent with the predicted molecular weight of the protein.
The binding of C1-BODIPY-C12 probe to PPARγ-LBD
In the receptor binding assay, C1-BODIPY-C12, a BODIPY-labeled fatty acid that can bind to PPARγ-LBD, was used as a fluorescence probe to study the binding potency of environmental pollutants with hPPARγ-LBD. As shown in Figure 3A, the fluorescence polarization (FP) values increased from 20 to 250 upon the addition of PPARγ-LBD, indicating the binding of C1-BODIPY-C12 to the receptor. The binding curve reached saturation at 800 nM PPARγ-LBD, with a dissociation constant (Kd) of 253.5 nM ± 10.05 nM. Therefore, 800 nM PPARγ-LBD was chosen for the subsequent competitive binding assays.
The competitive binding of environmental pollutants to PPARγ-LBD
Rosiglitazone (Rosi), a specific agonist of PPARγ, was used as a positive control to displace the fluorescent probe in the competitive ligand binding assays. As shown in Figure 3B, Rosi inhibited the binding of the C1-BODIPY-C12 probe to PPARγ-LBD in a dose-dependent manner, with an IC50 of 6.89 µM, demonstrating the feasibility of the assay. Next, the binding affinities of TPHP and PFOS to PPARγ-LBD were determined. As shown in Figure 3C,D, TPHP and PFOS also inhibited the binding of the C1-BODIPY-C12 probe to PPARγ-LBD in a dose-dependent manner, with IC50 values of 60.45 µM and 37.27 µM, respectively.

Figure 1: Schematic illustration of fluorescence polarization (FP)-based receptor competitive binding assays. Please click here to view a larger version of this figure.

Figure 2: SDS-PAGE analysis of the purified PPARγ-LBD. M is the protein molecular weight marker. Cl is the cell lysate, FT is the flow-through fraction, W1-W6 are the wash solutions, E1 is the eluate, and E2-E4 are the purified PPARγ-LBD proteins. Please click here to view a larger version of this figure.

Figure 3: Fluorescence polarization (FP)-based receptor binding curve and competitive binding curves. (A) FP-based binding curve of C1-BODIPY-C12 to human PPARγ-LBD. (B-D) FP-based competitive binding curves of Rosi, TPHP, and PFOS to Human PPARγ-LBD. Error bars denote the standard deviation (SD) for three independent experiments. Please click here to view a larger version of this figure.
| ID | seq | ||
| pET28a-Human PPARG-P1 | CAAATGGGTCGCGGATCCATGATCGACCAGCTGAATCCAGAGTCC | ||
| pET28a-Human PPARG-P2 | GTGGTGGTGGTGCTCGAGTCAGTACAAGTCCTTGTAGATCTC | ||
| PPARγ-LBD nucleotide sequence | AGACGACATTCCCTCTAGAATAATTTTGTTTAACTTTAAGAAGGAGAT ATACCATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCCTG GTGCCGCGCGGCAGCCATATGGCTAGCATGACTGGTGGACAGCAAA TGGGTCGCGGATCCATGATCGACCAGCTGAATCCAGAGTCCGCTGAC CTCCGGGCCCTGGCAAAACATTTGTATGACTCATACATAAAGTCCTTCC CGCTGACCAAAGCAAAGGCGAGGGCGATCTTGACAGGAAAGACAACA GACAAATCACCATTCGTTATCTATGACATGAATTCCTTAATGATGGGAGA AGATAAAATCAAGTTCAAACACATCACCCCCCTGCAGGAGCAGAGCAA AGAGGTGGCCATCCGCATCTTTCAGGGCTGCCAGTTTCGCTCCGTGG AGGCTGTGCAGGAGATCACAGAGTATGCCAAAAGCATTCCTGGTTTTG TAAATCTTGACTTGAACGACCAAGTAACTCTCCTCAAATATGGAGTCCA CGAGATCATTTACACAATGCTGGCCTCCTTGATGAATAAAGATGGGGT TCTCATATCCGAGGGCCAAGGCTTCATGACAAGGGAGTTTCTAAAG AGCCTGCGAAAGCCTTTTGGTGACTTTATGGAGCCCAAGTTTGAGT TTGCTGTGAAGTTCAATGCACTGGAATTAGATGACAGCGACTTGGCAA TATTTATTGCTGTCATTATTCTCAGTGGAGACCGCCCAGGTTTGCTGAA TGTGAAGCCCATTGAAGACATTCAAGACAACCTGCTACAAGCCCTGG AGCTCCAGCTGAAGCTGAACCACCCTGAGTCCTCACAGCTGTTTG CCAAGCTGCTCCAGAAAATGACAGACCTCAGACAGATTGTCACGGA ACACGTGCAGCTACTGCAGGTGATCAAGAAGACGGAAACCGACATG AGTCTTCACCCGCTCCTGCAGGAGATCTACAAGGACTTGGACTGG CTCGAGGCCACCCACCC | ||
Table 1: The primer and nucleotide sequence of PPARγ ligand-binding domain.
| Experimental Reagents names | Volume/Dose |
| pET28a-Human PPARG-P1 | 1 μL |
| pET28a-Human PPARG-P2 | 1 μL |
| 2×phanta Max Master Mix | 12.5 μL |
| cDNA | 2 μL |
| ddH2O | 8.5 μL |
Table 2: PCR experimental reagent system.
| Experiment names | Temperature | Time |
| Pre-denaturation | 95 °C | 3 min |
| Denaturation | 95 °C | 15 s |
| Annealing | 65 °C | 15 s |
| Extension | 72 °C | 6 min |
| Store | 12 °C | -- |
Table 3: PCR experimental reaction program.
Fluorescence polarization (FP), surface plasmon resonance (SPR), and nuclear magnetic resonance (NMR) are common techniques used for assessing direct binding interactions between proteins and compounds19,20. FP has been widely employed in the investigation of molecular interactions for drug discovery and chemical screening21,22,23. In comparison, SPR and NMR assays are expensive and time-consuming, making them less suitable for high-throughput screening (HTS) applications. This protocol describes a receptor-ligand analysis method based on FP with a multi-well plate detection system, enabling the HTS of chemicals.
Choosing the appropriate probe for a receptor binding assay is crucial. The probe should consist of two components: a specific ligand for the nuclear receptor and a fluorescent group. Typically, such probes can be commercially obtained, as exemplified by the C1-BODIPY-C12 probe used in this study. C1-BODIPY-C12 is a fluorescent analog of fatty acid, with the BODIPY fluorescent group incorporated at the C1 position, and is a specific ligand for PPARγ. If a commercially available fluorescent probe is not an option, it should be chemically synthesized by attaching a fluorescent group to a known specific ligand.
The classic structure of a nuclear receptor includes a DNA-binding domain responsible for regulating target gene expression and a ligand-binding domain (LBD), typically located at the receptor's C-terminus24. The coregulator binding site is generally found within the transcriptional activation function domain of the nuclear receptor, where it interacts with nuclear coregulatory factors25. These coregulators can either enhance or suppress the receptor's transcriptional activity, thereby modulating gene expression. The LBD, located in a specific region of the receptor protein, regulates the receptor's conformational changes upon ligand binding, which in turn activates or inhibits its transcriptional activity. Since the LBD is a well-defined domain crucial for recognizing and binding specific small molecule ligands24, only the receptor-LBD was used in the receptor competitive binding assay in this study. This approach, which involved expressing and purifying the ligand-binding domain of PPARγ, reduced assay costs.
The reagents used in this method, including buffers for protein purification, C1-BODIPY-C12 probe, and Tris-HCl, are commercially available and inexpensive, which is a significant advantage for the assay. Fluorescence polarization (FP) detection is performed in a multi-well plate (either 96-well or 384-well), with a rapid read time of 3-5 min per plate, enhancing testing throughput and efficiency. The receptor-ligand binding approach is highly flexible and can be easily adapted to various receptors, provided the receptor proteins are available. This adaptability broadens the scope of research that can be conducted using this method. Overall, the combination of these advantages-ease of use, cost efficiency, high-throughput capacity, rapid processing, and flexibility in receptor adaptation - makes this method a promising option for screening toxic environmental pollutants.
The present results demonstrate that PFOS and TPHP can bind to PPARγ, which is consistent with previous findings from molecular docking and reporter gene assays9,26. Additionally, the method described in this manuscript has been utilized to assess the binding potency of several environmental pollutants with nuclear receptors. For instance, using the FP-based receptor-ligand competitive binding assay, the binding potency of 19 per- and polyfluoroalkyl substances (PFASs) and 7 bisphenol A (BPA) compounds to peroxisome proliferator-activated receptor β/δ (PPARβ/δ)7,10, 12 PFASs to PPARγ9,13, 7 BPA compounds and 3 particulate matter (PM2.5) components to farnesoid X receptor (FXR)11,12, and 8 polybrominated diphenyl ethers (PBDEs) and 6 polychlorinated biphenyls (PCBs) to thyroid receptor (TR)14,15 have been determined. These findings highlight the potential of this method for screening the binding interactions between environmental pollutants and nuclear receptors.
Previous studies have reported fluorescence polarization (FP) assay methods for PPARγ that involve using gel filtration to measure binding, which requires at least 1.5 h to detect the binding of a single compound23. In contrast, this method allows the detection of binding affinities for at least 12 compounds with PPARγ within 10 min. Additionally, some commercially available assay kits (see Table of Materials) are priced at over $3000 for an 800 × 20 µL format. These methods are notably expensive and time-consuming. This study presents improvements over these existing methods.
One potential limitation of this method is that the fluorescence probe must be a ligand for the receptor, and fluorescence probes do not interact with environmental pollutants directly. Therefore, it is crucial to ensure that the probe and environmental pollutants are kept separate in the solution. Additionally, this assay reflects an in vitro situation and cannot fully capture in vivo interactions, as receptors are heterodimeric in vivo27. Consequently, while this method serves as a rapid screening tool, further investigation of receptor activation and related toxicological mechanisms in vivo is necessary.
Another drawback is the "rightward shift" phenomenon observed in fluorescence polarization (FP) assays when evaluating binding affinity, which may lead to a systematic underestimation of the measured affinities. In previous studies, the binding affinity of rosiglitazone with PPARγ was assessed using the time-resolved fluorescence resonance energy transfer (TR-FRET) assay28, which is a highly sensitive method for measuring ligand-receptor binding affinity. However, the TR-FRET assay is relatively time-consuming and cumbersome, requiring a 4 h incubation of the reaction solution at room temperature before detection. Although the FP assay exhibits lower sensitivity compared to the TR-FRET assay, it is more suitable for high-throughput screening of environmental ligands that bind to nuclear receptors. Nevertheless, the FP assay may miss some weak environmental ligands. Additionally, in previous studies, the binding affinity of PFOS with PPARγ was determined using equilibrium dialysis (EqD)29, another highly sensitive method for measuring ligand-receptor binding affinity. However, EqD relies on expensive analytical equipment (LC-MS/MS), which limits its application and precludes high-throughput screening capabilities.
Although this fluorescence polarization (FP) assay exhibits a "right-shift" phenomenon, which may result in generally higher calculated IC50 values, it does not affect the relative affinity ranking or subsequent risk assessment predictions. Furthermore, the FP assay is cost-effective, time-efficient, and capable of screening a wide range of compounds for their affinity towards multiple nuclear receptors. Overall, FP-based high-throughput screening of environmental ligands facilitates the rapid identification of toxic environmental pollutants.
The authors declare that there are no conflicts of interest.
This work was supported by the National Natural Science Foundation of China (Grant No. 82103875).
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| C1-BODIPY-C12 Probe | Thermo Fisher Scientific, China | 102209-82-3 | Binds to PPARγ-LBD and emits fluorescence. |
| Coomassie Brilliant Blue R-250 | Solarbio, China | 6104-59-2 | Stain the protein bands. |
| GraphPad prism | Dotmatics | https://www.graphpad.com/features | |
| imidazole | Solarbio, China | I8090 | Prepare buffers for the protein purification process. |
| Isopropyl β-D-1-thiogalactopyranoside | Solarbio, China | 367-93-1 | Induce the expression of PPARγ-LBD |
| Microplate reader | Biotek , USA | Synergy H1 | Detecting FP value |
| NaCl | Shanghai Reagent | 7647-15-5 | Prepare buffers for the protein purification process. |
| NaH2PO4 · 2H2O | Shanghai Reagent | 13472-35-0 | Prepare buffers for the protein purification process. |
| Ni NTA Beads 6FF | Smart-Lifesciences, China | SA005005 | Protein purification. |
| Origin 8.5 | OriginLab, Northampton, MA, U.S.A. | ||
| Perfluorooctanesulfonic acid (PFOS) | J&K Scientific Ltd, China | 1763-23-1 | The detected environmental pollutants |
| Phenylmethylsulfonyl fluoride (PMSF) | Solarbio, China | P0100 | Inhibit protein degradation. |
| PPARγ-Competitor Assay Kit | Thermo Fisher Scientific | PV6136 | https://www.thermofisher.com/order/catalog/product/PV6136 |
| PPARγ-LBD Ligand Screening Assay Kit | Cayman | 600616 | https://www.caymanchem.com/product/600616 |
| Rosiglitazone (Rosi) | aladdin, China | 122320-73-4 | The agonists of PPARγ |
| Shaker | ZHICHENG, China | ZWY-211C | Bacterial culture expansion and induction of protein expression |
| Triphenyl phosphate (TPHP) | Macklin, China | T819317 | The detected environmental pollutants |
| Tris | Solarbio, China | T8230 | Prepare buffers for the protein purification process. |
| Tryptone | OXOID Limited, China | LP0042B | Prepare Lysogeny Broth (LB) medium. |
| Ultrasonic Cleaner | Kimberly, China | LHO-1 | Disrupt the bacteria to achieve complete lysis |
| Urea | Solarbio, China | U8020 | Prepare buffers for the protein purification process. |
| Yeast extract | OXOID Limited, China | LP0021B | Prepare Lysogeny Broth (LB) medium. |
Request permission to reuse the text or figures of this JoVE article
Request Permission