A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Enhanced Gene Delivery and Expression using Intraosseous Injection of Chitosan Nanoparticles Encapsulated Adenine Base Editor Plasmids

1.1K views

DOI:

10.3791/68181

May 16th, 2025

* These authors contributed equally

In This Article

Summary

Here, we present a gene therapy approach that delivers ABE-coated chitosan directly to the bone marrow by intraosseous injection.

Abstract

The delivery of exogenous plasmids into experimental animals is crucial in biomedical research, including the investigation of gene functions, the elucidation of disease mechanisms, and the assessment of drug efficacy. However, the transfection efficiency of the current method is relatively low, and the introduction of plasmids for long-term gene expression may be affected by the immune system. To address these limitations, we developed and investigated a novel method that utilizes chitosan to encapsulate adenine base editor (ABE) plasmids and then directly deliver the complex to the bone marrow of mice by intraosseous injection. In this study, to target the CaMK II δ gene, which is closely related to osteoclast differentiation, we utilized chitosan to encapsulate ABE CaMK II δ plasmids. We directly injected the plasmid cargo into the bone marrow cavity by intraosseous injection. Results showed a high in vivo editing efficiency of 14.27% at the A1 locus and 10.69% at the A2 locus in recipient mice. This novel strategy is not only particularly suitable for diseases caused by abnormal osteoclast function but also holds significant potential for advancing the field of gene therapy.

Introduction

Gene therapy has emerged as a promising approach in the field of biomedical research1,2. It offers the potential to treat a variety of disorders by introducing foreign plasmids in experimental animals to modulate the expression of specific genes and study their therapeutic effects. However, conventional delivery methods have encountered some problems that limit their effectiveness and safety3. The concerns include low transfection efficiency, high biological damage, and low gene expression efficiency. Therefore, it is necessary to establish a novel delivery method for gene therapy that can overcome these limitations.

Chitosan is a natural polysaccharide with good biodegradability and biocompatibility4,5,6, which makes it easy to degrade in animal bodies without causing serious biological toxicity. It has been widely used in drug delivery due to its high drug embedding rate7,8, enhanced delivery efficiency, and reduced damage to animals.

ABE gene editing technology, which allows direct base pairs conversion of A-T to G-C, is promising in genetic and medical research. Compared to the current mainstream gene editing technology, ABE technology can achieve accurate single base mutation, thus reducing editing of non-target DNA sequences, reducing off-target effects9,10, and leading to zero DNA double-strand breaks11, which greatly reduces the risk of gene editing12. ABE technology is also highly biocompatible and is more suitable for disease treatment research.

Tail vein injection is a common method used for in vivo delivery of plasmids, especially in gene therapy. The target gene for this study is CaMK II δ, which is closely related to osteoclast differentiation13,14. The use of intraosseous injection instead of the tail vein allows the edited plasmid to enter the osteoclasts directly into the bone marrow. This direct transmission to the bone marrow increases the efficiency and stability of gene expression, which is advantageous for the treatment of diseases related to osteoclast dysfunction.

Here, we present a novel method that involves encapsulating the ABE plasmid with chitosan and then directly introducing the complex into mice by intraosseous injection. Through this method, we hope to pave the way for more effective gene therapy treatments for foreign plasmids entering organisms, especially diseases related to osteoclast dysfunction.

Access restricted. Please log in or start a trial to view this content.

Protocol

All animal experiments described were approved by the Animal Health Committee of Anhui University on the Use and Care of Animals. In this study, ABE was generously donated by Professor Tian Chi (Shanghai University of Science and Technology, Shanghai, China ; Figure 1D).

1. ABE plasmid construction

  1. Design gRNA with the sequence TCCATGATGCACAGACAGGA where PAM is presented by GAC.
  2. According to the company's primer list guide, add the primer to the corresponding volume of ddH2O to achieve a concentration of 100 µM. Then, shake and mix thoroughly to ensure even distribution. For the annealing reaction, prepare a 10 µM solution by adding 10 µL of the stock primer solution to the new microcentrifuge tube, 90 µL of ddH2O, and mix well.
  3. Add 5 µL of upstream primer, 5 µL of downstream primer, and 40 µL of ddH2O in a microcentrifuge tube. To facilitate the annealing reaction, immerse the tube into a container filled with boiling water for 5 min. Ensure that the water level does not reach the opening of the tube to prevent water from entering and contaminating the primers. Cool down to room temperature to complete the annealing reaction.
  4. Add 2 µg pLKO5.sgRNA.EFS.tRFP (Figure 1D), 1 µL of ESP3I, 4 µL of buffer, and 33 µL of ddH2O into a microcentrifuge tube and allow to react in a constant temperature water bath at 37 °C for 45 min.
  5. Perform agarose gel electrophoresis. Prepare a 1% agarose gel by weighing 0.5 g agarose and pour it into a glass bottle. Add 50 mL of 1x TAE buffer into the glass bottle and shake to dissolve the agarose powder. Heat in the microwave oven for 2 min until completely melted. Add 5 µL of YeaRed Nucleic Acid Gel Stain, mix thoroughly, and pour into the gel mold; after the gel solidifies, start adding the samples.
    NOTE: To prepare 1xTAE, use the reagents listed in Table 1.
  6. Add 1x TAE to the electrophoresis tank and put in the configured agarose gel block, which should be immersed in TAE. Add 5 µL of 1x loading buffer to the digestion product from step 1.4 and mix. Add the sample to the gel. In addition, add 6 µL of marker to the gel as well.
  7. Run the electrophoresis program at a constant voltage of 110 V for 35 min. After electrophoresis, determine the position of the band in the sample according to the marker and cut the gel strip with a clean blade for gel recovery.
  8. Perform the gel recovery operation according to the gel maxi purification kit instructions. Set a water bath to 50 °C. Add the corresponding volume of PN solution to the tube containing the cut gel as per the kit. Poke the gel with a pipette tip to facilitate dissolution and then put it in the water bath. Shake the tube every once in a while and observe the dissolution process until the gel block is completely dissolved.
  9. Take a spin column, CA3, from the kit. Add 500 µL of BL solution from the kit into the spin column and centrifuge it at 2,000 x g for 1 min to equilibrate the column. After centrifugation, remove the waste liquid at the bottom of the collection tube and put the adsorption column back into the collection tube.
  10. Continue centrifugation at 2,000 x g for 1 min. Discard the waste liquid at the bottom of the centrifuge tube, add 600 µL of PN solution, and centrifuge 2,000 x g for 30 s; discard the waste liquid again. Repeat the operation and again discard the waste liquid.
  11. After centrifugation, replace the 2 mL collection tube with a new 1.5 mL tube. Open the cover and let dry in a ventilated place for 30 min to remove the ethanol completely. Then, add preheated 40 µL of ddH2O, centrifuge, and elute the required DNA.
    NOTE: PN should be added with anhydrous ethanol according to the instructions. The use of preheated water can increase the yield.
  12. Add 7 µL of annealing product from step 1.3, 3 µL of gel recovery product from step 1.11, 1 µL of T4 DNA Ligase, 2 µL of 10x T4 Ligase Buffer, and 7 µL of ddH2O into a microcentrifuge tube, and keep overnight at 16 °C to obtain the ligation product.
  13. Add 10 µL of ligation product and 70 µL of DH5α in a microcentrifuge tube on ice for 30 min. Set the water bath to 42 °C. After the ice bath, put the tube into the water bath for 90 s and then again on ice for 2 min.
  14. Add 600 µL of Luria-Bertani (LB) liquid medium to the tube and shake on a shaker for 30 min. At the same time, irradiate an LB solid medium plate inside a laminar flow cabinet for 30 min. After the incubation, evenly distribute 100 µL of the solution on the plate. After coating, place the plate upside down in a 37 °C bacterial incubator for culture.
    NOTE: DH5α is usually stored at -80 °C. LB solid medium is prepared using the reagents listed in Table 2. LB liquid medium is prepared using the reagents listed in Table 3.
  15. Select a single colony and expand the bacterial colony for 14 h on a fresh plate. Take a 50 mL centrifuge tube, add 50 mL of LB liquid medium, add 50 µL of ampicillin at a 1:1000 ratio, and mix well. Divide this into new tubes at 15 mL per tube.
  16. Check the culture plate for round white colonies with good growth. Select these with a 10 µL pipette and transfer them to the LB medium. Culture this in a shaker for 12 h and then send this sample for sequencing.
  17. Compare the sequencing results with the target gRNA to identify the strain with the matching sequence, Camk II δ-sgRNA, as the target strain, and then extract the plasmid.
  18. Perform plasmid extraction according to the instructions of the mini plasmid kit. Add 500 µL of BL to the adsorption column CP3, centrifuge for 1 min at 2,000 x g, and discard the waste liquid. Put the adsorption column back into the collection tube. Add 500 µL of bacterial solution and centrifuge at 4,000 x g for 10 min.
  19. Collect the flow through. Centrifuge again, and after removing the supernatant, add 250 µL of P1 to the centrifuge tube with bacterial precipitation and then transfer it to a microcentrifuge tube and vortex. Add 250 µL of P2 and gently invert for 6x-8x. Add 350 µL of P3 and again gently invert for 6x-8x. White flocculent precipitate appears.
  20. Centrifuge for 10 min at 2,000 x g. Transfer the supernatant to a new adsorption column CP3, centrifuge at 2,000 x g for 30 s, and remove the waste liquid. Add 600 µL of PW, centrifuge again at 2,000 x g for 30 s, and remove the waste liquid. Add 600 µL of PW again, centrifuge at 2,000 x g for 30 s, and remove the waste liquid.
  21. Place the adsorption column in the collection tube and centrifuge for 2 min at 2,000 x g to remove residual PW. Then, place the adsorption column in a clean microcentrifuge tube, allow it to dry for 30 min, and add 35 µL of preheated ddH2O to the middle of the adsorption film, then store the resulting product in -20 °C for subsequent tests.
    NOTE: PW should be added with anhydrous ethanol according to the instructions. The use of preheated water can increase the yield.

2. Marrow cell extraction

  1. Select KM mice aged 8-9 weeks (mice other than KM strains are also acceptable), male, and weighing about 30 g. Fix the mice in the left hand with the head facing down and inject 150 µL of 1% Pentobarbital sodium from the side of the abdomen with a syringe using the right hand. Confirm anesthesia by toe pinch.
    NOTE: Follow local institutional guidelines for an appropriate anesthetic regimen.
  2. Perform cervical dislocation of mice, remove the tibia with surgical scissors and tweezers, and strip away the surrounding excess muscle tissue. Soak the removed tibia in PBS and wash, leaving only clean bones.
  3. Take 1 mL of PBS in a syringe to flush bone marrow cells from one end of the tibia until the bone is white.
  4. Collect cell suspension and centrifuge at 800 x g at 4 °C for 5 min. After removing the supernatant, lyse the red blood cells with 500 µL of red cell lysate. After 1 min, add 1 mL of separation buffer to terminate the red cell lysate. After centrifuging at 800 x g at 4 °C for 5 min, remove the supernatant and place the cells on ice for later use.
    NOTE: If the red blood cells are completely lysed, the cells precipitate, and no red cells are visible. If the red cells can still be seen, they can be lysed again, but the incubation time should not be too long to avoid damage to other cells.

3. Chitosan transfection

  1. Chitosan preparation: Weigh 4 mg chitosan and dissolve in 20 mL of 0.2 mg/mL acetic acid solution. Adjust pH to 5.5 with 10 M NaOH. Take 500 µL of this solution and add it to individual microcentrifuge tubes.
  2. Add 2 µg, 3 µg, 4 µg, and 5 µg ABE plasmids to individual tubes and dissolve them in 500 µL of 30 mM Na2SO4. Mix 500 µL of chitosan solution and 500 µL of the plasmid.
  3. Incubate them in a water bath at 50-55 °C for 15 min. After mixing the two solutions well, vortex for 15-30 s and let stand for 30 min.
  4. Chitosan characterization: Analyze the diameters and zeta potentials of Chitosan using dynamic light scattering (DLS), with the concentration of chitosan maintained at 0.1 mg/mL in ddH2O. Run each sample 3x.
  5. Cast 0.1 mg/mL samples onto a silicon chip. Add 20 µL of the resuspended samples to 200-mesh grids and incubate at room temperature for 10 min. Stain the grids with 2% phosphotungstic acid for 3 min and remove the remaining liquid with filter paper. Observe with a transmission electron microscope.
  6. Nanoparticle encapsulation efficiency: Filter the supernatant with a 0.1 µm filter to remove the unprecipitated particles. Upload the plasmid and measure the concentration with a spectrophotometer at 260 nm. The calculated efficiencies of ABE Plasmid and gRNA plasmid were 84% ± 0.37% and 85% ± 0.53%, respectively.
  7. Inject 100 µL of chitosan embedded with plasmid into mice through the bone marrow cavity (step 5). After 7 days of injection, isolate the bone marrow cells and lyse the red blood cells as described in step 2.
  8. Add 2 mL of serum-containing DMEM medium to 6-well cell culture plates and add the bone marrow cells (approximately 1 x 106) suspended in 500 µL of serum-containing DMEM medium. Measure the fluorescence intensity under a fluorescence microscope. CaMK II δ-sgRNA plasmid has TagRFP red fluorescence when excited at 580 nm (Figure 2B).
    NOTE: Serum-containing DMEM medium is prepared using the reagents listed in Table 4.

4. Flow cytometry

  1. Prepare different dosages of ABE plasmids: 2 µg, 3 µg, 4 µg, and 5 µg, and deliver to recipient mice as described in step 3. After 7 days, isolate the bone marrow cells from the mice as described in step 3.
  2. Collect the bone marrow cells and centrifuge at 800 x g at 4 °C for 5 min. Discard the supernatant and lyse the red blood cells with 500 µL of red blood cell lysate. After 1 min, terminate the reaction with 1 mL of separation buffer and count the number of cells with a cell counter.
  3. Transfer 1 x 106 cells into a new microcentrifuge tube and centrifuge with 800 x g at 4 °C for 5 min. After removing the supernatant, resuspend the cells with 500 µL of PBS and transfer them into a flow tube. Measure the efficiency by flow cytometry. Prepare a flow cytometry control group as described in step 2.
    NOTE: Cell debris and dead cells with the lower FSC signals and located in the lower-left corner of the FSC versus SSC scatter plot (less than 400) were excluded (Figure 3). Because the plasmids have TagRFP red fluorescence, they can be sorted out.

5. Bone marrow cavity injection

  1. Select KM male mice aged 8 to 9 weeks old, weighing about 30 g. Anesthetize them with an intraperitoneal injection of 150 µL of 1% Pentobarbital sodium (step 2.1). After anesthesia, apply a sterile eye lubricant to the animal's eyes to prevent corneal drying and ulceration. Confirm the depth of anesthesia by toe pinch.
    NOTE: Follow local institutional guidelines for an appropriate anesthetic regimen.
  2. Fix the anesthetized mouse in a supine position on the operating table and fix the front limb of the mouse with tape.
  3. Disinfect the posterior tibia of mice with an alcohol swab. Fill the sterile plasmid solution to be injected in a 1mL syringe with a 26G needle. Remove air bubbles and prepare for injection.
  4. Touch the shin of the mouse and hold the shin of the mouse with your fingers. Determine the position of the injection needle so that the tibial shaft is penetrated from the tibial plateau at the mouse's knee joint. Rotate the injection needle parallel to the tibia, stab into the bone marrow cavity, and inject 100-200 µL slowly (about 3 s) to minimize the damage to the mice.
  5. After the injection, slowly pull out the needle (about 3 s) and immediately use an alcohol swab to stop bleeding and disinfect the puncture site.
  6. Place the mouse cage on a heating pad or (carefully) under a heating lamp so that the environmental temperature is about 37 °C. Wait for the mice to recover from anesthesia, and observe their recovery.

6. Sanger sequencing

  1. Seven days post-injection, collect mouse bone marrow cells as described in step 2 and isolate genomic DNA using an extraction kit. Collect the cells by centrifuging at 2,000 x g for 1 min. Discard the supernatant, add 200 µL of GA solution, and vibrate with a vortex mixer. Add 20 µL of Proteinase K and 200 µL of GB, mix, and then place in a 70 °C water bath for 10 min.
  2. After the incubation, add 200 µL of anhydrous ethanol, shake for 15 s, and then put the mixed liquid into the supporting adsorption column. Centrifuge at 2,500 x g for 1 min, discard the waste liquid at the bottom of the tube and add 500 µL of GD solution. Centrifuge and discard the waste liquid, wash the pellet 2x with PW, and finally dry it, eluting it with 40 µL of pure water.
    NOTE: PW should be added with anhydrous ethanol according to the instructions.
  3. Amplify the target gene CaMKIIδ by PCR with the forward primer sequence gctaaggtgataaatgtggcact and the reverse primer sequence of ctagtgtgcgggccagattc. Prepare the PCR reaction by adding 25 µL of 2x buffer, 1 µL of dNTP Mix, 2 µL of forward primer, 2 µL of reverse primer, 1 µL of DNA Polymerase, 2 µL of template DNA, and 17 µL of ddH2O. Run the following PCR program: 95 °C for 3 min, 95 °C for 15 s, 53.7 °C for 30 s, 72 °C for 60 s, 12 °C for heat preservation.
  4. After PCR, prepare a 1% agarose gel and perform agarose gel electrophoresis at 110 V for 35 min (step 1.5, step 1.6). Cut the target gel area after electrophoresis and send for Sanger sequencing (Figure 4).

Access restricted. Please log in or start a trial to view this content.

Results

In vitro plasmids were injected into mice by intraosseous injection (Figure 1A). The average particle size of the nanoparticles was about 202.9 nm, the potential was 2.77 mV, and the PDI was 0.22 (Figure 1B). Figure 1C shows the surface shape of the nanoparticles observed as spherical by electron microscopy. Figure 1D shows the plasmid map of the ABE vector and...

Access restricted. Please log in or start a trial to view this content.

Discussion

For biomedical research, the challenge in delivering exogenous plasmids to animals involves improving the efficiency of delivery and gene expression while simultaneously minimizing harm to animals to achieve the desired therapeutic effect15,16. We present a novel method of intraosseous injection of chitosan-mediated ABE plasmid delivery into the bone marrow cells of recipient mice. This strategy improves plasmid delivery efficiency and gene expression.

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors declare no competing interests.

Acknowledgements

This work was funded by the Natural Science Foundation of Anhui Province (2208085MC74, 2208085MC51) and the Scientific Research Foundation from the Education Department of Anhui Province, China (KJ2021A0055).

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
0.2 ml PCR Tubes, Flat capLABSELECT PT-02-C
1 mL syringeAnhui Jiangnan medical equipment Co., LTD/
1% Pentobarbital sodium//
1.5 ml Microcentrifuge TubesLABSELECTMCT-001-150
10 × DNA Loading BufferVazymeP022-01
10X T4 DNA Ligase Buffer 1 mlTaKaRa Biotechnology(Dalian)Co.,LTD2011A
1250 μl Pipette Tip 102.1mmLABSELECTT-001-1250
200 μl Pipette Tips 50.55mmLABSELECT T-001-200
2x Phanta Max BufferaVazymeP505-d1
4 ? centrifugeThermo Fisher75002425
50 ml Centrifuge tubeLABSELECTT-012-50
6-well Cell Culture PlatesLABSELECT11110
AgarSangon BiotechA505255-0250
AmpAbiowell/
ChitosanSangon BiotechA600614-0500
Constant temperature culture shakerShanghai Zhicheng Analytical Instrument Manufacturing Co., LTDZWY-200D
Countess Automated Cell CounterThermo Fisher ScientificCountess II/II FL
Countess Cell Counting Chamber Slides and Holder, disposableThermo Fisher ScientificC10228
CutSmart BufferNew England BiolabsB7204SVIAL
DH5αGeneral BiosystemsCS01010
DMEMgibcoC11995500BT
dNTP MixVazymeP505-d1
Esp3I enzymeNEBiolabsR0734S
Ethylenediaminetetraacetic acidVETEC (sigma-aldrich)V900106
Fetal bovine serumOriCellFBSAD-01011-500
Flow cytometerBD FACSCalibur342975
Flow tubeBeyotime BiotechnologyFFC005-1bag
Fluorescence microscopeLeica427019
gel maxi purification kitTIANGENDP210
Genomic DNA extraction kitTIANGENDP304
Glacial acetic acidChina National Pharmaceutical Group Corporation10000218
GoldBand DL2,000 DNA MarkerYESEN10501ES60
Ice machineshanghaizhengqiaoBNS-30laboratory reserved
ImunoSep BufferPrecision Biomedicals Co.,LTD604050
Megafuge 8 Small Benchtop Centrifuge SeriesThermo Fisher Scientific75004250
MEMLife Technology11140050
NanoDrop 2000 Thermo Fisher Scientific, USA
NaOHSIGAMS5881-500G
PBSXiGeneXG3650
PCMV-SPRY-ABE8E vector//
pcr amplification apparatusThermo FisherAKC96300441
Penicillin/Streptomycin SolarbioP1400
peptoneSangon BiotechA505247-0500
Phanta Max Super-Fidelity DNA PolymeraseVazymeP505-d1
Red cell lysateBeyotimeC3702
Sodium chlorideChina National Pharmaceutical Group Corporation10019318
Sodium sulfatealaddinS433911
T-001-10 10μl Pipette Tips 31.65mmLABSELECT T-001-10
T4 DNA LigaseTaKaRa Biotechnology(Dalian)Co.,LTD2011A
TrisBioFroxx1115KG001
tryptoneSangon BiotechA505250-0500
vortex mixersigmaZ258423
Water bathshanghaiyihengDK-80
YeaRed Nucleic Acid Gel StainYESEN10203ES76
Yeast extractBBIA610961-0500
Zetasizer NanoMalvern PanalyticalZetasizer Nano ZS
β-mercaptoethanol Sigma444203

References

  1. Ikawa, Y., et al. Gene therapy of hemoglobinopathies: Progress and future challenges. Hum Mol Genet. 28 (R1), R24-R30 (2019).
  2. Ginn, S. L., Mandwie, M., Alexander, I. E., Edelstein, M., Abedi, M. R. Gene therapy clinical trials worldwide to 2023-an update. J Gene Med. 26 (8), e3721(2024).
  3. Chen, J., Wang, K., Wu, J., Tian, H., Chen, X. Polycations for gene delivery: Dilemmas and solutions. Bioconjug Chem. 30 (2), 338-349 (2019).
  4. Tong, H., et al. Progress and prospects of chitosan and its derivatives as non-viral gene vectors in gene therapy. Curr Gene Ther. 9 (6), 495-502 (2009).
  5. Alizadeh, L., Zarebkohan, A., Salehi, R., Ajjoolabady, A., Rahmati-Yamchi, M. Chitosan-based nanotherapeutics for ovarian cancer treatment. J Drug Target. 27 (8), 839-852 (2019).
  6. Dimassi, S., Tabary, N., Chai, F., Blanchemain, N., Martel, B. Sulfonated and sulfated chitosan derivatives for biomedical applications: A review. Carbohydr Polym. 202, 382-396 (2018).
  7. Maity, S., Mukhopadhyay, P., Kundu, P. P., Chakraborti, A. S. Alginate coated chitosan core-shell nanoparticles for efficient oral delivery of naringenin in diabetic animals-an in vitro and in vivo approach. Carbohydr Polym. 170, 124-132 (2017).
  8. Abnoos, M., et al. Chitosan-alginate nano-carrier for transdermal delivery of pirfenidone in idiopathic pulmonary fibrosis. Int J Biol Macromol. 118 (Pt A), 1319-1325 (2018).
  9. Lee, H. K., Smith, H. E., Liu, C., Willi, M., Hennighausen, L. Cytosine base editor 4 but not adenine base editor generates off-target mutations in mouse embryos. Commun Biol. 3 (1), 19(2020).
  10. Lee, S. N., Jang, H. S., Woo, J. S. Heterologous expression and purification of a CRISPR-cas9-based adenine base editor. Methods Mol Biol. 2606, 123-133 (2023).
  11. Tang, J., Lee, T., Sun, T. Single-nucleotide editing: From principle, optimization to application. Hum Mutat. 40 (12), 2171-2183 (2019).
  12. Newby, G. A., et al. Base editing of hematopoietic stem cells rescues sickle cell disease in mice. Nature. 595 (7866), 295-302 (2021).
  13. Lu, D. Z., et al. Camkii(δ) regulates osteoclastogenesis through erk, jnk, and p38 mapks and creb signalling pathway. Mol Cell Endocrinol. 508, 110791(2020).
  14. Sato, K., et al. Regulation of osteoclast differentiation and function by the camk-creb pathway. Nat Med. 12 (12), 1410-1416 (2006).
  15. Li, X., et al. Viral vector-based gene therapy. Int J Mol Sci. 24 (9), 7736(2023).
  16. Gonçalves, G. A. R., Paiva, R. M. A. Gene therapy: Advances, challenges and perspectives. Einstein. 15 (3), 369-375 (2017).
  17. Mingozzi, F., High, K. A. Immune responses to AAV in clinical trials. Curr Gene Ther. 11 (4), 321-330 (2011).
  18. Mingozzi, F., et al. Cd8(+) t-cell responses to adeno-associated virus capsid in humans. Nat Med. 13 (4), 419-422 (2007).
  19. Dong, L., Li, Y., Cong, H., Yu, B., Shen, Y. A review of chitosan in gene therapy: Developments and challenges. Carbohydr Polym. 324, 121562(2024).
  20. Rizeq, B. R., Younes, N. N., Rasool, K., Nasrallah, G. K. Synthesis, bioapplications, and toxicity evaluation of chitosan-based nanoparticles. Int J Mol Sci. 20 (22), 5776(2019).
  21. Mansouri, S., et al. Chitosan-DNA nanoparticles as non-viral vectors in gene therapy: Strategies to improve transfection efficacy. Eur J Pharm Biopharm. 57 (1), 1-8 (2004).
  22. Zhou, C., et al. Off-target rna mutation induced by DNA base editing and its elimination by mutagenesis. Nature. 571 (7764), 275-278 (2019).
  23. Betzler, B. K., Chee, Y. J. Bin Abd Razak, H.R. Intraosseous injections are safe and effective in knee osteoarthritis: A systematic review. Arthrosc Sports Med Rehabil. 3 (5), e1557-e1567 (2021).
  24. Lin, Y. W., Aplan, P. D. Leukemic transformation. Cancer Biol Ther. 3 (1), 13-20 (2004).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Plasmid TransfectionBone Marrow CellsOsteoclast FunctionFlow CytometryDynamic Light ScatteringGene Editing Efficiency