A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Frequency and Distribution of Crossovers in Caenorhabditis elegans Meiosis by SNP Genotyping using Real-time PCR

1.2K views

⸱

DOI:

10.3791/68183

⸱

July 11th, 2025

 ,  ,  , 
1Graduate School of Biology-Oriented Science and Technology, Kindai University, 2Department of Genetic Engineering, Faculty of Biology-Oriented Science and Technology, Kindai University, 3Graduate School of Frontier Biosciences, Osaka University

In This Article

Summary

This protocol provides a method for measuring crossover frequencies and distribution during meiosis in Caenorhabditis elegans. Single-nucleotide polymorphism genotyping with real-time PCR was used to determine the origin of the chromosomes. The 4-point mapping allowed to determine the crossover distributions of the left-arm, center, and right-arm regions of each chromosome.

Abstract

Caenorhabditis elegans is an excellent model organism for studying meiosis. In addition to general advantages, such as a short reproductive cycle, many progenies, and a transparent body for imaging, there are six pairs of homologous holocentric chromosomes. There is strong crossover interference and regulation of crossover distribution. To measure the crossover frequency, visible marker mapping, snip-SNP mapping, and quantification of cytological markers as precursors of crossover formation have been developed. Here, we introduce a modified SNP genotyping method to measure the crossover frequency and distribution in C. elegans oogenesis. This method can omit the laborious steps of restriction digestion and gel electrophoresis and avoid the ambiguous judgment of uncut DNA bands. Single-nucleotide polymorphism (SNP) genotyping is performed using the Bristol/Hawaiian hybrid strain. Crossing hermaphrodites with myo-3p::GFP-expressing males enables us to focus on oogenesis. A single worm lysate produces sufficient DNA template for all six chromosomes. The 5' exonuclease-based TaqMan chemistry and SNP-specific minor groove binder (MGB) probes allow the precise detection of SNP at a genotyping rate of approximately 97.7%. We utilize the accurate detection of SNPs to measure crossover frequency in C. elegans. This method can also be applied to determine the crossover frequency in male or crossover-defective mutants, as well as for more specific chromosomal intervals.

Introduction

Crossover formation between homologous chromosomes is essential for the proper segregation of chromosomes and also for the generation of genetic diversity1. Errors in crossover formation cause aneuploidy, which can lead to infertility, miscarriage, and birth defects2. Crossover frequency varies by chromosome region, mutant type, age, and sex, underscoring the need to accurately measure crossover frequency under each of these conditions3,4,5. The overall goal of this method is to accurately measure the crossover frequency of each chromosomal domain and thereby accurately determine the distribution of crossovers over the entire length of the C. elegans chromosome.

Traditionally, two-point mapping using morphological markers has been used to measure crossover frequency6,7,8,9,10. In C. elegans, dumpy, short, fat body (Dpy) and uncoordinated movement (Unc) phenotypes are often used to create chromosome maps6. The advantages of this method are its low cost and ability to analyze many progenies. The disadvantages of these methods include the limitation of choosing the loci of interest and the inability to use lethal progenies because their phenotypes are not visible. In order to overcome the inconvenience of site choice, Tc1 transposons have been used as markers for polymorphic sequence-tagged sites (STS)11,12. Tc1s can be detected using PCR and electrophoresis. While the standard Bristol N2 strain had 30 copies of the Tc1 transposon, the C. elegans isolates from Bergerac in France (RW7000 and DP13) had 500 copies of Tc1. Thus, the number and distribution of Tc1 transposons vary among isolates, and this is used to analyze the chromosomes of the progeny of hybrid worms between isolates by PCR. Subsequently, SNPs were also used to measure crossover frequency and distribution13,14. The SNP between the Bristol N2 and Hawaiian CB4856 strains appeared every 1,000 bp15,16. SNPs are detected as restriction fragment length polymorphisms (RFLP) using PCR, restriction digestion, and electrophoresis. Recently, small insertion/deletion (InDel) sites as well as SNPs between Bristol N2 and Hawaiian CB4856 have been proposed as more efficient markers17. However, measuring crossover frequency using Tc1, RFLP, and InDel requires labor-intensive processes such as PCR, restriction enzyme treatment, and electrophoresis. If each process is not optimized in a large-scale analysis, the results may be misinterpreted due to factors such as the accuracy of PCR, the type of restriction enzyme used, the efficiency of DNA cleavage, and the clarity and separation of bands during electrophoresis. In contrast, the proposed method utilizes SNP genotyping by real-time PCR to facilitate accurate and precise quantification.

Crossovers are not randomly distributed along chromosomes. In C. elegans, single crossovers tend to form more frequently in the arms and are suppressed in the center3,5. Morphological two-point mapping cannot identify where crossovers occur outside of marker genes. Conversely, SNP mapping allows for an increase in markers and has been shown to facilitate the determination of the exact region of a crossover along the entire chromosome5,14,18. In this study, we employed the chromosomal domain boundaries proposed by Rockman and Kruyglyak5 and selected four SNPs for analysis: at both ends of the chromosome, and at both ends of the center/arm boundaries.

By taking advantage of the previous methods, we proposed an accurate and rapid SNP detection method by real-time PCR using TaqMan, 5' nuclease19 to measure the crossover among the left arm, center, and right arm of each chromosome. The advantages of our method over alternative technologies, as compared to prior studies20,21,22, are accuracy and simplicity. This method is a qPCR-applied crossover analysis method for C. elegans and is widely suitable for researchers studying meiosis.

Access restricted. Please log in or start a trial to view this content.

Protocol

1. First genetic cross

  1. Prepare mating plates that comprise normal Nematode Growth Medium (NGM) plates with a small OP50 spot (~5 mm diameter) in the 35 mm dish.
  2. Add three L4 hermaphrodites of the Bristol N2 strain (or mutants with a Bristol background) and nine young adult males of the Hawaiian CB4856 strain on a mating plate (Figure 1A).
    NOTE: To analyze mutants with high embryonic lethality, it is necessary to use balanced mutants with both Bristol and Hawaiian backgrounds in this cross. To obtain mutants with a Hawaiian background, the Bristol mutants must be outcrossed with the Hawaiian strain at least six times until all the SNP sites of interest have a Hawaiian background. As a result, the Hawaiian mutant contains Bristol background only in the mutated region and the balancer chromosome.
  3. Incubate the plate for 1.5 days at 20 °C to mate the two strains. Transfer each hermaphrodite to a new individual NGM plate with OP50.
  4. Place the plates in a 20 °C incubator for 1 day to allow them to lay fertilized eggs. Transfer each hermaphrodite to a new individual NGM plate with OP50.
  5. Place the plates in a 20 °C incubator for 1 day to allow fertilized eggs to be laid again. Remove the hermaphrodites. Keep the plates for 0.5 - 1 day in a 20 °C incubator to grow the progenies to L4.

2. Second cross

  1. Pick six crossed-L4-hermaphrodites (Bristol/Hawaiian hybrids) and 12-15 ccIs4251[(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I (TTS24) Bristol males onto a new mating plate (Figure 1B).
    NOTE: The ccIs4251 inserted strain is obtained from the Caenorhabditis Genetics Center, and it must be outcrossed with wild-type N2 strain more than six times.
  2. Keep the plate for 1.5 days at 20 °C in an incubator to mate. Transfer each hermaphrodite to a new NGM plate with OP50.
  3. Place the plates in a 20 °C incubator for 1 day to allow them to lay fertilized eggs. Transfer each hermaphrodite to a new individual NGM plate with OP50.
  4. Keep the plates for 1 day in a 20 °C incubator to let them lay fertilized eggs again. Transfer each parental hermaphrodite to a PCR tube with 3 µL of lysis buffer to check if the first cross was successful.
  5. Check the genotypes of the parents as a Bristol/Hawaiian hybrid by PCR in a region of chromosome V. Separate the bands by 2.5% agarose gel electrophoresis.
    1. In the SNP, WBVar01973670, the length of the PCR amplicon from the Bristol genome is 220 bp, and from the Hawaiian genome is 196 bp. If the PCR results indicate that the parents are Bristol homozygotes, this is due to self-fertilization of the first cross. Do not use the progeny of these worms for further analysis.

3. Sampling

  1. Prepare Worm lysis buffer as follows: 50 mM KCL, 10 mM Tris pH 8.2, 2.5 mM MgCl2, 0.45% IGEPAL CA-630 (NP-40), 0.45% Tween 20, and 0.01% gelatin. Sterilize by filtration and store at room temperature. Immediately before use, add 3 µL of 20 mg/mL proteinase K (in H2O) to 1 mL of lysis buffer and store in aliquots at -20 °C.
  2. Check the expression of the GFP at the body wall muscle of the progenies of the second cross by fluorescent dissecting microscope before adding the worms to individual PCR tubes. The magnification is 6.1- 55x, and the wavelength used is 440-460 nm.
  3. Pick a GFP-positive single worm and add to each PCR tube containing 3 µL of worm lysis buffer (Figure 1C). Collect a total of 360 (90 x 4 biological replicates) adult male crossed progenies in each of 360 PCR tubes.
    NOTE: To avoid picking self-fertilized offspring, GFP-positive worms should be selected for the sampling. Unmated hermaphrodites younger than L4 are also available for analysis of autosomes, but because they have different numbers of X chromosomes, males and hermaphrodites must be identified after growing to L4 and sampled when analyzing the X chromosome.
  4. Place the samples in a -80 °C freezer for 5 min. Samples can be stored at -80 °C until lysis can begin.
  5. When analyzing mutants with high embryonic lethality, collect the dead embryos instead of live larvae to obtain unbiased results. To collect embryos, use a pipette tip with 0.5 µL of chitinase solution (20 mg/mL chitinase, 50 mM NaCl, 70 mM KCl, 2.5 mM MgCl2, 2.5 mM CaCl2). Collect embryos within 4 h of laying.
    NOTE: Dead embryos laid more than 4 h ago are unsuitable for PCR analysis, probably due to the degradation of genomic DNA.

4. Sample lysis

  1. Set the PCR tubes in the thermal cycler at 60 °C for 1 h, followed by 95 °C for 15 min. Add 100 µL of nuclease-free water to each tube and mix well.
  2. Store samples at -20 °C until starting SNP genotyping by real-time PCR.

5. SNP genotyping

  1. Make a mixture as follows (Figure 2). In a 1.5 mL tube, add 125 µL of Master Mix, 6 µL of SNP Genotyping Assay (40x), 280 µL of Distilled water (DW), Forward primer (450 nM), Reverse primer (450 nM), Probe 1 (100 nM), Probe 2 (100 nM).
    NOTE: The probes and primers are listed in Table 1.
  2. Mix thoroughly by pipetting several times to ensure a uniform concentration. Add 4 µL of the mixture to each well of a 96-well PCR plate on the support base with a 12-channel micropipette.
  3. Add 1 µL of lysate containing each genomic DNA to each well and mix by pipetting several times.
  4. Prepare positive controls, i.e., Bristol homozygotes, Hawaiian homozygotes, and Bristol/Hawaiian hybrids, and three no-template controls as negative controls (Figure 3A).
  5. Seal the plate with an optical adhesive film. Press the film focusing on the rims of each well using an applicator.
  6. Centrifuge the plate briefly to collect the liquid at the bottom and remove air bubbles from the liquid.
  7. Load the plate onto the real-time PCR instrument. Click the Create New Experiment button in the Software.
  8. In the Properties setting, set Instrument type to QuantStudio 1 System, Block type to 96-well 0.2 mL Block, Experimental type to Genotyping, Chemistry to TaqMan Reagents, and Run mode to Fast.
  9. In the Method setting, set Volume to 5 µL (ensuring that the correct reaction volume matches the setup), Cycle Count to 40 cycles (default). Set the temperature and time settings as follows: Pre-Read Stage at 25 °C for 30 s, Hold Stage (enzyme activation, hot start) at 95 °C for 20 s, PCR Stage at 95 °C for 1 s, 60 °C for 20 s, and Post-Read Stage at 25 °C for 30 s.
  10. In the Plate setting, match the positions of the samples and controls to each well on the software screen.
  11. Save the Experiment in a USB device, load it into the real-time PCR instrument, and click the Run button.

6. Data analysis

  1. Save the results to a USB and transfer them to a computer for data analysis.
  2. Analyze Real-Time delta Rn (dRn) Data using the formula below, where Rn (normalized reporter) is the fluorescence signal from the reporter dye, VIC and FAM, normalized by dividing by the fluorescence signal of the passive reference dye, ROX.
    dRn = Rn - baseline
  3. Review the allelic discrimination plot.
  4. Confirm the separation of clusters (Figure 3B). In the allele discrimination plot, Bristol homozygotes are grouped in the lower right corner, Bristol/Hawaiian hybrids are grouped in the upper right corner, Hawaiian homozygotes are grouped in the upper left corner, and negative controls are grouped in the lower left corner. Use the following color codes:
    Red: Bristol allele
    Blue: Hawaiian allele
    Green: Heterozygous
    Black: Negative control
  5. Export the results to a spreadsheet file and assemble the genotyping data from all four SNP positions. If there are undetermined calls in four consecutive positions, exclude the data from the N-value. Use 90 samples per plate for analysis.
    1. Identify the crossovers as follows: If the SNP at position #1 is a Bristol/Hawaiian hybrid, and positions #2-#4 are all Bristol homozygotes [B/H]-[B/B]-[B/B]-[B/B] or position #1 is a Bristol homozygote and position #2-#4 are all Bristol/Hawaiian hybrids [B/B]-[B/H]-[B/H]-[B/H], these results indicate a single crossover between positions #1 and #2 (somewhere on the left arm of the chromosome). Similarly, in the case of [B/H]-[B/H]-[B/B]-[B/B] or [B/B]-[B/B]-[B/H]-[B/H], a single crossover occurs between #2 and #3 (somewhere in the central region of the chromosome), and in the case of [B/H]-[B/H]-[B/H]-[B/B] or [B/B]-[B/B]-[B/B]-[B/H], a single crossover occurs between #3 and #4 (somewhere on the right arm of the chromosome).
      NOTE: There are six patterns of double crossovers. Left and right: [B/B]-[B/H]-[B/H]-[B/B] and [B/H]-[B/B]-[B/B]-[B/H], left and center: [B/B]-[B/H]-[B/B]-[B/B] and [B/H]-[B/B]-[B/H]-[B/H], center and right: [B/B]-[B/B]-[B/H]-[B/B] and [B/H]-[B/H]-[B/B]-[B/H].

7. Statistical analysis

  1. Insert the values into the SPSS Statistics software (IBM). For the comparison of the crossover distribution at the left arm, the central region, and the right arm of the chromosomes, insert 82 chromosomes with a crossover at the left arm, 20 chromosomes with a crossover at the central region, and 68 chromosomes with a crossover at the right arm.
  2. Perform ANOVA and Bonferroni correction and determine statistical significance using a two-tailed p-value. Perform as many comparisons as required, such as left arm versus center or WT versus mutant.

Access restricted. Please log in or start a trial to view this content.

Results

We detected the four SNP sites on chromosome II in C. elegans by SNP genotyping assay to quantify crossover formation per full length of the chromosome, in the left arm, in the central region, and in the right arm. The detection of SNPs is performed according to the manufacturer's instructions. The master mix contains Taq DNA Polymerase, Heat-labile uracil-N-glycosylase (UNG), dNTP with dUTP, and Passive reference ROX dye. Taq DNA polymerase is activated at 95 °C, enabling the inhibition of non-specific amplific...

Access restricted. Please log in or start a trial to view this content.

Discussion

Here, we have introduced a method for measuring the crossover frequency and distribution in C. elegans meiosis based on SNP genotyping of crossed progenies from the Bristol/Hawaiian hybrid species. While the conventional snip-SNP method (RFLP) requires gel electrophoresis after PCR, and the detection of DNA bands requires a gel documentation system14,18, SNP genotyping by the 5' nuclease assay using real-time PCR does not require a laborious electrop...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors declare no conflicts of interest.

Acknowledgements

The strains were kindly provided by the Caenorhabditis Genetics Center (CGC), funded by the NIH Office of Research Infrastructure Programs (P40 OD010440). We thank the members of the Saito Laboratory for their helpful discussions regarding this work. This work was supported by the Japan Society for the Promotion of Science (JSPS) KAKENHI Grant JP23K05868 to TTS.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
101-1000μl Pipette TipQSP111-N-Q
0.5mol/I-EDTA Solution (pH 8.0)Nacalai tesque14347-21
10mol/I-Sodium Hydroxide SolutionNacalai tesque94611-45
10X DreamTaq Green BufferThermo Fisher Scientific EP0713
10μL, Long Tip, GranduatedFUKAEKASEI, WATSON110-207C
200μL, Standard Tip, GraduatedFUKAEKASEI, WATSON110-705C
Agar PowderNacalai tesque01028-14
AgarosePH JapanPH108
Autoclave TOMY model ES-215 High Pressure Steam SterilizerTOMY SEIKOES-215
Bacto Peptone Enzymatic Digest of ProteinThermo Fisher Scientific 211677
Boric AcidNacalai tesque05215-05
Caenorhabditis elegans Bristol wild-type Caenorhabditis Genetics CenterN2
Caenorhabditis elegans Hawaiian wild-typeCaenorhabditis Genetics CenterCB4856
Calcium ChlorideNacalai tesque06729-55
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] ISaito labTTS24originally from PD4251
CholesterolNacalai tesque08721-62
Custom TaqMan SNP Genotyping AssaysThermo Fisher Scientific 4332077
Deoxynucleotide (dNTP) Solution MixNew England BiolabsN04470
DigPrint Doc Tablet DP-T130zBio ToolsDP-T130z
di-Potassium HydrogenphosphateNacalai tesque28726-05
Dissecting MicroscopeNikonSMZ-745 C-DS
Dream Taq DNA PolymeraseThermo Fisher Scientific EP0713
Ethidium Bromide SolutionNacalai tesque14631-94
Forward Primer for WBVar01973670IDT103988736atgtctcacccaaggttgaa
gelatinNacalai tesque166-31
Gilson PIPETMAN Classic PipetThermo Fisher Scientific 
IGEPAL CA-630Sigma-Aldrich18896
Magnesium Sulfate HeptahydrateNacalai tesque21003-75
MicroAmp Optical 96-Well Reacton PlateThermo Fisher Scientific N8010560
MicroAmp Optical Adhedive FilmThermo Fisher Scientific 4311971
MiniAmp  thermal cyclerThermo Fisher Scientific MiniAmp
Mini-Sub Cell GT Horizontal Electrophoresis System, 7 x 10 cm trayBio-Rad Laboratories1704466
Nichipet EXIINichiryo00-NPX2-2
Nichipet EXII MULTINichiryo00-NPM-12VP
Pippete Mate NEONichiryo00-PMNEO
Potassium ChlorideNacalai tesque285-38
Potassium DihydrogenphosphateNacalai tesque28720-65
Proteinase KThermo Fisher Scientific EO0491
QuantStudio 1 Real-Time PCR System, 96-well, 0.2 mLThermo Fisher Scientific A40426
Quick-Load Purple 1kb Plus DNA LadderNew England BiolabsN0550S
Reverse Primer for WBVar01973670IDT103988737tggctactcctagtcactga
Sodium ChloridsNacalai tesque31319-45
TaqPath ProAmp Master MixThermo Fisher Scientific A30866
TC Dish 35, StandardSARSTEDT83.3900
Tris (hydroxymethyl) aminomethaneNacalai tesque35406-75
Trizma baseSigma-Aldrich T1503-1KG
Tween 20Yoneyama Reagent03706
WormStuff Worm PickGenesee Scientific59-AWP
WormStuff Worm Pick Tips(90/10% Pt/Ir, 30 Gauge)Genesee Scientific59-30PI36

References

  1. Jones, G., Kleckner, N., Zickler, D. Meiosis through three centuries. Chromosoma. 133 (2), 93-115 (2024).
  2. Hassold, T. J., Hunt, P. A. Missed connections: Recombination and human aneuploidy. Prenat Diagn. 41 (5), 584-590 (2021).
  3. Barnes, T. M., Kohara, Y., Coulson, A., Hekimi, S. Meiotic recombination, noncoding DNA and genomic organization in caenorhabditis elegans. Genetics. 141 (1), 159-179 (1995).
  4. Lim, J. G., Stine, R. R., Yanowitz, J. L. Domain-specific regulation of recombination in Caenorhabditis elegans in response to temperature, age, and sex. Genetics. 180 (2), 715-726 (2008).
  5. Rockman, M. V., Kruglyak, L. Recombinational landscape and population genomics of Caenorhabditis elegans. PLoS Genet. 5 (3), e1000419(2009).
  6. Brenner, S. The genetics of Caenorhabditis elegans. Genetics. 77 (1), 71-94 (1974).
  7. Li, W., Yanowitz, J. L. Atm and atr influence meiotic crossover formation through antagonistic and overlapping functions in Caenorhabditis elegans. Genetics. 212 (2), 431-443 (2019).
  8. Rose, A. M., Baillie, D. L. The effect of temperature and parental age on recombination and nondisjunction in Caenorhabditis elegans. Genetics. 92 (2), 409-418 (1979).
  9. Villeneuve, A. M. A cis-acting locus that promotes crossing over between X chromosomes in Caenorhabditis elegans. Genetics. 136 (3), 887-902 (1994).
  10. Youds, J. L., et al. Rtel-1 enforces meiotic crossover interference and homeostasis. Science. 327 (5970), 1254-1258 (2010).
  11. Emmons, S. W., Yesner, L., Ruan, K. S., Katzenberg, D. Evidence for a transposon in Caenorhabditis elegans. Cell. 32 (1), 55-65 (1983).
  12. Williams, B. D., Schrank, B., Huynh, C., Shownkeen, R., Waterston, R. H. A genetic mapping system in Caenorhabditis elegans based on polymorphic sequence-tagged sites. Genetics. 131 (3), 609-624 (1992).
  13. Hillers, K. J., Villeneuve, A. M. Chromosome-wide control of meiotic crossing over in C. elegans. Curr Biol. 13 (18), 1641-1647 (2003).
  14. Wicks, S. R., Yeh, R. T., Gish, W. R., Waterston, R. H., Plasterk, R. H. Rapid gene mapping in Caenorhabditis elegans using a high-density polymorphism map. Nat Genet. 28 (2), 160-164 (2001).
  15. Campos, T. L., Korhonen, P. K., Sternberg, P. W., Gasser, R. B., Young, N. D. Predicting gene essentiality in Caenorhabditis elegans by feature engineering and machine-learning. Comput Struct Biotechnol J. 18, 1093-1102 (2020).
  16. Fay, D., Bender, A. Snps: Introduction and two-point mapping. WormBook. , (2008).
  17. Hwang, H. Y., Wang, J. Fast genetic mapping using insertion-deletion polymorphisms in Caenorhabditis elegans. Sci Rep. 11 (1), 11017(2021).
  18. Davis, M. W., et al. Rapid single nucleotide polymorphism mapping in C. elegans. BMC Genomics. 6, 118(2005).
  19. Livak, K. J. Allelic discrimination using fluorogenic probes and the 5' nuclease assay. Genet Anal. 14 (5-6), 143-149 (1999).
  20. Li, Q., et al. The tumor suppressor BRCA1-BARD1 complex localizes to the synaptonemal complex and regulates recombination under meiotic dysfunction in Caenorhabditis elegans. PLoS Genet. 14 (11), e1007701(2018).
  21. Saito, T. T., Lui, D. Y., Kim, H. M., Meyer, K., Colaiacovo, M. P. Interplay between structure-specific endonucleases for crossover control during Caenorhabditis elegans meiosis. PLoS Genet. 9 (7), e1003586(2013).
  22. Saito, T. T., Youds, J. L., Boulton, S. J., Colaiacovo, M. P. Caenorhabditis elegans him-18/slx-4 interacts with slx-1 and xpf-1 and maintains genomic integrity in the germline by processing recombination intermediates. PLoS Genet. 5 (11), e1000735(2009).
  23. Longo, M. C., Berninger, M. S., Hartley, J. L. Use of uracil DNA glycosylase to control carry-over contamination in polymerase chain reactions. Gene. 93 (1), 125-128 (1990).
  24. Kutyavin, I. V., et al. 3'-minor groove binder-DNA probes increase sequence specificity at pcr extension temperatures. Nucleic Acids Res. 28 (2), 655-661 (2000).
  25. Hammarlund, M., Davis, M. W., Nguyen, H., Dayton, D., Jorgensen, E. M. Heterozygous insertions alter crossover distribution but allow crossover interference in Caenorhabditis elegans. Genetics. 171 (3), 1047-1056 (2005).
  26. Hodgkin, J., Horvitz, H. R., Brenner, S. Nondisjunction mutants of the nematode Caenorhabditis elegans. Genetics. 91 (1), 67-94 (1979).
  27. Meneely, P. M., Farago, A. F., Kauffman, T. M. Crossover distribution and high interference for both the X chromosome and an autosome during oogenesis and spermatogenesis in Caenorhabditis elegans. Genetics. 162 (3), 1169-1177 (2002).
  28. Nabeshima, K., Villeneuve, A. M., Hillers, K. J. Chromosome-wide regulation of meiotic crossover formation in Caenorhabditis elegans requires properly assembled chromosome axes. Genetics. 168 (3), 1275-1292 (2004).
  29. Phillips, C. M., Dernburg, A. F. A family of zinc-finger proteins is required for chromosome-specific pairing and synapsis during meiosis in C. elegans. Dev Cell. 11 (6), 817-829 (2006).
  30. Mancera, E., Bourgon, R., Brozzi, A., Huber, W., Steinmetz, L. M. High-resolution mapping of meiotic crossovers and non-crossovers in yeast. Nature. 454 (7203), 479-485 (2008).
  31. Qi, J., et al. Characterization of meiotic crossovers and gene conversion by whole-genome sequencing in Saccharomyces cerevisiae. BMC Genomics. 10, 475(2009).
  32. Miller, D. E., et al. A whole-chromosome analysis of meiotic recombination in Drosophila melanogaster. G3 (Bethesda). 2 (2), 249-260 (2012).
  33. Carlton, P. M., Farruggio, A. P., Dernburg, A. F. A link between meiotic prophase progression and crossover control. PLoS Genet. 2 (2), e12(2006).
  34. Tsai, C. J., et al. Meiotic crossover number and distribution are regulated by a dosage compensation protein that resembles a condensin subunit. Genes Dev. 22 (2), 194-211 (2008).
  35. Bhalla, N., Wynne, D. J., Jantsch, V., Dernburg, A. F. Zhp-3 acts at crossovers to couple meiotic recombination with synaptonemal complex disassembly and bivalent formation in C. elegans. PLoS Genet. 4 (10), e1000235(2008).
  36. Yokoo, R., et al. Cosa-1 reveals robust homeostasis and separable licensing and reinforcement steps governing meiotic crossovers. Cell. 149 (1), 75-87 (2012).
  37. Almanzar, D. E., et al. Meiotic DNA exchanges in C. elegans are promoted by proximity to the synaptonemal complex. Life Sci Alliance. 6 (4), e202301906(2023).
  38. De Los Santos, T., et al. The mus81/mms4 endonuclease acts independently of double-holliday junction resolution to promote a distinct subset of crossovers during meiosis in budding yeast. Genetics. 164 (1), 81-94 (2003).
  39. Saito, T. T., Colaiacovo, M. P. Regulation of crossover frequency and distribution during meiotic recombination. Cold Spring Harb Symp Quant Biol. 82, 223-234 (2017).
  40. Zalevsky, J., Macqueen, A. J., Duffy, J. B., Kemphues, K. J., Villeneuve, A. M. Crossing over during Caenorhabditis elegans meiosis requires a conserved mutS-based pathway that is partially dispensable in budding yeast. Genetics. 153 (3), 1271-1283 (1999).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Crossover FrequencyMeiotic RecombinationChromosome MappingTaqMan ChemistryOogenesis AnalysisGenetic MutantsCrossover Distribution
Frequency and Distribution of Crossovers in Caenorhabditis elegans Meiosis by SNP Genotyping using Real-time PCR
Contact Us
Recommend to Library

Privacy

Terms of Use

Policies

Copyright © 2026 MyJoVE Corporation. All rights reserved.