Optimized Hot Phenol–Based RNA Extraction from Mycobacteria: A Robust Approach for Reliable Gene Expression Analysis

Summary

This study optimizes a Hot Phenol–based RNA extraction method for Mycobacterium, yielding high-quality RNA suitable for transcriptomic analyses. When benchmarked against TRIzol and RNeasy under identical conditions, the method provided higher yield, comparable integrity, and improved cost-efficiency, offering a practical alternative for large-scale gene expression studies.

Abstract

Mycobacterium tuberculosis (Mtb) remains a major global health threat, underscoring the need for reliable transcriptomic studies to understand its biology and drug resistance mechanisms. Such analyses depend on obtaining high-quality, high-yield RNA. Although several RNA extraction methods are available, many require expensive reagents, large culture volumes, or specialized equipment, limiting their suitability for large-scale studies, particularly in resource-constrained settings. Here, an optimized Hot Phenol based RNA extraction method specifically tailored for mycobacteria is presented. The method uses minimal culture volume and commonly available reagents to consistently yield high-quality RNA suitable for high-throughput transcriptomic applications. RNA quantity and integrity were assessed by gel electrophoresis and RNA integrity analysis (RIN), and its suitability for downstream applications was confirmed by qPCR and Qubit 4. To benchmark the performance of the optimized method, a parallel RNA extraction using TRIzol and RNeasy under identical experimental conditions was carried out, including the same Mycobacterium species, culture volume, growth phase (logarithmic and stationary), and lysis conditions. This allowed a direct comparison of yield, quality, feasibility, and cost. The optimized Hot Phenol method demonstrated comparable or improved RNA yield and quality while significantly reducing reagent cost and dependence on specialized equipment. Owing to its efficiency, reproducibility, and affordability, this protocol provides a practical alternative for large-scale gene expression and transcriptomic studies in Mtb and other mycobacterial species.

Introduction

M. tuberculosis (Mtb), the causative agent of tuberculosis (TB), remains the leading cause of death from a single infectious pathogen, surpassing HIV/AIDS. In 2024, TB accounted for approximately 1.3 million deaths worldwide¹. This burden is compounded by the rising prevalence of multidrug-resistant (MDR) and extensively drug-resistant (XDR) strains. Therefore, there is an urgent need to understand the molecular basis of TB pathogenesis and identify new therapeutic targets².

Transcriptional profiling of Mtb has become an important tool for elucidating functional elements involved in host-pathogen interactions³, adaptation to environmental stress⁴, and mechanisms underlying drug resistance⁵. Advanced methodologies such as real-time PCR, microarrays, and RNA sequencing (RNA-seq) have significantly enhanced the ability to analyze the mycobacterial transcriptome⁶. However, the success of these methods heavily depends on the availability of high-quality RNA, which in turn relies on efficient cell lysis during extraction. The complex mycolyl–arabinogalactan–peptidoglycan cell wall of Mtb makes RNA extraction particularly difficult⁷. Existing lysis techniques, including enzymatic hydrolysis⁸, sonication⁹, and bead-beating¹⁰, often require costly equipment and large culture volumes, limiting their practicality in many BSL-3 laboratories. Additionally, Mtb’s slow growth rate necessitates prolonged culture times to obtain sufficient biomass¹¹.

To overcome these limitations, an optimized Hot Phenol–based RNA extraction method that is rapid and economical was developed. Using only 3 mL of mid-log phase culture, the method yields 45–60 µg of high-quality RNA suitable for downstream transcriptomic analyses. Cell lysis is achieved using a compact hand-held tissue grinder and readily available reagents, eliminating the need for expensive instruments. Although the Hot Phenol method has been reported previously^11,12, the optimized Hot Phenol method improves convenience, cost-effectiveness, and RNA yield. Optimization was performed using M. smegmatis mc²155 (Msmeg) and successfully validated with Mtb H37Rv.

Protocol

The reagents and the equipment used are listed in the Table of Materials.

1. Culturing of Mycobacterium

1. Inoculate 1mL from the glycerol stock of Msmeg or Mtb in 10 mL of Middlebrook 7H9 medium supplemented with 0.2% glycerol, 0.05% Tween 80, and 10% ADC at 37 °C with shaking at 150 rpm until the OD reaches 1–1.5.
2. Grow the secondary culture by adding 1% from the primary culture in 10 mL of 7H9 media until mid-log phase, OD_600nm = 0.6–0.7.
3. Split into 3 mL aliquots and centrifuge the cultures at 2000 x g for 5 min at room temperature (23–25 °C).
4. Store the pellets at -80 °C until RNA extraction.
   CAUTION: For Mtb cultures, follow proper BSL3 guidelines and heat-inactivate the pellet at 95 ˚C for 20–25 min.
   NOTE: Figure 1 shows the flowchart of the basic steps followed during RNA extraction by the Hot Phenol method.

Figure 1: A schematic representation of the Hot-Phenol method and analysis. Please click here to view a larger version of this figure.

2. RNA extraction

1. Hot-Phenol method (HP method)
   1. Add 200 µL of TES buffer (100 mM Tris-HCl, pH 8.0; 5 mM EDTA, pH 8.0; 0.1 M NaCl; % SDS; 1% β-mercaptoethanol) to the cell pellet and resuspend the pellet by vortexing.
   2. Add approximately 0.1 g of 0.1 mm silica beads to the sample. Use a hand-held tissue grinder for 10–15 s until the pellet is completely thawed on ice. Repeat this step for 2 more cycles, followed by snap freezing in liquid nitrogen after each repeat.
   3. OR use a high-speed tabletop bead ruptor for 1 min at the speed setting of 5 (5.0 m/s) at room temperature. Repeat this step for 3 cycles and incubate the sample on ice to prevent heating after each cycle.
      NOTE: Repeat Mtb cell lysis for 6–8 cycles (each cycle for 1 min) with either a hand-held tissue grinder or a bead ruptor, and intermittently cool on ice after each cycle. Use DEPC (Diethylpyrocarbonate) treated water for the preparation of all the buffers and reagents needed for RNA extraction.
   4. Add an additional 200 µL of TES buffer (pre-warm to 65 °C) to each sample to make up the volume to 400 µL. To each sample, add 200 µL of acidic phenol (phenol equilibrated with 100 mM citrate buffer, pH 4.5) and 200 µL of chloroform (mix the acid phenol and chloroform in an equal ratio before adding it to the sample).
   5. Incubate the sample at 65 °C on a heat block with shaking at 900 rpm for 30 min and centrifuge at 12000 x g for 15 min at room temperature. Ensure a proper phase separation after centrifugation (a clear upper aqueous phase containing RNA, a distinct interphase of DNA, and a lower organic phase containing proteins and lipids will be observed).
   6. Remove the upper layer of aqueous phase and transfer it into a new 1.5 mL microcentrifuge tube. Add an equal volume of acidic phenol: chloroform again. Centrifuge at 12,000 x g for 15 min at room temperature. Ensure a proper phase separation.
   7. Remove the upper aqueous layer into a fresh 1.5 mL microcentrifuge tube, then add 30 µL of 3 M sodium acetate buffer, pH 5.3, and 240 µL of chilled isopropanol. Incubate at −80 °C for 30 min to 1 h.
      NOTE: The microcentrifuge tube can be stored overnight at -80 °C at this step. Seal the microcentrifuge tube with multiple layers of parafilm to prevent it from opening at 65 °C during incubation.
      CAUTION: Phenol and chloroform are hazardous chemicals; therefore, proper personal protective equipment (PPE), engineering controls like fume hoods, and specific waste disposal procedures should be followed.
   8. Centrifuge at 12,000 x g for 1 h at room temperature. Ensure pellet formation and carefully remove the supernatant without disturbing the pellet.
   9. Resuspend the pellet in 1 mL of 75% ethanol and centrifuge at 12,000 x g for 1 min at room temperature. Perform this step twice and air-dry the pellet.
   10. Resuspend the pellet in 50 µL of nuclease-free water.
       ​NOTE: To dissolve RNA, incubate it in RNase-free water for 10–30 min at room temperature.
2. TRIzol method
   1. Add 200 µL of TRIzol reagent to the cell pellet.
      CAUTION: TRIzol is a hazardous chemical; therefore, proper personal protective equipment (PPE), engineering controls like fume hoods, and specific waste disposal procedures should be followed.
   2. Follow the cell lysis method as in steps 2.1.2 - 2.1.3..
   3. Add an additional 200 µL of TRIzol reagent, followed by 200 µL of chloroform, and vortex for 1 min. Centrifuge at 13,400 x g for 15 min at 4 °C. Ensure the proper phase separation after centrifugation.
   4. Transfer the aqueous phase carefully into a new 1.5 mL microcentrifuge tube.
   5. Precipitate the RNA by adding 500 µL of isopropanol to the aqueous phase and incubating at −80 °C for 30 min to 1 h.
   6. Pellet down the RNA by centrifugation at 15,000 x g for 20 min at 4 °C. Carefully observe the pellet and remove the supernatant without disturbing the pellet.
   7. Resuspend the pellet with 1 mL of 75% ethanol and centrifuge at 13,400 x g for 1 min at 4 °C. Repeat this step twice, air-dry the pellet for 30 min at room temperature, and resuspend in 50 µL of nuclease-free water.
3. Commercially available RNA extraction kit method
   1. Resuspend the cell pellet in 200 µL of Resuspension buffer (provided in the kit).
   2. Follow the cell lysis method as in steps 2.1.2 - 2.1.3.
   3. Carry out the subsequent experiment as per the manufacturer's instructions.

3. DNase treatment, quantification, and visualization

1. To remove genomic DNA contamination, add 1 µL of DNase I (10units) and 5 µL of RDD buffer (1x) to each RNA sample and incubate at room temperature for 30 min.
2. Quantify the RNA sample spectrophotometrically using Nanodrop and RNA integrity using a Qubit4. Accepted value of RIN is between 7.5 -10. Accepted values of A₂₆₀/A₂₈₀ and A₂₆₀/A₂₃₀ in the range 1.8–2.0 and 2.0–2.2, respectively.
3. Visualize RNA on 1% agarose gel using 1X RNA loading dye.

4. cDNA synthesis and quantitative real-time PCR

1. Set up a 20 µL reaction for cDNA preparation using the cDNA Reverse Transcription kit and 1 µg RNA, following the manufacturer’s instructions in a thermal cycler.
2. Set up a 10 µL real-time PCR reaction using 50 ng of cDNA, 0.4 µM of each primer, and SYBR according to the manufacturer’s instructions. Run the sample on the Real-Time PCR Thermal cycler.
   NOTE: The following primers were used for qPCR analysis:
   Mtb sigA Fw 5' cctcaaacagatcggcaagg 3', Mtb sigA Rv 5' cagatccacatcatgtcgcg 3'
   Mtb hsp70 Fw 5’ gctggtggacaagttcaagg 3', Mtb hsp70 Rv 5' ggtcagctgctcgtctaaga 3'
   Mtb16srRNA Fw 5' gcgatacgggcagactagag 3', Mtb16srRNA Rv 5' aaggaaggaaacccacacct 3'
   Ms. sigA Fw 5' gaagacaccgacctggaact 3', Ms.sigA ms Rv. 5' gactcttcctcgtcccacac 3'
   Ms. sigH Fw 5' gaagggttcccgtacaagg 3', Ms sigH Rv. 5' tcatgacgtcacctcctcg 3'
   Ms. sigE Fw 5' caccaccaaccttttcctcg 3', Ms. sigE Rv. 5' accctcgatgtcacacagg 3'

5. Statistical analysis

1. Perform Student’s t-test with all the biological replicates using Graph Pad Prism, P ≤ 0.05 was considered statistically significant. Error bars represent standard error from at least three biological replicates.

Results

RNA quality and yield

RNA quality and quantity were assessed by agarose gel electrophoresis (Figure 2). Distinct, sharp bands corresponding to 23S and 16S rRNA were observed for all extraction methods, confirming successful isolation of total RNA. The Hot Phenol and TRIzol methods showed three clear bands representing 23S (~2900 bp), 16S (~1500 bp), and 5S rRNA (~120 bp), indicating intact, high-quality RNA. In contrast, the colum...

Discussion

To develop a simple and robust RNA extraction method for Mycobacterium, the Hot Phenol method was optimized. Subsequently, the extracted RNA was compared with two widely used approaches: TRIzol and a column-based kit method^12,13. These techniques were compared based on RNA yield, purity, integrity, cost, and processing time to assess their practicality for downstream molecular applications. Both the Hot Phenol and TRIzol methods, though relatively time-i...

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
0.1 mm silica beads	MP Biomedicals	MP116911050
2-propanol	Sigma	278475
Bead Ruptor 4	revvity
Chloroform	Sigma	288306
Cold centrifuge	ThermoScientific	42541217
DNase I	qiagen	79254
EDTA	sigma	E02SS
HCl	SRL	62889
Heat block	MIULAB	MU-E02-1049
High-Capacity cDNA Reverse Transcription kit	Thermo Fischer Scientific	4368814
Motor driven tissue grinder G10	Coron	G22616008
NaCl	sigma	S5886
Nanophotometer N50	IMPLEM	T51601
phenol equilibrated with 0.1 M citrate buffer, pH 4.5	Sigma	P4682
PowerUP SYBR	Applied Biosystems	A25742
Qubit 4 fluorometer	Invitrogen	2.32262E+12
Real-Time PCR Thermal cycler	Analytik Jena AG	844-00503-2
RNA easy Kit	Qiagen	74104
SDS	Sigma	S9888
Sodium acetate	Sigma	S2889
thermal cycler	Biorad	621BR29739
TRI Reagent	Sigma	T9424
Tris base	Himedia	MB029
β-mercaptoethanol	Sigma	516732