A Neonatal Mouse Model of Necrotizing Enterocolitis and Lamina Propria Isolation for Immune Cell Profiling

Summary

This protocol outlines a neonatal mouse model of necrotizing enterocolitis (NEC) and subsequent isolation of lamina propria immune cells from the neonatal murine small intestine.

Abstract

Necrotizing enterocolitis (NEC) is a severe inflammatory disease of the neonatal intestine, primarily affecting preterm infants. NEC is characterized by epithelial injury, microbial dysbiosis, and a dysregulated immune response, often resulting in intestinal necrosis and systemic inflammation. Experimental murine models that recapitulate the key aspects of human disease have been essential in advancing our understanding of the mechanisms that drive disease and inform therapeutic development. This protocol describes a well-established neonatal mouse model of necrotizing enterocolitis (NEC) utilizing formula feeding, intermittent hypoxia, oral administration of lipopolysaccharide (LPS), and enteric bacteria cultured from an infant with NEC. This combination reliably induces histological, transcriptional, and immunological features consistent with NEC in human infants and has been foundational in multiple key discoveries in the field. Additionally, this protocol describes the isolation of immune cells from the small intestinal lamina propria of neonatal mice. Lamina propria cell isolation enables detailed immune cell profiling via flow cytometry, facilitating analysis of both innate and adaptive cell populations within the intestine.

Introduction

Necrotizing enterocolitis (NEC) is a severe inflammatory disease of the intestine that almost exclusively affects premature neonates. Approximately 7%-8% of very low birth weight infants (<1500 g) will be affected by NEC, and mortality rates associated with the disease can approach 50% in neonates that require surgical intervention¹. The pathogenesis of NEC remains incompletely understood; however, current evidence suggests that NEC arises from the confluence of multiple factors, including an immature intestinal barrier, dysregulated immune signaling, and a dysbiotic microbiome^2,3,4. The convergence of these factors can initiate and exacerbate inflammatory responses in the intestine, most notably through the activation of toll-like receptor 4 (TLR4), resulting in epithelial damage and various types of cell death, including apoptosis and necrosis^5,6. The aim of this protocol is to present a reproducible and physiologically relevant mouse model of NEC that recapitulates the intestinal inflammation and pneumatosis intestinalis (gas within the bowel wall) observed in human neonates, enabling mechanistic investigation into disease pathogenesis. Additionally, this protocol describes the isolation of immune cells from the small intestinal lamina propria of neonatal mice, allowing researchers to perform immune cell profiling via flow cytometry.

Compared to larger animal models, such as neonatal rats or piglets^7,8, neonatal mouse models offer several distinct advantages, including lower cost, greater access to transgenic animals, and the ability to perform experiments on larger cohorts. Murine NEC models primarily utilize a combination of formula feeding, cold stress, and hypoxia to simulate the complex pathophysiology of NEC observed in human patients^7,8,9. However, many murine models of NEC are limited by their dependence on broad microbial stressors or artificial alterations of the microbiota, which may compromise their clinical relevance. In contrast, the model described in this protocol overcomes these limitations by integrating several key factors implicated in NEC pathogenesis in human infants^10,11. Specifically, this model combines hypoxic stress, which has been implicated in disrupting intestinal barrier integrity^3,12, with oral administration of infant formula supplemented with lipopolysaccharide (LPS), a well-characterized TLR4 ligand that induces intestinal inflammation, as well as clinically relevant dysbiotic microbiome with enteric bacteria cultured from a patient with NEC totalis, the most severe form of the disease, characterized by pan-necrosis of the bowel^10,13. By integrating these clinically relevant and disease-specific stressors, our model accurately reflects the clinical and molecular features of NEC. Furthermore, to provide investigators with a framework to interrogate the immune-mediated mechanisms underlying NEC pathogenesis, this protocol outlines the isolation of lamina propria cells from the neonatal murine small intestine for flow cytometry analysis. As the principal site of intestinal mucosal immune activity, the lamina propria contains a dynamic repertoire of resident and infiltrating immune cells that play a central role in NEC-associated inflammation¹⁴. Flow cytometry provides a robust and scalable platform for characterizing these immune cell populations with high resolution, enabling detailed analysis of cellular phenotypes, quantification of immune responses, and identification of immunologic signatures implicated in NEC pathogenesis¹⁵.

The murine NEC model outlined in this protocol complements in vitro models by enabling the study of host-microbiome interactions, immune responses, and inflammatory signaling within the complex environment of the neonatal intestine. It reproduces key aspects of NEC pathogenesis that cannot be modeled in vitro, making it a valuable tool for elucidating disease mechanisms and assessing therapeutic strategies. Although species-specific differences remain a limitation, this model offers a robust and accessible platform to advance our understanding of NEC and accelerate the development of targeted interventions.

Protocol

All methods were performed in accordance with the ethical guidelines provided by the Institutional Animal Care and Use Committee (IACUC) at the University of North Carolina at Chapel Hill School of Medicine. Mice were bred, maintained, and housed according to procedures described in the Guide for the Care and Use of Laboratory Animals under a study proposal approved by the IACUC (protocol no. 24-114) of the University of North Carolina at Chapel Hill School of Medicine. C57BL/6J mice were used for all experiments described in this study. Pups were started in the model at postnatal day 4, weighing between 1.8-2.3 g; animals outside this weight range were excluded. The experimental cohorts had a balanced sex distribution, with males and females each comprising approximately 50% of the treated animals. The reagents and the equipment used are listed in the Table of Materials.

1. Murine NEC model

NOTE: Enteric bacterial stock is produced by obtaining the enteric contents from an infant who had the most severe form of NEC, NEC totalis^13,16. The enteric contents are cultured overnight at 1 x g for 16 h at 37 °C, centrifuged at 3000 x g for 10 min at 4 °C, and resuspended in 50% glycerol. 20 µL aliquots are pipetted into cryovials and stored at -80 °C for long-term storage. The selected culture times in this protocol were chosen for workflow efficiency. These time points can be adjusted as needed to accommodate individual laboratory schedules without impacting the overall model. Additionally, this protocol was optimized for a maximum capacity of 40 mice, but can be scaled up as needed.

1. Preparing bacterial culture
   1. On experimental day 0 at 15:00, add a 20 µL aliquot of enteric bacteria cultured from an infant with NEC totalis to a 15 mL culture tube containing 2 mL of Luria-Bertani (LB) broth. Incubate the bacterial culture with the tube lid in the vented position in an orbital shaker at 37°C, 1 x g, overnight for 16 h, and incubate a culture tube containing only 2 mL of LB broth concurrently as a control to assess for any LB contamination.
      1. Visually confirm the overnight culture by comparing the turbidity between the bacterial culture and the clear, LB-only control; proceed only if the bacterial culture appears turbid and the control remains clear.
   2. On experimental day 1, at 07:00, aliquot 125 µL of the inoculated overnight culture into a T75 cell culture flask with a vented lid containing 25 mL of LB broth. Prepare four T75 flasks in total and incubate them in an upright position in an orbital shaker at 37°C, 1 x g, for 2 h to expand the bacterial culture.
      NOTE: Overnight cultures are prepared on experimental days 0, 1, and 2 of the NEC model.
2. Allocating pups into experimental groups
   1. On experimental day 1 at 07:00, weigh postnatal day 4 pups.
      ​NOTE: The optimal weight range is between 1.8-2.3 g, and outliers should be removed from the experiment.
   2. Group the experimental mice into formula-fed and dam-fed cohorts and calculate the average weight of the formula-fed mice. Separate the designated formula-fed mice from the dam and place them in a new cage housed in an infant incubator pre-heated to 37 °C. Keep the dam-fed pups in the original cage with the dam.
      NOTE: Neonatal mice are particularly sensitive to changes in ambient temperature. To maintain consistent temperature regulation after separation from the dam, formula-fed pups are kept in a temperature-controlled infant incubator set at 37 °C. This approach is consistent with established NEC protocols that preserve physiologic temperature without the use of additional thermal interventions^11,17,18,19.
   3. Repeat on experimental days 2 and 3, weighing the formula-fed mice and calculating the average weight prior to the 07:00 feeding time point daily.
3. Measuring Optical Density (OD) of bacterial culture
   1. After 2 h of incubation at 37 °C and 1 x g, remove the four T75 flasks with expanded culture from the orbital shaker on experimental days 1, 2, and 3. Combine the contents of the four T75 flasks, mix well, and pipette 1 mL of the bacterial culture into a cuvette.
      1. Prepare a blank solution by adding 1 mL of sterile LB broth to a cuvette. Measure the optical density of the bacterial culture at 600 nm (OD_600nm) with a spectrophotometer.
         NOTE: The target OD_600nm is 0.6 ± 0.02. If the OD_600nm of the bacterial culture is below the target value, continue incubation as described in step 1.3.1. until the target OD_600nm of 0.6 ± 0.02 is reached. If the OD_600nm is over 0.6, dilute the bacterial culture with sterile LB broth.
   2. Transfer 80 mL of the bacterial culture into two 50 mL centrifuge tubes and centrifuge at 3000 x g for 10 min at 4 °C. Confirm successful culture by checking for a visible pellet at the bottom of each tube.
4. Formula preparation
   1. Begin formula preparation at 09:00 on experimental days 1, 2, and 3. Combine 16 mL of infant formula and 8 mL of puppy milk in a 2:1 ratio in a sterile 50 mL centrifuge tube.
   2. Remove the supernatant from the two 50 mL centrifuge tubes containing pelleted bacterial culture (step 1.3.2).
   3. Thoroughly resuspend each of the two pellets in 2 mL of the formula mix and transfer the resuspension to the formula mix to make 24 mL of the NEC formula.
      NOTE: The final bacterial concentration in the NEC formula should be between 4 and 5 x 10⁹ CFU/mL.
   4. Label six 50 mL centrifuge tubes for each of the six feeding time points (10:00, 13:00, 16:00, 19:00, 22:00, 07:00).
   5. Pipette 4 mL of the NEC formula into each labeled tube.
   6. Prepare six single-use aliquots of LPS (5 mg/mL) stock and store in low-binding microtubes at -20°C. Add LPS (see NOTE for concentration) to the NEC formula immediately before feeding at each time point.
      NOTE: The amount of LPS added to the NEC formula is based on the average body weight of the formula-fed pups calculated at 07:00 each day, using a dosage of 5 µg of LPS per gram of the body weight of the pups. The final LPS concentration varies with body weight. For example, with a feeding volume of 80 µL and an average pup cohort weight of 2 grams, the LPS concentration in the formula would be 0.125 mg/mL.
5. Feeding
   NOTE: On experimental day 1, mice to be placed in the NEC model are fasted for 3 h after separation from their dam. The first NEC formula feed is at 10:00 and continues every 3 h until 22:00. On experimental days 2 and 3, mice are fed at 07:00, 10:00, 13:00, 16:00, 19:00, and 22:00. Mice are not fed on experimental day 4.
   1. Immediately prior to feeding mice, thaw and vortex one aliquot of LPS for 15 s. Add the appropriate amount of LPS based on the average weight of the mice to the 4 mL prepared tube of NEC formula (see step 1.4.6 for calculation) and thoroughly mix by pipetting.
   2. Fill a 1 mL syringe with NEC formula and attach a neonatal peripherally inserted central catheter (PICC) line. Ensure there are no bubbles or air in the syringe or the PICC line.
   3. Administer the NEC formula to the pups via oral gavage with the PICC line.
      1. Gently restrain each pup by the loose skin at the base of its neck and hold the mouse in an upright position. Using forceps, guide the distal end of the PICC line into the oropharynx and esophagus, positioning the tip of the PICC line within the stomach.
         NOTE: The insertion distance of the PICC line is equal to the distance from the corner of the mouth to the top of the milk spot in the stomach. The optimal insertion point should then be clearly marked on the PICC line using a permanent marker.
      2. If significant resistance is felt during the PICC line insertion, remove the PICC line, reposition, and carefully reattempt the insertion.
      3. Dispense 8 µL of NEC formula slowly into the stomach, monitoring the pup closely throughout the feeding for signs of aspiration. Observe for the appearance of a white milk spot to confirm successful gastric delivery.
      4. Remove the PICC line. Observe the pup for any labored breathing or emesis. If the pup regurgitates formula, blot the mouth and nose with a low-lint laboratory wipe.
   4. Repeat this process at every feeding time point.
   5. Twice daily, subject the pups to hypoxia for 10 min immediately following the 13:00 and 19:00 feeding times.
      1. After two feeds per day, place the pups in a hypoxia chamber connected to a gas tank containing 95% nitrogen and 5% oxygen. Open the tank valve and monitor the oxygen levels within the sealed hypoxia chamber using a handheld monitor. Once the hypoxia chamber reaches 5%± 0.5% oxygen, maintain the pups at this oxygen level for 10 min.
         NOTE: The flow rate should be optimized to decrease from 20% to 5% oxygen at a steady, controlled rate over a 2 min period.
   6. Watch the mouse pups between feedings for any signs of respiratory distress, pale discoloration, or apnea. If these signs are present, remove the affected pup from the hypoxia chamber, watch carefully for recovery, and if needed, euthanize the pups in accordance with IACUC policy.
   7. Continue oral gavage feeding and hypoxia exposure at scheduled time points for the full 72 h duration of the NEC model.
      NOTE: If experimental day 1 starts Monday at 10:00, the 72 h endpoint will occur at 10:00 on Thursday. This is designated as day 4 of the model. Mice are not fed at 07:00 on day 4 of the model, and are euthanized at this final 10:00 time point for tissue collection.
6. Euthanizing animals and collecting tissue
   1. On the morning of Day 4 of the model, weigh and record the sex of each pup, then euthanize in accordance with IACUC guidelines.
   2. Following euthanasia, collect blood from each pup into a serum separator tube containing a clot activator and gel.
   3. Centrifuge at 16,000 x g for 20 min at 4 °C to separate the serum. Pipette the serum into labeled 1.7 mL tubes and store at -80 °C.
   4. Make a 1-2 cm midline incision through the abdominal wall and the peritoneum to expose the gastrointestinal tract. Inspect the exposed intestine for hallmark features of NEC, including distension, erythema, gas accumulation within the intestinal wall (pneumatosis intestinalis), and visible air bubbles.
   5. Identify and resect the duodenum through the distal rectum. Place the tissue in a Petri dish on ice. Use ice-cold Phosphate-Buffered Saline (PBS) to rinse the intestine.
   6. Identify the cecum and cut proximally to separate the cecum and colon from the small intestine. Section off pieces starting at the distal ileum and working towards the jejunum. Place a 1 cm piece in a tube containing RNA lysis buffer and 1.5 mm zirconium oxide beads on ice for transcriptional analysis.
      1. Flush a 1.5 cm piece with a syringe containing PBS attached to a 24 G blunt-end needle, and then place it in a microcentrifuge tube containing 1 mL of 4% paraformaldehyde (PFA). Snap freeze a 1 cm piece of intestine and store at -80 °C for protein analysis. Snap freeze a 1 cm piece of intestine and store at -80 °C for any additional assays.
   7. Process tissue collected into RNA lysis buffer in a bead beater (5.50 m/s, 1.0 min., cycle = 1.0, pause dwell: 10 s, 4 °C) to homogenize the tissue, then store at -80 °C.
7. Tissue fixation
   1. Place tissue pieces collected in 4% PFA on a rocker at 4 °C to fix for 24 h. After 24 h, remove 4% PFA from each tube and replace with 1 mL PBS to wash the tissue. Return the tubes to the rocker at 4 °C for 15 min. Repeat the PBS wash once.
      1. Remove the PBS and add 1 mL of 50% ethanol to each tube and return the tubes to the rocker at 4 °C for 15 min. Remove the 50% ethanol and add 1 mL of 70% ethanol, and store at 4 °C until tissue can be processed into paraffin histology blocks.
         NOTE: Additional intestinal segments or stool samples may be collected as needed for further analysis.

2. Lamina propria immune cell isolation

NOTE: This protocol is optimized for the isolation of lamina propria cells from neonatal mice at approximately one week of age. If reference samples are needed for spectral flow cytometry, weanlings (postnatal weeks 3-4) may be used. For weanling samples, double all reagent volumes specified in the protocol.

1. Preparing reagents
   1. Prepare 1x Hank's balanced salt solution without Ca²⁺ and Mg²⁺ (HBSS W/O) containing 10mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) and store at room temperature.
   2. Prepare fluorescent-activated cell sorting (FACS) buffer by dissolving 5% bovine serum albumin (BSA) in PBS + 5 mM ethylenediaminetetraacetic acid (EDTA) and store at 4 °C.
   3. The day before performing lamina propria cell isolation, prepare pre-digestion solution by adding 5mM EDTA, 5% fetal bovine serum (FBS), and 1 mM dithiothreitol (DTT) to HBSS W/O.
   4. Prepare digestion solution immediately before performing lamina propria cell isolation by supplementing Roswell Park Memorial Institute 1640 medium (RPMI) with 10% FBS and  mg/mL collagenase IV.
      NOTE: HBSS W/O can be prepared in advance and stored at room temperature. FACS buffer should be prepared in advance and stored at 4 °C. Pre-digestion and digestion solutions must be prepared fresh immediately before performing lamina propria isolation and kept on ice.
2. Collecting and preparing intestinal tissue for digestion
   1. Locate the cecum and transect proximally to remove the cecum and colon. Excise 2-3 cm of distal small intestine (ileum) and place it on ice-cold HBSS W/O in a petri dish (resuming from step 1.6.5).
   2. Using a 24 G blunt-end needle attached to a syringe, flush the intestinal lumen completely with ice-cold HBSS W/O while stabilizing the tissue with forceps. Visually confirm that the intestinal lumen is free of stool after flushing.
   3. Carefully remove any remaining connective tissue from the intestinal segment using fine forceps or scissors.
   4. Cut the intestine longitudinally to open, then section transversely into 1-1. cm segments.
3. Lamina propria dissociation
   1. Transfer intestinal segments into a 1 mL centrifuge tube containing 1 mL of pre-digestion solution that has been cooled on ice.
   2. Incubate the sample at 37 °C for 20 min with continuous rotation to facilitate tissue dissociation.
   3. Gently swirl the tube, then pour the contents through a 10 µm cell strainer placed over a 5 mL centrifuge tube.
      NOTE: The filtrate collected through the 10 µm strainer contains intraepithelial lymphocytes (IELs) and can be used for downstream analysis if desired.
   4. Transfer tissue fragments into a new 15 mL centrifuge tube containing 10 mL of pre-heated to 37 °C digestion solution. Subsequently, incubate the sample for 40 min at 37 °C with continuous rotation.
   5. Transfer the entire sample into an automated tissue dissociation tube and run the dissociation program consisting of four rotation cycles of 15 s each, alternating between clockwise and counterclockwise directions.
      NOTE: An alternative to an automated tissue dissociator is manually grinding the intestinal tissue using the frosted tips of two microscope slides. If using this method, apply gentle, even pressure to avoid excessive mechanical stress, as this can significantly reduce cell viability.
   6. Gently vortex the cell suspension, then centrifuge the samples in the tissue dissociation tube at 300 × g for 5 min at 4 °C.
   7. Carefully aspirate the supernatant without disturbing the pellet, then resuspend the cells in  mL of ice-cold FACS buffer.
   8. Place a 10 µm cell strainer on a 5 mL centrifuge tube. Transfer the resuspended cell suspension through the filter, then wash the filter with an additional  mL of ice-cold FACS buffer.
   9. Count cells and assess viability using trypan blue or a viability dye. Centrifuge the volume required for flow cytometry at 30 × g for 5 min at 4 °C. Use cells immediately for downstream applications to preserve viability and marker expression.

Results

The neonatal murine model of NEC described in this protocol replicates key features of the disease. Kaplan-Meier survival analysis (Figure 1A) revealed a significant reduction in survival in the NEC treatment group compared to the dam-fed controls (9/21 vs. 8/8; p = 0.0063). Gross inspection of the intestines from the mice subjected to the model (Figure 1B) demonstrated hallmark features of NEC, including intestinal distension, air bubbles, and visible ...

Discussion

This protocol integrates a physiologically relevant neonatal murine model of NEC with lamina propria immune cell isolation, providing a comprehensive platform to investigate mucosal immune responses during intestinal inflammation. By combining clinically relevant exposures, such as enteric microbiome from human NEC cases, hypoxic stress, and formula feeding, this model recapitulates the complex and multifactorial pathogenesis observed in human disease^10,13. The a...

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
1 mL Syringe-Tuberculin Slip Tip	Becton Dickinson	309659	Syringe for formula feeding
1.5 mL semi-micro Disposable Cuvettes	BRAND GMBH + CO KG	759085D
1.7 ml Microtubes Clear	Axygen - Corning Inc.	MCT-175-C	Nonpryogenic & Rnase-/Dnase-free
5% Oxygen, Balance Nitrogen Certified Reference Material, Size 200 High Pressure Steel Cylinger, CGA 580	Airgas	X02NI95C2003186
Anti-Mo CD16/CD32 Purified Clone: 93	eBioscience Inc.	14-0161-85
Anti-Mouse CD16/CD32 Purified Clone: 93	eBioscience Inc.	14-0161-86
APC anti-mouse Ly-6C Clone: HK1.4 Isotype: Rat IgGc	BioLegend	128015
autoMACS Rinsing Solution	Miltenyi Biotec	130-091-222
BB515 Rat Anti-CD11b Clone: M1/70	BD Biosciences	564455
BB700 Rat Anti-Mouse CD4 Clone: RM4-5	BD Biosciences	566408
BD Microtainer SST	Becton Dickinson	365867	Serum Tube
BIOTIX Rainin LTS Compatible Racked Filter Tips, p1200	Fisher Scientific	12-111-365
BIOTIX Rainin LTS Compatible Racked Filter Tips, p20	Fisher Scientific	12-111-366
BIOTIX Rainin LTS Compatible Racked Filter Tips, p200	Fisher Scientific	12-111-362
Brilliant Stain Buffer	BD Biosciences	563795
BUV615 Rat Anti-Mouse Ly-6G Clone: 1A8	BD Biosciences	751263
BV650 Rat Anti-Mouse I-A/I-E Clone: M5/114.15.2	BD Biosciences	563415
C57BL/6J Neonatal Mice	The Jackson Laboratory	000664
CD45-VioGreen mouse	Miltenyi Biotec	130-102-412
CD64 Antibody, anti-mouse, PE-Vio 770, REAfinity Clone REA286	Miltenyi Biotec	130-119-659
CFX Opus Real-Time PC Systems	Bio-Rad	12011319
Collagenase Type 4	Worthington Biochemical Corporation	LS004188
DL-dithiothreitol	Sigma	D9779-5g
eBioscience FOXP3/Transcription Factor Staining Buffer Set	Life Technologies Corp.	00-5523-00
EDTA (0.5M), pH 8.0	Quality Biological Inc	351-027-721
Esbilac Puppy Milk Replacer	Pet-Ag, Inc.	99502-1	Puppy Milk
Fisherbrand Disposable Cuvettes	Fisher Scientific	14-955-127
Fisherbrand Sterile Polystyrene Disposable Serological Pipets with Magnifier Stripe (paper/plastic wrap), 10mL	Fisher Scientific	13-678-11E
Fisherbrand Sterile Polystyrene Disposable Serological Pipets with Magnifier Stripe (paper/plastic wrap), 25mL	Fisher Scientific	13-678-11
Fisherbrand Sterile Polystyrene Disposable Serological Pipets with Magnifier Stripe (paper/plastic wrap), 50mL	Fisher Scientific	13-678-11F
Fisherbrand Sterile Polystyrene Disposable Serological Pipets with Magnifier Stripe (paper/plastic wrap), 5mL	Fisher Scientific	13-678-11D
Genie Temp-Shaker 300	USA Scientific, Inc.	SI-G1600
gentleMACS Dissociator (protocol; m_intestine-01)	Miltenyi Biotec	130-093-235
gentleMACS  C Tubes	Miltenyi Biotec	130096334
Ghost Dye Red 780 Viability Dye	Tonbo Biosciences	13-0865-T100
Glycerol ReagentPlus	Sigma-Aldrich	G7757-500ML
GraphPad Prims Software, Version 10.0	GraphPad	N/A
Greiner Bio-One Round Bottom Polypropylene Culture Tube with Two-Position Vent Stopper	Fisher Scientific	07-000-212
Handi+ Oxygen analyzer	Maxtec	N/A
Hanks' Balanced Salt Solution	Gibco	141650-095
HEPES Buffer	Mediatech, Inc.	25-060-CI
Hypoxia Chamber	Billups-Rothenburg, Inc.	N/A
ImageJ	Schneider et al., 2012	N/A
Integra Miltex MeisterHand Iris Scissors, 10.2cm	Fisher Scientific	12-460-655
Integra Miltex MeisterHand Iris Scissors, 9cm	Fisher Scientific	12-460-598
Integra Miltex™ Swiss Jeweler-Style Forceps	Fisher Scientific	12-460-110
Isolette Infant Incubator	Air-Shields Vickers	C100-200-2 Series 02	Incubator for mice
Kimtech Science Kimwipes Delicate Task Wipes	Kimberly-Clark	34120
LPS	Sigma-Aldrich	L3129-10mg
Luria Broth Broth, Miller Molecular Genetics Powder	Fisher Scientific	BP1426-500
MACS BSA Stock Solution	Miltenyi Biotec	130-091-376
MACSmix Tube Rotator	Miltenyi Biotec	130-090-753
Microcentrifuge Tubes	Thermo Scientific	3451	1.5 ml, clear, graduated, sterile
NanoDrop OneC Microvolume UV-Vis Spectrophotometer	ThermoFisher Scientific	ND-ONEC-W
Ohaus scout portable balance	Fisher Scientific	30253024
Paraformaldehyde	Thermo Scientific	J61899.AK
PE Rat Anti-Mouse TIM-4 Clone: RMT4-54	BD Biosciences	564147
PE-CF594Rat Anti-Mouse CD24 Clone:M1/69	BD Biosciences	562477
Peripherally Inserted Central Catheter, 1.9 French, Single-Lumen	Utah Medical Products, Inc.	P-2S	A single-lumen silicone peripherallly inserted central catheter.
Phosphate buffered saline (PBS)	Gibco	10010023
Quick-RNA MicroPrep kit	Zymo Research	R1051
Rainin pipette - 1000 uL	Rainin	17014382
Rainin pipette - 200 uL	Rainin	17014390
Rainin pippette - 20 uL	Rainin	17014392
RB780 Hamster Anti-Mouse CD11c Clone: HL3	BD Biosciences	755338
RPMI Medium 1640 (1x)	Gibco	11875-093
Similac Advance	Abbott Nutrition	53363	Baby Formula
Sorvall ST8R Centrifuge	Fisher Scientific	75007200
SsoAdvanced Universal SYBR Green Supermix	Bio-Rad	1725271
Straight, fine, sharp point sciessors	Miltex Instruments	MH5-300
T100 Thermocycler	Bio-Rad	621BR71229
Thermo Scientific Nunc 50mL Conical Sterile Polypropylene Centrifuge Tubes, blue racks	Fisher Scientific	12-565-271
Thermo Scientific S1 Pipet Fillers	Fisher Scientific	14387166
Tissue Culture Flask	Fischer Scientific	FB012937	75 cm2 , Vented cap, TC treated, Sterile
True-Stain Monocyte Blocker	BioLegend	426102
Two Stage Brass 0-50 psi General Purpose Cylinder Regulator	Airgas	Y12215B580-AG
Vortex-Genie 2	USA Scientific, Inc.	NC9864336
World Precision Instrument Iris Forceps, 10cm, Curved, Serrated, German	Fisher Scientific	50-822-332
World Precision Instrument Iris Forceps, 10cm, Straight, Serrated	Fisher Scientific	50-822-329
ZymoScript RT PreMix Kit	Zymo Research	R3012
Primers
		Sequence
Cxcl2 (Mouse) forward primer for quantitative PCR	Integrated DNA Technologies	CCAGACAGAAGTCATAGCCACT
Cxcl2 (Mouse) reverse primer for quantitative PCR	Integrated DNA Technologies	GGCACATCAGGTACGATCCA
Il1b (Mouse) forward primer for quantitative PCR	Integrated DNA Technologies	AGTGTGGATCCCAAGCAATACCCA
Il1b (Mouse) reverse primer for quantitative PCR	Integrated DNA Technologies	TGTCCTGACCACTGTTGTTTCCCA
LCN2 (Mouse) forward primer for quantitative PCR	Integrated DNA Technologies	GACTTCCGGAGCGATCAGTT
LCN2 (Mouse) reverse primer for quantitative PCR	Integrated DNA Technologies	CTGTACCTGAGGATACCTGTGC