RESEARCH
Peer reviewed scientific video journal
Video encyclopedia of advanced research methods
Visualizing science through experiment videos
EDUCATION
Video textbooks for undergraduate courses
Visual demonstrations of key scientific experiments
BUSINESS
Video textbooks for business education
OTHERS
Interactive video based quizzes for formative assessments
Products
RESEARCH
JoVE Journal
Peer reviewed scientific video journal
JoVE Encyclopedia of Experiments
Video encyclopedia of advanced research methods
EDUCATION
JoVE Core
Video textbooks for undergraduates
JoVE Science Education
Visual demonstrations of key scientific experiments
JoVE Lab Manual
Videos of experiments for undergraduate lab courses
BUSINESS
JoVE Business
Video textbooks for business education
Solutions
Language
English
Menu
Menu
Menu
Menu
A subscription to JoVE is required to view this content. Sign in or start your free trial.
Research Article
A Young Sim1, Ha Young Kim1, Gil Young Jung1, Jordan E. Axelrad2, Ken Cadwell3,4, Kyung Ku Jang1
1Department of Anatomy, Graduate School of Medical Science, Brain Korea 21 Project,Yonsei University College of Medicine, 2Division of Gastroenterology and Hepatology, Department of Medicine,NYU Grossman School of Medicine, 3Division of Gastroenterology and Hepatology, Department of Medicine,University of Pennsylvania Perelman School of Medicine, 4Department of Pathobiology,University of Pennsylvania Perelman School of Veterinary Medicine
Erratum Notice
Important: There has been an erratum issued for this article. View Erratum Notice
Retraction Notice
The article Assisted Selection of Biomarkers by Linear Discriminant Analysis Effect Size (LEfSe) in Microbiome Data (10.3791/61715) has been retracted by the journal upon the authors' request due to a conflict regarding the data and methodology. View Retraction Notice
We present a protocol to generate single cell-seeded patient-derived intestinal organoids, providing standardized cultures that reduce heterogeneity and improve reproducibility for downstream assays and precision medicine applications.
Recent developments in organoid technology have enabled the creation of patient-derived intestinal organoids (PDIOs) that recapitulate the structural, functional, genetic, and epigenetic features of their original tissues. However, conventional passage-derived organoids inevitably yield heterogeneous populations in size and number, leading to inconsistent results even under identical conditions. To address this, a standardized approach, referred to here as "single cell-seeded PDIOs," was established. In this method, mature PDIOs were enzymatically dissociated into single cells and seeded at a defined number into individual wells of a 96-well plate. This controlled seeding normalized the size and number of PDIOs. Compared with passage-derived organoids, single cell-seeded PDIOs displayed reduced inter-well variability in organoid numbers and intra-well variability in organoid sizes, which enables the determination of generation efficiency and improves the reproducibility of viability assays. Moreover, this platform is compatible with downstream analysis, including transcriptomic analysis and protein expression profiling. Collectively, this approach may enhance experimental consistency and provide a practical foundation for reproducible PDIO-based studies.
The human intestine is a highly complex ecosystem defined by finely tuned interactions among gut microbiota, intestinal epithelium, and the immune system1. These components maintain intestinal homeostasis through tightly regulated signaling networks. For instance, the gut microbiota, comprising over ten trillion microbial organisms, interacts with immune cells to modulate the activity of the immune system and maintains a balanced intestinal environment2. The intestinal epithelium is instrumental in mediating this microbiota-immune system crosstalk3,4. Intestinal stem cells (ISCs), the key driver of epithelial renewal, continuously regenerate and differentiate into specialized cell types, including secretory cell lineages (Paneth cells, goblet cells, enteroendocrine cells, and Tuft cells), absorptive enterocytes, and microfold cells5,6. Together, these cells form a vital physical barrier and functional interface that protects the host against inflammatory stimuli.
In recent years, PDIOs have emerged as a powerful platform in translational research7. These three-dimensional (3D) cultures are created from ISCs isolated from patient tissues and maintained in an extracellular matrix such as extracellular matrix (ECM), along with defined growth factors that recapitulate the ISC niche8,9. Notably, PDIOs retain the genetic and epigenetic characteristics of the donor tissue, allowing sustained expansion and reproducible experimentation. Since Sato et al. first developed PDIOs from leucine-rich repeat-containing G protein-coupled receptor 5+ (Lgr5⁺) ISCs10, subsequent studies have identified essential growth factors for the generation and differentiation of PDIOs, leading to widely adopted protocols across laboratories11,12,13. However, the experimental settings used to treat PDIOs with candidate drugs vary considerably across the studies and are often insufficiently described14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47. Furthermore, PDIOs are typically passaged by mechanical disruption, resulting in heterogeneity in organoid size, morphology, and spatial arrangement. This variability complicates the accurate assessment of drug responsiveness and underlying molecular mechanisms. To address this limitation, recent studies have developed PDIOs derived from single cell-suspension or sorted single cells45,48,49,50,51,52,53,54.
In this article, as one of the complementary and practical methods, "single cell-seeded PDIOs" is introduced to generate standardized PDIOs from a single cell suspension using conventional ECM and media, enabling accurate and reproducible assays. Briefly, single cells isolated from the mature PDIOs were embedded in ECM at defined cell densities, and the resulting cultures were monitored over 2 weeks while number, size, and morphology were quantified. Because each ECM dome is embedded with a known cell input, the organoid count per well is consistent, allowing generation efficiency to be calculated as a readout for regenerative capacity in each organoid line49,54. Although the dome-shaped Matrigel produces size heterogeneity due to the spatial gradient of Wnt3a concentration arising from its inherent instability and limited diffusion55, inter-well size variability in single cell-seeded PDIOs is markedly lower than in passage-derived organoids49,54. However, this approach still has practical limitations. Without fluorescence-activated cell sorting, some organoids may be generated from doublets or triplets, resulting in intrinsic biological heterogeneity within PDIOs. Also, the optimal number of single cells must be empirically determined for each organoid line due to varied generation efficiencies. Finally, fully differentiated single cell-seeded PDIOs were subjected to downstream analyses including quantitative reverse transcription PCR (qRT-PCR), Western blot, and immunohistochemistry.
All materials and reagents required for the experiment are listed in the Table of Materials.
1. Preparation of reagents and materials
2. Thawing and recovery of cryopreserved PDIOs
3. Passaging of PDIOs
4. Single cell-seeded PDIO culture
To generate single cell-seeded PDIOs, mucosal pinch biopsies of the terminal ileum and the ascending colon were collected from consenting healthy subjects during surveillance colonoscopy using 2.8 mm standard biopsy forceps, under the NYU Grossman School of Medicine Institutional Review Board (Mucosal Immune Profiling in Patients with Inflammatory Bowel Disease; S12-01137). Then, single cell-seeded PDIOs were generated by dissociating 6,000 cells isolated from mature PDIOs into the ECM, followed by culturing in DIF. The organoids arose from single cells and began forming bud-like structures on day 6 (Figure 2). To assess the advantage of this approach, passage-derived PDIOs generated by mechanical disruption and PDIOs seeded with 1,000, 3,000, or 5,000 cells were established and cultured in either EXP or DIF13. Organoid formation was proportional to the input number of dissociated single cells (Figure 3A). The organoids cultured in EXP predominantly exhibited a cystic structure, indicative of an undifferentiated state mainly composed of ISCs and transit-amplifying cells. In contrast, single cell-seeded PDIOs cultured in DIF spontaneously developed bud-like structures, a hallmark of increased differentiation (Figure 3A). The sizes of individual organoids were more comparable in single cell-seeded PDIOs than in passage-derived PDIOs (Figure 3B). Consistently, size variability was significantly lower in single cell-seeded PDIOs (Figure 3C). Single cell-seeded PDIOs produced a consistent number of organoids per well with reduced well-to-well variability (Figure 3D,E), indicating that the single cell-seeded approach generates organoids with reduced variance in size and number, thereby generating reproducible results. Despite this reproducibility in size and number of organoids, generation efficiency varied markedly across PDIO lines, ranging from 0.5% to 6% PDIOs (Figure 3F), suggesting that generation efficiency is an intrinsic, line-specific property.
Single cell-seeded PDIOs cultured in DIF for 8-10 days reached a fully differentiated state comprising Paneth cells, goblet cells, and enteroendocrine cells (Figure 4A). To confirm the differentiation at the molecular level, total RNA was extracted from the organoids cultured in EXP or DIF for 10 days using an RNA extraction kit, and cDNA was synthesized using a cDNA synthesis kit. qRT-PCR was performed using SYBR Green-based qPCR master mix in a real-time PCR system. Gene expression levels were normalized relative to ACTB. The primers for the transcript analysis were listed in Table 2. Consistent with the previous studies45,49,56, DIF-cultured PDIOs significantly increased (10 to 1,000-fold) the expression of secretory cell lineage-specific markers, including sPLA2 (Paneth cell), MUC2 (goblet cell), and CHGA (enteroendocrine cell), along with the ATOH1, a master regulator gene of secretory cell lineages49 (Figure 4B).
To further validate cellular differentiation, frozen sections of the organoids were prepared by fixation with 4% paraformaldehyde followed by cryoprotection with 20% sucrose. The fixed organoids were mixed with optimal cutting temperature compound. Compound and frozen in cryomold with 2-methylbutane cooled by dry ice. 10 µm sections were made by cryostat. The air-dried sections underwent permeabilization using 0.2% Triton X-100 solution, followed by incubation with primary and secondary antibodies in 4% (w/v) bovine serum albumin in PBS. The following primary antibodies were used: anti-ATOH1, anti-LYZ1, anti-MUC2, and anti-CHGA. Alexa Fluor 555 conjugated with anti-mouse IgG and Alexa Fluor 488 conjugated anti-rabbit IgG were used as secondary antibodies at a final concentration of 1:500. Nuclei were visualized using antifade mountant with nuclear counterstain. Images were acquired using a fluorescence imaging system. Consistent with transcript analysis, immunofluorescence staining demonstrated increased number of ATOH1+, LYZ1+, MUC2+, and CHGA+ cells within individual organoids of comparable size (Figure 4C) with the comparable size. These data collectively indicate that DIF efficiently promotes differentiation into Paneth cells, goblet cells, and enteroendocrine cells of single cell-seeded PDIOs.

Figure 1: Representative steps of single cell-seeded PDIOs preparation. (A) Organoids after treatment with CRS and centrifugation. (B) Organoid pellet after washing with washing buffer and centrifugation. (C) Organoid pellet following neutralization with DMEM and centrifugation. (D) Filtration of dissociated single cells through a 40 µm cell strainer into a 50 mL tube. (E) Cell counting and transfer into a 1.5 mL tube, showing pellet after centrifugation. Please click here to view a larger version of this figure.

Figure 2: Time course of single cell-seeded PDIO generation. Representative time-course images of single cell-seeded PDIOs from 6,000 cells that were cultured in DIF at the indicated time points. Red arrow marks a single cell, and black arrows indicate the bud-like structure of PDIOs. Scale bars: 150 µm. Please click here to view a larger version of this figure.

Figure 3: Characterization of single cell-seeded PDIOs. (A) Representative images of passage-derived PDIOs or single cell-seeded PDIOs from 1,000, 3,000, or 5,000 cells that were cultured in either EXP or DIF at the indicated time point. (B,C) Surface area (B) and its standard deviation (C) of passage-derived derived-PDIOs or single cell-seeded PDIOs at the indicated time point. (D,E) Organoid count (D) and its standard deviation (E) of passage-derived derived-PDIOs or single cell-seeded PDIOs at the indicated time point. (F) Generation efficiency of single cell-seeded PDIOs. Data points in (B) and (D) represent individual organoids within an individual line. Data points in C, E, and F represent individual organoid lines. Bars represent mean ± SD. Indicated p-values by unpaired t-test. Scale bars in (A): 1,000 µm. Please click here to view a larger version of this figure.

Figure 4: Transcript and protein analysis of single cell-seeded PDIOs. (A) Representative images of single cell-seeded PDIOs from 3,000 cells that were cultured in DIF at days 4, 8, and 10. Scale bars: 1,000 µm. (B) RT-PCR analysis of ATOH1, sPLA2, MUC2, and CHGA. (C) Representative images of ATOH1 staining image (left), MUC2 and CHGA co-staining image (middle), and LYZ1 and CHGA co-staining image (right) in the single cell-seeded PDIOs from 3,000 cells that were cultured in EXP or DIF at day 10. Data points in (B) represent individual organoid lines and the mean of technical duplicates. Bars in (A) represent mean ± SD. Indicated p-values by unpaired t-test. Scale bars in (A) and (B): 1,000 and 200 µm, respectively. Please click here to view a larger version of this figure.
| Component | Concentration |
| Human Noggin protein | 100 ng/mL |
| Human R-Spondin 1 / RSPO1 (21-146) protein | 1 µg/mL |
| Recombinant human Wnt3a surrogate | 100 ng/mL |
| Mouse EGF recombinant protein | 50 ng/mL |
| N-acetyl-L-cysteine | 1 mM |
| [Leu15]-Gastrin I human | 10 nM |
| A 83-01 | 500 nM |
| Human IGF-I, animal-free recombinant protein | 200 ng/mL |
| Human FGF-basic (FGF-2/bFGF) (154 aa) recombinant protein | 100 ng/mL |
| B-27 supplement (50X) serum free | 1X |
Table 1: Growth factors and concentrations used in the DIF medium.
| Target | Organism | Forward 5’-3’ | Reverse 5’-3’ |
| ATOH1 | Homo sapiens | GTCCGAGCTGCTACAAACG | GTGGTGGTGGTCGCTTTT |
| sPLA2 | H. sapiens | CTGCTGTCAGGTGGCTCA | GGAAGACTTTTTGGATTTCTGC |
| MUC2 | H. sapiens | GCTGCTATGTCGAGGACACC | GGGAGGAGTTGGTACACACG |
| CHGA | H. sapiens | TGTAGTGCTGAACCCCCACC | CTCTCGCCTTTCCGGATCT |
| ACTB | H. sapiens | CCCAGCCATGTACGTTGCTA | TCACCGGAGTCCATCACGAT |
Table 2: Primer sequences for RT-PCR.
PDIOs hold immense promise for precision disease modeling, drug screening, and regenerative medicine, as they faithfully preserve the genetic and epigenetic landscape of individual patients. However, their practical applications are often hampered by difficulties in standardizing organoid generation and characterization. To overcome these challenges, an approach using PDIOs derived from single cell suspension or single cells has been introduced in recent studies45,48,49,50,51,52,53,54. The single cell-seeded PDIO, using conventional ECM and media, serves as a complementary and practical method to normalize the quantity, size, and differentiation state of organoids, thereby ensuring reproducible results.
Although many studies report that PDIOs retain their phenotype in a different batch and can be maintained for more than 6 months or over 24 passages11,13,57, both viability and generation efficiency declined noticeably after passage 10 in our experience, reflecting disease-associated vulnerability in ISCs of the lines54. In addition, a subset of PDIO lines displayed an abrupt reduction in proliferation around passage 3 or 4 and subsequently ceased to expand. Based on these observations, it is highly recommended to confirm that each line produces enough organoids (more than 300 organoids per well in a 24-well plate) through passage 4, bank more than 8 cryovials per line under passage 3, and avoid experimental use of PDIOs more than passage 10. These precautions help mitigate phenotypic changes and sudden growth failure while ensuring reproducible assays.
For reproducible generation of single cell-seeded PDIOs, the input organoids should be sufficiently large and in an undifferentiated state. 1-1.5 × 105 cells can be generally obtained from approximately 400 mature, cystic-shaped organoids with a surface area exceeding 2 × 105 µm2. It is highly recommended to harvest organoids maintained in EXP for more than 6 days, because differentiated organoids (grown in DIF) contain fewer ISCs56 and require more than 20 min of enzymatic dissociation reagent treatment to isolate single cells due to their complex architecture with buds. When processing more than 1,000 mature organoids at once, incomplete digestion often yields large tissue clumps. In this case, dissociating the organoids with collagenase and DNase I would minimize clumping and improve single-cell yield. After embedding single cells in the ECM, Y-27632 treatment for the first 3 days prevents anoikis-dependent cell death of single ISC58.
Significant heterogeneity in the generation efficiency of PDIO must be considered, as demonstrated in our previous studies49,54. While the precise mechanisms underlying this variability remain unclear, recent evidence suggests that epigenetic alterations in the primary tissues could influence the organoid-forming capacity of ISCs54. Generation efficiency typically ranges from approximately 0.5% to 6%, influenced by tissue-specific factors such as inflammation status54. Therefore, it is recommended to determine generation efficiency prior to initiating downstream analyses, as around 50 PDIOs per 96-well plate are optimal for clear and consistent morphological and quantitative comparisons.
The plate type and starting number of dissociated cells should be carefully considered for the intended downstream analysis. For transcript analysis, such as qRT-PCR and bulk RNA sequencing, 60-80 PDIOs cultured in 96-well plates typically yield around 600-800 ng of RNA. In contrast, protein-based analysis, such as Western blot and immunohistochemistry, requires a larger number of PDIOs (approximately 300-500). In these cases, dissociating 30,000-50,000 cells per well into a 24-well plate and subsequently combining PDIOs from 2-3 wells on the day of sampling generally yields approximately 50 µg of protein and generates a cryomold containing 200-300 mature PDIOs.
The single cell-seeded PDIO protocol offers distinct advantages over traditional mechanical disruption-based methods, particularly in ensuring reproducibility. However, the results should be interpreted with caution, as PDIOs inherently reflect the biological heterogeneity of their localized region of intestine with inflammation. For example, in Crohn's disease (CD), a subtype of IBD, the inflammation is typically patchy and restricted to a specific segment of the small intestine. As such, the specific anatomical site of the primary tissue can significantly influence the phenotype and molecular profile of the resulting PDIOs, even when using standardized protocols. Comparative analyses of PDIOs derived from multiple regions within the same patient or across diverse patient cohorts may enhance the robustness and generalizability of PDIO-based analyses.
Because the method still embeds organoids in dome-shaped ECM, single cell-seeded PDIOs retain the variability in size, shape, and differentiation (Figure 3A and Figure 4A). A recent study demonstrated substantial size variability among organoids cultured in an ECM dome, according to a spatial gradient of Wnt3a concentration due to its inherent instability and limited diffusion55. These gradients cause spatial heterogeneity in organoid morphology, gene expression, and epithelial differentiation. To address this challenge, alternative platforms such as microwell arrays have been explored59,60,61. For example, Kakni et al. developed a thermoformed microwell-based culture system that supports the growth of individual intestinal organoids under matrix-reduced conditions62. This method significantly enhanced organoid viability, maintained functional integrity, and reduced organoid heterogeneity, representing a promising direction for achieving more standardized and reproducible organoid cultures. Therefore, the combination of single cell-seeded PDIOs with microwell arrays may provide an innovative platform to enhance accurate and reproducible analysis in organoid-based translational research.
Jordan E. Axelrad has received research grants from BioFire Diagnostics, Genentech, Janssen, and Takeda; consultancy fees, honorarium, or advisory board fees from AbbVie, Abivax, Adiso, Biomerieux, Bristol-Myers Squibb, Celltrion, Ferring, Fresenius, Janssen, Merck, Pfizer, Sanofi, Takeda, and Vedanta. K.C. is an inventor on US patent 10,722,600 and provisional patents 62/935,035 and 63/157,225.
This work was supported in part by the National Research Foundation of Korea (NRF) grant funded by the Korea government (MSIT) (RS-2025-00557588, RS-2024-00411768, RS-2025-18362970, and RS-2025-02214844, Kyung Ku Jang); a grant of the Korea Health Technology R&D Project through the Korea Health Industry Development Institute (KHIDI) funded by the Ministry of Health & Welfare, Republic of Korea (RS-2024-00406488, Kyung Ku Jang); National Institutes of Health (NIH) grant DK093668 (Ken Cadwell); K23DK124570 (Jordan E. Axelrad); Crohn's & Colitis Foundation (Jordan E. Axelrad). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
| [Leu15]-Gastrin I human | Sigma-Aldrich | G91450-0.1 mg | |
| 15 mL conical tube | SPL | 50015 | |
| 20X PBS, pH 7.4 | Biosesang | P2007-7.4 | |
| 50 mL conical tube | SPL | 50050 | |
| A 83-01 | Tocris | 2939-10 mg | |
| Advanced DMEM/F-12 | Gibco | 12634010 | |
| Axygen 1000 µL pipet tips, wide-bore, clear, nonsterile | Axygen | T-1005-WB-C | |
| Axygen 200 µL pipet tips, wide-bore, clear, nonsterile | Axygen | T-205-WB-C | |
| B-27 supplement (50X) serum free | Gibco | 17504044 | |
| Bovine serum albumin | Roche | 10735078001 | |
| Corning 96-well clear polystyrene microplates | Corning | 3599 | |
| Corning cell recovery solution | Corning | 354253 | |
| Corning ECM Matrix (Corning Matrigel) | Corning | 356231 | |
| Costar 24-well clear TC-treated multiple well plates | Corning | 3526 | |
| DMEM high glucose w/ stable glutamine w/ sodium pyruvate | Biowest | L0103-500 | |
| Gentamicin | Gibco | 15750060 | |
| Gentle cell dissociation reagent | Stemcell | 100-0485 | |
| Human FGF-basic (FGF-2/bFGF) (154 aa) recombinant protein | Gibco | 100-18B-100UG | |
| Human IGF-I, animal-free recombinant protein | Gibco | AF-100-11-500UG | |
| Human Noggin protein | Acrobiosystem | NON-H5219-1mg | |
| Human R-Spondin 1 / RSPO1 (21-146) protein | Acrobiosystem | RS6-H4220-1mg | |
| IntestiCult Organoid Growth Medium (Human) | Stemcell | 6010 | |
| L-glutamine 100X | Biowest | X0550-100 | |
| Mouse EGF recombinant protein | Gibco | 315-09-100UG | |
| N-acetyl-L-cysteine | Sigma-Aldrich | A9165-5 g | |
| Penicillin-streptomycin solution 100X | Biowest | l0022-100 | |
| Recombinant human Wnt3a surrogate | Acrobiosystem | WNE-W5253-50ug | |
| TrypLE (enzymatic dissociation reagent) express enzyme (1X), no phenol red | Gibco | 12604013 | |
| Y-27632 dihydrochloride | Tocris | 1254-10MG |