RESEARCH
Peer reviewed scientific video journal
Video encyclopedia of advanced research methods
Visualizing science through experiment videos
EDUCATION
Video textbooks for undergraduate courses
Visual demonstrations of key scientific experiments
BUSINESS
Video textbooks for business education
OTHERS
Interactive video based quizzes for formative assessments
Products
RESEARCH
JoVE Journal
Peer reviewed scientific video journal
JoVE Encyclopedia of Experiments
Video encyclopedia of advanced research methods
EDUCATION
JoVE Core
Video textbooks for undergraduates
JoVE Science Education
Visual demonstrations of key scientific experiments
JoVE Lab Manual
Videos of experiments for undergraduate lab courses
BUSINESS
JoVE Business
Video textbooks for business education
Solutions
Language
English
Menu
Menu
Menu
Menu
A subscription to JoVE is required to view this content. Sign in or start your free trial.
Research Article
Erratum Notice
Important: There has been an erratum issued for this article. View Erratum Notice
Retraction Notice
The article Assisted Selection of Biomarkers by Linear Discriminant Analysis Effect Size (LEfSe) in Microbiome Data (10.3791/61715) has been retracted by the journal upon the authors' request due to a conflict regarding the data and methodology. View Retraction Notice
This protocol describes the isolation and culture of primary rat knee articular chondrocytes using sequential enzymatic digestion. The method yields chondrocytes with validated phenotypic characteristics, providing researchers with a reliable approach for cartilage research applications.
Cartilage damage resulting from trauma, aging, or inflammatory conditions remains a significant clinical challenge due to the tissue's inherently limited regenerative capacity. Chondrocytes, being the sole cellular component of cartilage, are responsible for maintaining extracellular matrix structure and function, making them essential for understanding cartilage physiology, pathology, and regeneration. The current study presents a comprehensive and standardized protocol for the isolation, culture, and phenotypic verification of primary rat articular chondrocytes from the knee joint. The procedure utilizes young, suckling rats to ensure maximal cell viability and employs sequential enzymatic digestion with trypsin and collagenase type II for efficient cell extraction. The chondrocyte phenotype is verified through type II collagen immunofluorescence, flow cytometric analysis, and Interleukin (IL)-1β stimulation assays to confirm cellular identity and inflammatory responsiveness. This optimized and reproducible workflow enables the generation of high-purity chondrocyte cultures suitable for drug screening, mechanistic investigations, and tissue engineering applications, advancing cartilage biology research.
Cartilage is a specialized type of connective tissue that performs multiple crucial functions, including providing support, cushioning, and shock absorption1. It plays a vital role in maintaining structural stability and ensuring mobility within the skeletal system2,3. Mechanical injury, degenerative changes, inflammation, or metabolic abnormalities can cause damage to cartilage4,5,6. Due to its inherent lack of blood vessels and nerves, combined with the limited proliferative capacity of chondrocytes, the repair of cartilage presents significant challenges. Diseases such as osteoarthritis (driven by degenerative changes and mechanical injury) and rheumatoid arthritis (caused by autoimmune inflammatory responses) can cause irreversible cartilage damage, greatly diminishing patients' quality of life7,8,9. As the exclusive cell type within cartilage tissue, chondrocytes are responsible for key functions such as the secretion and maintenance of the extracellular matrix, support of skeletal development, participation in joint cushioning and repair, and central regulation of cartilage growth and metabolism10,11,12.
Chondrocytes are confined within avascular matrix lacunae, resulting in severely limited capacity for their own proliferation and tissue repair13,14. The functional status of chondrocytes directly determines the health of cartilage tissue15. Chondrocyte dysfunction, caused by aging, inflammation, trauma, or genetic factors, results in decreased matrix synthesis and increased degradation16,17. This pathological process drives cartilage degeneration (such as in osteoarthritis), leading to the impairment of its essential support, cushioning, and lubrication functions. The limited regenerative capacity of cartilage is the core reason for the significant challenge in its repair and constitutes a key research area in modern orthopedics and regenerative medicine. Current research on cartilage has become a major focus in the field, with drug-based interventions, tissue engineering, and gene therapy all requiring the isolation of chondrocytes for in vitro studies18,19,20,21,22,23,24,25. Consequently, isolating and identifying chondrocytes constitutes a critical step in many experimental approaches. While immortalized chondrocyte-like cell lines such as SW1353 are used as convenient surrogates in some studies, they lack the expression of critical phenotypic markers, most notably type II collagen, which is essential for authentic chondrocyte function and matrix formation26. Therefore, primary chondrocytes remain the gold standard for research requiring physiological relevance. Compared to previously published protocols requiring multiple enzyme combinations or extensive mechanical manipulation, the simplified enzymatic digestion approach reduces complexity and processing time compared to methods requiring multiple enzyme combinations or extensive mechanical manipulation. Furthermore, the incorporation of comprehensive validation steps ensures consistent identification of functional chondrocytes and enhances reproducibility across experiments and laboratories.
Chondrocytes are characterized by their secretion of type II collagen, while under stimulation by inflammatory factors, they extensively synthesize and release matrix metalloproteinases (MMPs)27. Therefore, following chondrocyte isolation, the cells were identified via type II collagen immunofluorescence, and chondrocyte purity was assessed using flow cytometry. And stimulated with Interleukin (IL)-1β to confirm their characteristic synthesis and secretion of matrix metalloproteinases. This study describes the process of chondrocyte extraction and characterization from neonatal mice, establishing a foundation for subsequent chondrocyte-related experiments.
The use of animal subjects in this study was approved by the experimental animal care and welfare ethics committee of China-Japan Friendship Hospital (No. zryhyy21-21-05-16). The reagents and the equipment used are listed in the Table of Materials.
1. Experimental animals and preparatory work
NOTE: Cartilage from the joints of rats, rabbits, and humans following total knee arthroplasty can be used for chondrocyte isolation. However, due to their higher viability, suckling rats were utilized for chondrocyte extraction in this study.
2. Isolation of articular cartilage tissue
NOTE: The neonatal cartilage appears as a translucent, bluish-white layer covering the bony epiphysis. Strict aseptic techniques must be followed during this step to avoid contamination that may compromise subsequent experiments.
3. Digestion of cartilage tissue
NOTE: Use trypsin to digest connective tissues surrounding the cartilage, followed by 0.2% collagenase II for cartilage matrix digestion.
4. Chondrocyte isolation and culture
NOTE: All procedures must be performed under sterile conditions in a biosafety cabinet. Sterile gloves should be worn during mechanical dissociation of cartilage tissue using a syringe plunger on the cell strainer to prevent experimental contamination. Under standard culture conditions, primary chondrocytes typically require approximately 2-3 days to reach 80%-90% confluence for the first passage.
5. Type II collagen immunofluorescence staining for chondrocyte identification
NOTE: The adhered chondrocytes are characterized by a spindle-shaped and polygonal morphology. All biomarker analyses presented in this study were performed using cells at Passage 2. Chondrocytes at passage 3 begin to exhibit more pronounced dedifferentiation, characterized by a shift toward a spindle-shaped, fibroblast-like morphology and a deceleration in proliferation rate. This phenotypic change becomes more evident after passage 4. By passage 6, the vast majority of cells adopt an elongated, fibroblast-like shape. The antibody dilutions were determined based on the manufacturer's recommendation and validated by our preliminary experiments to ensure optimal specificity and signal intensity.
6. Flow cytometric analysis of chondrocyte purity
NOTE: Chondrocytes are characterized by their ability to synthesize and secrete type II collagen, which serves as a definitive marker for identification. The chondrosarcoma cell line SW1353, while exhibiting some chondrocytic characteristics, lacks type II collagen secretion capacity and thus serves as the negative control in this experiment.
7. IL-1β stimulation of chondrocytes
NOTE: The production of matrix metalloproteinases (MMPs) in response to IL-1β stimulation is a hallmark feature of chondrocytes. Therefore, this study employs IL-1β stimulation to validate this phenotypic characteristic in isolated chondrocytes.
8. Quantitative Real-Time PCR (qRT-PCR) analysis
NOTE: All RNA-related experiments were performed using DEPC-treated consumables. Briefly, tubes and tips were soaked in 0.1% DEPC for 12h, autoclaved (121 °C, 20 min) to inactivate both RNases and residual DEPC, and oven-dried prior to use.
9. ELISA assay
NOTE: Prepare biotinylated antibody working solution and enzyme conjugate working solution fresh before use.
10. Western blot analysis
NOTE: Prior to the experiment, prepare electrophoresis buffer, transfer buffer, TBST, 5% skim milk, and cut PVDF membrane to the appropriate size in advance. Subsequently, capture the chemiluminescent signals using a chemiluminescence imaging system. Set the instrument to automatic or manual mode for gradient exposure, which typically ranges from 10 s to 5 min, to ensure signals are captured within the linear dynamic range and to avoid pixel saturation. After signal capture, select the exposure image where the target bands are clear and the background is low for subsequent quantitative analysis.
Immunofluorescence staining for type II collagen demonstrated that the isolated chondrocytes were strongly positive (Figure 1A). Flow cytometric analysis further demonstrated that more than 98% of the cells were positive for type II collagen (Figure 1B), whereas the negative control SW1353 cells were negative (Figure 1C). Following stimulation with 10 ng/ml IL-1β for 24 h, Western blotting demonstrated a marked elevation in MMP3 and MMP13 protein levels in chondrocytes (Figure 2A), RT-PCR analysis revealed a significant increase in MMP3 and MMP13 mRNA expression in chondrocytes (Figure 2B) and ELISA detected a substantial rise in MMP3 and MMP13 protein content in the cell culture supernatants (Figure 2C).

Figure 1: Immunofluorescence and flow cytometry analysis of type II collagen expression. (A) Immunofluorescence detection of type II collagen in chondrocytes, with DAPI staining for nuclei. Scale bars: 500 µm. (B) Flow cytometry analysis of type II collagen labeling in chondrocytes. (C) Flow cytometry analysis of type II collagen labeling in SW1353 cells. Please click here to view a larger version of this figure.

Figure 2: IL-1β-induced upregulation of MMP3 and MMP13 in chondrocytes. Chondrocytes were stimulated with 10 ng/mL IL-1β for 24 h. (A) Western blot analysis of MMP3 and MMP13 protein expression in chondrocytes. (B) RT-PCR analysis of MMP3 and MMP13 mRNA levels in chondrocytes. (C) ELISA quantification of MMP3 and MMP13 concentrations in the culture supernatant. Data are presented as mean ± SD (n = 3). Please click here to view a larger version of this figure.
| Gene name | Primer Sequence (5′ to 3′) |
| Rat MMP3 | Sense: ACATGGAGACTTTGTCCCTTTTG |
| Antisense: TTGGCTGAGTGGTAGAGTCCC | |
| Rat MMP13 | Sense: CTTCTTCTTGTTGAGCTGGACTC |
| Antisense: CTGTGGAGGTCACTGTAGACT | |
| Rat GAPDH | Sense: GCCAAGTATGATGACATCAAGAAG |
| Antisense: TCCAGGGGTTTCTTACTCCTT |
Table 1: Polymerase chain reaction (PCR) primer sequences used in this study.
The protocol described here offers several key advantages for the isolation and culture of primary rat articular chondrocytes. The use of suckling rats is critical for achieving optimal cell yield and viability, as cartilage from young animals contains more proliferative chondrocytes and less mineralized matrix compared to adult cartilage. This age selection significantly improves the efficiency of enzymatic digestion and subsequent cell recovery.
The sequential enzymatic digestion approach represents a crucial aspect of this protocol. The initial trypsin treatment effectively removes peripheral connective tissues and partially disrupts the cartilage matrix, while the subsequent collagenase II digestion specifically targets the type II collagen-rich extracellular matrix surrounding chondrocytes. The 4-h collagenase digestion time has been optimized to balance complete cell release with minimal cell damage. Shorter digestion periods may result in incomplete cell liberation, while extended exposure can compromise cell viability and phenotype.
Mechanical dissociation using a syringe plunger is essential for breaking apart cartilage fragments and releasing individual cells. This step must be performed gently to avoid excessive cell damage while ensuring adequate tissue disruption. The use of sterile techniques throughout the procedure is paramount, as chondrocyte cultures are particularly susceptible to contamination.
The multi-faceted validation approach employed in this protocol ensures the authenticity and functionality of isolated chondrocytes. Type II collagen immunofluorescence staining serves as the gold standard for chondrocyte identification, as this protein is exclusively produced by chondrocytes in cartilaginous tissues28. The high purity achieved (>98% positive cells) demonstrates the effectiveness of the isolation method and minimal contamination with other cell types, such as synoviocytes or fibroblasts.
Flow cytometric analysis provides a quantitative assessment of cell purity and can be used for high-throughput quality control29. The use of SW1353 cells as a negative control is particularly valuable. Although SW1353 cells exhibit chondrocyte-like properties and are commonly used as a surrogate for chondrocytes in experiments, they do not express type II collagen, a key characteristic of functional chondrocytes30. This makes them a reliable negative reference in such studies.
The IL-1β stimulation assay confirmed that isolated chondrocytes retained their functional capacity to react to inflammatory signals. IL-1β treatment triggered MMP13 upregulation at both transcriptional and secretory levels, verifying the cells' pathological response and affirming their utility for disease modeling research. It should be noted that this response is a hallmark yet non-exclusive feature of chondrocytes, as other joint-associated cells like fibroblast-like synoviocytes and mesenchymal stem cells also upregulate MMPs upon IL-1β stimulation.
Compared to previously published protocols, this method offers several improvements. The simplified enzymatic approach reduces the complexity and time requirements compared to methods requiring multiple enzyme combinations or extensive mechanical manipulation. The incorporation of comprehensive validation steps ensures consistency and reproducibility across different experiments and laboratories.
The protocol's emphasis on maintaining sterile conditions throughout the procedure minimizes contamination risks, which have been a significant challenge in chondrocyte culture. Additionally, the detailed troubleshooting guidelines and quality control measures help ensure successful outcomes even for novice researchers. The high-quality chondrocytes obtained using our isolation and culture protocol hold significant potential for various bioengineering applications. Primarily, these cells serve as an essential cell source for cartilage tissue engineering, where they can be seeded onto biocompatible scaffolds to create functional constructs for repairing articular cartilage defects31,32. Furthermore, with the advancement of 3D bioprinting technology, these chondrocytes can be utilized as bio-inks to fabricate sophisticated, patient-specific cartilage tissue models for drug screening and disease modeling33.
Limitations and considerations
Despite its advantages, this protocol has certain limitations that should be acknowledged. The use of young animals limits the direct relevance to age-related cartilage diseases, where aged chondrocytes may exhibit different biological characteristics. Researchers studying age-related cartilage degeneration may need to adapt this protocol for older animals, though this typically results in lower cell yields and altered cell behavior. Chondrocytes isolated using this method are best used within the first three passages, as extended culture periods can lead to dedifferentiation and loss of the chondrocytic phenotype. Researchers should monitor cell morphology and marker expression throughout culture to ensure maintenance of the desired phenotype.
The authors report no conflicts of interest in this work.
This study was supported by the National High-Level Hospital Clinical Research Funding and Elite Medical Professionals Initiative of China-Japan Friendship Hospital (NO.ZRJY2025-QM05).
| 4% Paraformaldehyde | Solarbio | P1110 | |
| 5× Loading Buffer | Solarbio | P1040 | |
| Alexa Fluor 488-conjugated anti-rabbit IgG | Zhongshan Jingqiao Biotechnology | ZF-0511 | |
| Animal-free Blocking Solution | Cell Signaling Technology | 15019 | |
| Anti-Collagen II antibody | Abcam | ab34712 | |
| Bicinchoninic Acid (BCA) Protein Assay Kit | Solarbio | PC0020 | |
| Collagenase II | Yeasen Biotechnology | 40508ES60 | |
| DAPI-containing Fluorescent Mounting Medium | Zhongshan Jingqiao Biotechnology | ZLI-9556 | |
| Dulbecco's Modified Eagle Medium | Solarbio | 11995 | |
| Fetal bovine serum (FBS) | Solarbio | S9010 | |
| Horseradish Peroxidase (HRP)-Conjugated Goat Anti-Rabbit IgG | Zhongshan Jingqiao Biotechnology | ZB-2301 | |
| IL-1β | peprotech | 400-01B | |
| MMP13 Rabbit mAb | ABclonal | A11148 | |
| MMP3 Rabbit mAb | ABclonal | A11418 | |
| Non-Fat Dry Milk | Solarbio | D3840 | |
| Phosphate Buffered Saline (PBS) | Solarbio | P1020 | |
| PVDF Membrane | Thermo Fisher Scientific | 88518 | |
| Rat MMP-13 ELISA Kit | Nouvs | NBP3-06931 | |
| Rat MMP-3 ELISA Kit | Nouvs | NBP3-06894 | |
| Reverse Transcription Kit | Promega | A3500 | |
| RIPA Lysis Buffer | Solarbio | R0010 | |
| RNase-free Water | Solarbio | R1600 | |
| SDS-PAGE Gel | Epizyme | PG112 | |
| SYBR Green Real-time PCR Master Mix | Toyobo | QPK-201 | |
| Triton X-100 | Solarbio | T8200 | |
| TRIzol | Solarbio | 15596026 | |
| Trypsin | Solarbio | T1320 | |
| Ultra-sensitive ECL Chemiluminescence Substrate Kit | NCM Biotech | P10300 | |
| β-Actin Rabbit mAb | ABclonal | AC026 |