Method Article

CRISPR/Cas9-Mediated Generation and Characterization of an Ent2*/CyO Drosophila melanogaster Strain

DOI:

10.3791/69546

August 7th, 2026

 ,  ,  ,  ,  ,  ,  , 

Corresponding Authors: Guangyu Cheng <chenggy@ccucm.edu.cn>

In This Article

Summary

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Equilibrative nucleoside transporter 2 (ENT2) is a conserved transmembrane protein involved in nucleoside transport and cellular metabolism. In this study, a CRISPR/Cas9-based genome editing workflow was established to generate an Ent2-targeted allele in Drosophila melanogaster. A stable Ent2*/ CyO heterozygous line was constructed and maintained using a balancer chromosome strategy. This work describes the design, generation, and molecular validation of the mutant line, as well as its phenotypic characterization under different temperature conditions. The established workflow and mutant strain provide a practical framework for studying genes with homozygous lethal phenotypes and for investigating temperature-associated phenotypic variation in Drosophila.

Abstract

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

In this study, a CRISPR/Cas9-based genome-editing approach was used to introduce mutations in the equilibrative nucleoside transporter 2 (Ent2) gene in Drosophila melanogaster. Guide RNAs targeting the coding region of Ent2 were designed and co-injected with Cas9 mRNA into w1118 embryos. Mutant alleles were identified by Sanger sequencing and maintained as a stable Ent2*/CyO heterozygous line using a balancer chromosome. Subsequently, we evaluated body weight, climbing ability, survival rate, and the activities of superoxide dismutase (SOD) and catalase (CAT) in fruit flies at 22 °C and 25 °C, respectively. The results indicate that at both 22 °C and 25 °C, the body length and weight of Ent2*/CyO fruit flies were significantly reduced compared to the w1118, and their development was delayed. At 22 °C, the overall lifespan of Ent2*/CyO flies was slightly longer than that of the w1118, whereas at 25 °C, no significant difference was observed. Regarding locomotor ability, the climbing performance of heterozygous flies was significantly lower than that of the w1118 at both temperatures, with males being more severely affected. In addition, the antioxidant enzyme activities of CAT and SOD in Ent2*/CyO fruit flies were significantly reduced, indicating a clear impairment of antioxidant capacity. These results describe the phenotypic profile of a CRISPR-generated Ent2 mutant line and demonstrate the feasibility of combining genome editing with balancer chromosome strategies in Drosophila. This study provides a methodological framework and a genetic resource for future investigations of genes associated with metabolism and environmental responses.

Introduction

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Drosophila melanogaster remains one of the most widely used model organisms for genetics and developmental biology1. It is characterized by a short life cycle, rapid reproduction, established genetic manipulation tools, and a fully annotated genome2,3. This species is extensively applied in studies of gene function, metabolic regulation, and environmental adaptability4,5. Nucleosides and their derivatives such as ATP are central to cellular energy generation, nucleic acid synthesis, and signal transduction in Drosophila, reflecting conserved metabolic regulation across metazoans6. Purinergic signaling pathways in Drosophila, which depend on extracellular adenosine and nucleoside transport mechanisms, highlight the functional role of nucleoside movement across membranes in coordinating energy and signal transduction responses7. Among these processes, the transport of nucleosides across the cytoplasmic membrane is primarily mediated by the equilibrative nucleoside transporter (ENT) family, with DmENT2 exhibiting functional transport activity in Drosophila8.

The ENT family comprises multiple subtypes, among which ENT2 is a extensively studied transmembrane nucleoside transporter9. It facilitates the energy-independent transmembrane transport of various purine and pyrimidine nucleosides10,11. In mammals, ENT2 is a ubiquitously expressed bidirectional transporter that facilitates the cellular uptake of purine and pyrimidine nucleosides and nucleobases. This transport activity contributes to nucleotide salvage and helps maintain cellular metabolic homeostasis12. ENT2 also mediates the transport of a variety of nucleoside‑derived drugs, extending its functional relevance beyond endogenous nucleoside movement, highlighting its broader physiological and clinical importance13. Moreover, ENT2 has been implicated in neurological disorders14, tumor metabolism15, vascular dysfunction16, and cellular energy metabolism in humans17. However, studies addressing the organism-level roles of Ent2 in Drosophila remain limited.

The roles of ENT2 in growth and development, energy metabolism, locomotor performance, and antioxidant capacity under varying temperature conditions have not been fully explored18. Temperature strongly affects basal metabolic rate and lifespan in Drosophila, with higher rearing temperatures generally increasing metabolic activity and reducing longevity19. These temperature‑dependent changes in gene expression can influence physiological pathways and thus may modify the phenotypic effects of specific gene mutations20.

Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR-associated protein 9 (CRISPR/Cas9) has been widely applied in Drosophila for various genomic modification operations such as site-specific knockout, deletion, replacement, and tag introduction, demonstrating its efficiency and reliability21,22,23. The latest progress indicates that CRISPR-derived base editors can also be used for finer site-specific base modifications in Drosophila, providing a new tool for point mutations and precise phenotypic control24. Traditional mutagenesis methods, including chemical and radiation mutagenesis as well as transposon‑mediated screens, can generate genetic mutations25. These approaches are often limited by low efficiency and high randomness in the mutation events. As a result, researchers must screen large numbers of individuals to isolate specific alleles of interest26. CRISPR/Cas9 enables programmed guide RNA (gRNA)‑directed cleavage at specified DNA sequences. The resulting double-strand breaks are repaired through non‑homologous end joining or homology‑directed repair, generating defined, heritable mutations and significantly reducing background mutations that could confound phenotypic analysis27,28. Mutant alleles generated via CRISPR/Cas9 can be maintained in a heterozygous state by linkage with balancer chromosomes, such as Curly O (CyO)29. This strategy has been shown to effectively prevent the loss of lethal alleles in homozygous form in Drosophila genetics. As a result, it supports long-term and systematic phenotypic assessment, including functional studies under varying temperatures or environmental conditions29,30. The simple design and high efficiency of CRISPR/Cas9 have significantly shortened the cycle of strain construction and enhanced the stability of the genetic background. This is particularly important for studying long-term environmental factors such as temperature response and developmental homeostasis.

Building on this foundation, the Ent2 gene in Drosophila melanogaster was knocked out using the CRISPR/Cas9 system, and a stably inherited Ent2*/CyO heterozygous mutant strain was established. The developmental cycle, body weight, locomotor ability, and activities of the antioxidant enzymes SOD and CAT were systematically assessed. By comparing multidimensional phenotypes of w1118 and mutant flies under varying temperature conditions, this study aims to present a reproducible strategy for generating and maintaining CRISPR-derived mutant lines and provides a descriptive characterization of the resulting phenotypes. This work offers a methodological framework and a useful genetic resource for future studies investigating genes involved in metabolism and environmental responses.

Protocol

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

1. Design of CRISPR/Cas9 targets for the Ent2 gene

  1. Select candidate CRISPR sites in exons 2 and 5 of Ent2 (FlyBase ID: FBgn0263916) using CHOPCHOP (v3)31 and the CCTop (v1.0)32.
  2. The reference genome was defined as Drosophila melanogaster Release 6 (dm6) (RefSeq assembly accession: GCF_000001215.4). Then, candidate gRNA sites were identified. Finally, the identified sites were filtered to obtain the optimal gRNAs.
  3. Filter targets by MIT Specificity Score ≥ 80 (CHOPCHOP), CFD score ≤ 0.1 (CCTop), GC content 40%–60%, and minimal PAM distance.
  4. Rank targets with a weighted score (efficiency 50%, specificity 30%, GC optimization 20%) and choose two gRNAs.
  5. Add one “G” to the 5′ end of each gRNA to satisfy the T7 promoter requirement. Use the following gRNA-specific forward oligonucleotides to generate the full-length sgRNA transcription template by PCR:
    Ent2-sg1-F: TAATACGACTCACTAT
    AGGTGACGTTAAATCCATCGTGTTTTAGAGCTAGAAATAGC
    Ent2-sg2-F: TAATACGACTCAC
    TATATTGCCGTTGGAATCATGGGGGTTTTAGAGCTAGAAATAGC
  6. The remaining sgRNA scaffold sequence is provided by the universal reverse oligonucleotide during PCR.

2. Preparation of sgRNA transcription templates

  1. Preparation of sgRNA transcription templates
    1. Assemble a 60 µL PCR reaction mixture using the double-oligonucleotide annealing–PCR method33 per the manufacturer’s instructions. Combine the gRNA-specific forward oligonucleotide (Ent2-sg1-F or Ent2-sg2-F) with a universal reverse oligonucleotide encoding the sgRNA scaffold to obtain the full-length dsDNA template for in vitro transcription.
    2. Program the thermocycler: 95 °C 3 min; 35 cycles of 95 °C 30 s, 55 °C 30 s, 72 °C 20 s; then 72 °C 10 min; hold at 12 °C.
  2. Purify the transcription template
    1. Add 100 µL ammonium acetate (see Table of Materials) to 60 µL PCR product; mix. Add 400 µL anhydrous ethanol; invert to mix and incubate at -20 °C for 20 min.
    2. Centrifuge at 4 °C, 20,000 x g for 15 min; discard supernatant.
    3. Air-dry the pellet with the tube open for 10 min. Resuspend the pellet in 10 µL of nuclease-free ddH₂O.
  3. In Vitro Transcription of gRNA
    1. Set up a 10 µL T7 in vitro transcription reaction following the kit instructions (see Table of Materials).
    2. Incubate at 37 °C for 35 min. Add 0.5 µL DNase I (provided in the transcription kit) and incubate at 37 °C for 15 min.
  4. Purify gRNA
    1. Dilute the transcription mixture to 60 µL with nuclease-free ddH₂O. Add 60 µL water-saturated phenol/chloroform (see Table of Materials ); vortex briefly and centrifuge at 4 °C, 16,000 x g for 5 min.
    2. Transfer 45 µL of the aqueous phase to a new 1.5 mL RNase-free tube. Add 5 µL sodium acetate; mix.
    3. Add 125 µL pre-chilled anhydrous ethanol; mix and incubate at -20 °C for 20–30 min. Centrifuge at 4 °C, 20,000 x g for 15 min; discard supernatant.
    4. Wash the pellet with 200 µL of 70% ethanol (RNase-free); centrifuge at 4 °C, 20,000 x g for 5 min; remove supernatant.
    5. Dry the pellet at 37 °C until ethanol evaporates completely. Resuspend in 20 µL ddH₂O; aliquot and store at -80 °C.
    6. Measure the gRNA concentration using a NanoDrop spectrophotometer and adjust the concentration to 250 ng/µL for injection. Ensure the purity of the gRNA with an A260/A280 ratio of approximately 2.0.
      NOTE: We emphasize that gloves must be worn throughout the entire process for RNase protection. All consumables, including pre-cooled RNase-free centrifuge tubes and pipette tips, must be used consistently during the procedure. Organic reagent waste generated during the operation must be collected separately in designated waste containers according to type and regularly transported to a certified hazardous waste disposal facility for proper handling.

3. Preparation of Cas9 mRNA

  1. Preparation of the Transcription Template
    NOTE: Use RNase-free tips and tubes throughout RNA-related steps.
    1. Thaw the Cas9 expression plasmid MLM3613 (see Table of Materials) on ice. In an RNase-free tube, combine 20 µg plasmid DNA, 7.5 µL 10x restriction buffer, 1 µL PmeI (10,000 U/mL), and nuclease-free ddH₂O to 75 µL.
    2. Incubate at 37 °C for 30 min. Verify complete linearization by loading 5 µL onto a 1% agarose gel at 120 V for 30 min.
  2. Purification of Transcription Templates
    1. Add 23 µL 2% sodium dodecyl sulfate (SDS, see Table of Materials for details) and 0.5 µL proteinase K (see Table of Materials for details) to 70 µL of the digest; incubate at 50 °C for 30 min.
    2. Add 45 µL chloroform and 45 µL Tris-saturated phenol; vortex briefly; centrifuge 13,800 x g, 5 min.
    3. Transfer 90 µL aqueous phase to a new tube. Add 10 µL sodium acetate (provided by the kit) and 200 µL pre-cooled anhydrous ethanol; mix; incubate −20 °C, 30 min.
    4. Centrifuge 20,000 x g, 4 °C, 15 min; discard supernatant. Wash the pellet twice with 100 µL 70% ethanol; centrifuge 20,000 x g, 2 min each; air-dry.
    5. Dissolve DNA in 20 µL nuclease-free ddH₂O; confirm >500 ng/µL.
  3. In vitro transcription with co-capping
    1. Set up the reaction using a T7 in vitro transcription kit with capping (see Table of Materials) according to the manufacturer’s instructions.
    2. Incubate at 37 °C for 2 h to generate capped Cas9 mRNA.
    3. After the transcription reaction is complete, add 1 µL of DNase (provided in the kit, concentration 2 U/µL), mix thoroughly, and incubate at 37°C for 15 min to degrade the DNA template.
  4. Add a poly(A) tail
    1. Bring the RNA to 14 µL ddH₂O.
    2. Add 2 µL 10x E. coli Poly(A) Polymerase buffer, 2 µL ATP (10 mM), 1 µL RNase inhibitor, and 1 µL Poly(A) polymerase.
    3. Incubate at 37 °C for 45 min.
  5. Purify the mRNA
    1. Apply the reaction to a spin-column total RNA kit (see Table of Materials). Load the sample onto a 2 mL silica membrane spin column; centrifuge 8,000 x g, 15 s; discard flow-through.
    2. Add 500 µL of RPE buffer to the RNeasy column, centrifuge at 8000 x g for 15 s, and discard the residual liquid. Repeat this step once, then centrifuge for 2 min and discard the residual liquid.
    3. Place the RNeasy column in a new 1.5 mL centrifuge tube. Add 30 µL of RNase-free ddH₂O, centrifuge at 8000 x g for 1 minute to elute the RNA. Adjust the mRNA concentration to 500 ng/µL for injection. Store the eluted RNA at -80 ℃.

4. Microinjection of Drosophila Embryos

  1. Preparation of Injection Samples
    1. Mix 15 µg Cas9 mRNA with 7.5 µg double-stranded gRNA at a volume ratio of 2:1.
    2. Adjust to 30 µL with DEPC-treated RNase-free water; keep on ice.
  2. Drosophila rearing
    1. Transfer the injected Drosophila strain w1118 to large food tubes for amplification. w1118 flies were used as the reference control to represent the baseline physiological state without balancer-associated effects.
    2. Maintain the flies in an artificial climate chamber set at 25 °C with a humidity of 60%–70% and a 12:12 light-dark cycle for 14 days.
    3. At 17:00 on the day following the 14-day rearing period (Day 15), collect adult flies to synchronize timed embryo laying. This specific collection time ensures that embryos used for injection are at a consistent developmental stage. Controlling the time of day is important for minimizing circadian rhythm effects on embryo development and reproductive behavior, thereby ensuring experimental reproducibility and reducing physiological variability between batches.
  3. Microinjection of Drosophila
    1. Collect adult flies for injection into fly cages, with approximately 400 adults per cage. Collect embryos on yeast-coated agar plates; collect embryos within 60 min of egg laying and rinse them onto coverslips. No dechorionation was performed prior to injection.
    2. Align the embryos on coverslips with their posterior poles facing outward, arranged in an orderly manner from top to bottom. Ensure that the injection needle penetrates the posterior pole to an appropriate depth (approximately one-fifth of the embryo length) for consistent cytoplasmic delivery. A total of 300 embryos were used in this study.
    3. Under a stereomicroscope, focus the needle tip and embryo in the same plane.
    4. Using the injection instrument, pierce the posterior pole and inject 0.001 µL of the mix into each embryo.
    5. Transfer injected embryos to food vials; incubate at 25 °C, ~70% relative humidity (RH) to obtain P₀ generation (the injected adults that survive to produce progeny).

5. Construction of stable expression strains in Drosophila

  1. Cross eclosed P₀ with Bc/CyO flies.
    1. Microinject a mixture of gRNA targeting the gene of interest and Cas9 protein into 300 embryos of the w1118 Drosophila strain. After injection, obtain a total of 30 viable and fertile P0 adults. Cross each P0 adult (mosaic) individually with flies from the w1118 strain, yielding 16 single-pair crosses (8 vials with P0 males crossed to virgin females and 8 vials with P0 females crossed to males). Maintain all crosses at 25 °C under constant culture conditions.
    2. After the appearance of F1 larvae, remove the P0 parental flies. Extract genomic DNA from the F1 progeny and subject it to PCR analysis to determine the F1 adult genotypes (Ent2/+).
    3. Generate F2 progeny by single crosses between Bc/CyO flies. Select individual F2 adults and genotype them to identify flies with the Ent2/CyO genotype.
    4. Intercross F3 flies (Ent2/CyO) to assess the presence of homozygous mutants. If no homozygous flies are recovered, intercross Ent2/CyO flies for an additional generation to further determine whether the homozygous genotype is lethal.
  2. Drosophila genomic DNA extraction
    1. Collect one or two adult flies into a 1.5 mL EP tube and add 110 µL of Plant DNA Extraction Buffer PA.
    2. Thoroughly homogenize samples using a tissue grinder for at least 3 min.
    3. Incubate the homogenates in a 65 °C metal bath for no less than 30 min.
    4. Add 100 µL of chloroform, gently invert the mixture to mix, and vortex for 10 s. Centrifuge the samples at 14,000 rpm for 10 min at room temperature.
    5. Carefully transfer approximately 65 µL (or more) of the supernatant to a new tube, add two volumes of pre-chilled absolute ethanol (pre-incubated at 4 °C for at least 10 min), gently invert to mix, and incubate at -20 °C for at least 15 min.
    6. Centrifuge samples at 14,000 rpm for 10 min at 4 °C and carefully discard the supernatant.
    7. Air-dry the DNA pellet at room temperature or in an incubator until completely dry, then resuspend in an appropriate volume of PB buffer. For female (f) samples, add 50 µL of PB buffer, whereas for male (m) samples, add 15 µL.
  3. PCR amplification and Sanger sequencing
    1. Perform PCR amplification using specific primers designed to flank the upstream and downstream regions of the gRNA target site.
    2. Purify the PCR products and subject them to Sanger sequencing. Analyze the sequencing chromatograms using SnapGene software34 and align with the wild-type reference sequence for comparative analysis.
    3. Examine the peak plots near the gRNA target site for overlapping peaks indicative of indel mutations. Perform peak splitting to resolve mixed signals and confirm the mutation type, including insertions or deletions at the target site.
    4. Backcross to Bc/CyO males for 4 generations to establish Ent2/CyO.
      Note: It has been observed that Ent2*/Ent2* and CyO/CyO are lethal at early developmental stages; therefore, Ent2*/CyO heterozygotes are maintained.
  4. After establishing the Ent2*/CyO heterozygotes, collect samples from the same batch of Ent2*/CyO heterozygotes under a stereomicroscope.
  5. Randomly select 20 adult flies, and weigh them using a precision balance with a 0.001 g resolution. Photograph the samples to document the phenotypic characteristics.

6. Descriptive phenotypic characterization

  1. Rear 120 males and 120 females (tested three vials for each group, with each vial containing 20 flies) each of Ent2*/CyO and w1118 at 22 °C and 25 °C.
  2. Record the number of deaths weekly and plot the survival curves.
  3. Set up 30 random mating pairs per group; allow 24 h mating;
  4. Transfer adults to fresh tubes; rear offspring.
  5. At 7 days post-eclosion, assess climbing success (≥8 cm within 30 s) with six replicates per group.
  6. All observations were recorded as descriptive characteristics of the mutant line and were not used to infer gene function.

7. Measure antioxidant enzyme activities

  1. Collect 300 male and 300 female adults (tested three vials for each group, with each vial containing 100 flies) Ent2*/CyO and w1118 control flies that at 5 days post‑eclosion to ensure physiological maturity and comparable age.
  2. Transfer flies to empty tubes without food and starve for 2 h to standardize metabolic state prior to biochemical assays.
  3. Add one steel bead/tube; homogenize at 60 Hz, 2 min.
  4. Centrifuge 4 °C, 161 x g, 10 min; collect the supernatant.
  5. Measure total superoxide dismutase (SOD, see Table of Materials for details) and catalase (CAT, see Table of Materials for details) according to the kit instructions.

8. Data statistics and analysis

  1. Express all data as mean ± standard error of the mean (Static equilibrium, ΣFx=0, ΣFy=0, force diagram, illustrating balance of forces on an object.​ ± SEM).
  2. Use one-way ANOVA to compare enzyme activity data; apply three-way ANOVA (factors: genotype, temperature, sex) for body weight, climbing ability, and body length. Perform Tukey’s HSD post hoc test when appropriate35.
  3. Define significance as P < 0.05 for all statistical tests.
  4. Analyze lifespan data using survival curves and perform the log-rank (Mantel-Cox) test, which assesses whether significant differences exist in survival trajectories between experimental cohorts36.
  5. Conduct all analyses and plotting in GraphPad Prism 9.5.0 software following the software guidelines37.
  6. All statistical analyses were performed for descriptive comparison only and not to establish causal relationships.

Results

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Design and effectiveness verification analysis of Ent2 gene targeting sites
Candidate target sites for the Ent2 gene were designed using CHOPCHOP and CCTop platforms (Figure 1). Two gRNAs targeting exon 2 and exon 5 regions were selected based on specificity and efficiency criteria. To verify successful genome editing, genomic DNA from randomly selected individuals of the established Ent2*/CyO line was amplified and subjected to Sanger sequencing. Sequencing chromatograms showed overlapping peaks beginning near the target site, consistent with insertion/deletion (indel) mutations. Further sequence analysis revealed frameshift mutations leading to premature stop codons (Figure 2). These results confirm that the CRISPR/Cas9 system successfully introduced mutations at the targeted Ent2 locus and demonstrate the feasibility of the genome editing workflow.

CRISPR gene sequence diagram with gRNA targeting, CDS, and PAM sites highlighted for editing.
Figure 1. The schematic diagram of the knockout site of the Ent2 gene and the location of the detection primer in the genome. This schematic illustrates the genomic structure of the Ent2 locus, highlighting the CDS (green), start and stop codons (red), gRNA PAM motif (gray), gRNA target sequence (blue), and gRNA amplification primer sequence (yellow) Please click here to view a larger version of this figure.

DNA sequencing chromatogram, base pair analysis, results display, genetic research, sequence data visualization.
Figure 2. The peak plot of sequencing results of Drosophila progeny of stable line self-inbred Ent2*/CyO. Sequencing chromatogram confirming the genotype of progeny obtained from self-crossing the stable Ent2*/CyO heterozygous line. Please click here to view a larger version of this figure.

Descriptive morphological observations of the Ent2/CyO line
We observed body shape differences between the two genotypes of fruit flies across genders under 22 °C and 25 °C conditions using a stereomicroscope (Figure 3). Under both temperature conditions, both male and female fruit flies exhibited a typical "long spindle" body shape. Female abdomens were wide and spindle-shaped, with wing tips slightly extending beyond the abdominal tip. The thorax–abdomen junction in males was clearly defined, and the darkened pigmentation at the end of the abdomen—a distinguishing feature of males—was visible. The wings of w1118 flies of both genders were transparent with clearly defined veins, and no wing edge curvature or vein breakage was observed. In contrast, Ent2*/CyO heterozygotes exhibited noticeable wing base bending and wing edge curvature. At 22 °C, regardless of gender, the body length of fruit flies was significantly greater than that of the same genotype at 25 °C. Additionally, female body length was significantly greater than that of males at the same temperature. Furthermore, at both 22 °C and 25 °C, the body size of Ent2*/CyO heterozygotes was smaller than that of the corresponding w1118 flies. To investigate the morphological basis, we simultaneously measured the body length of the flies (Figure 3E, Table 1). A three-way ANOVA revealed significant main effects of genotype (F(1,16)=230.1, P<0.0001), temperature (F(1,16)=19.50, P=0.0004), and sex (F(1,16)=166.9, P<0.0001). Significant genotype x sex interaction (F(1,16)=14.96, P=0.0014) and a significant genotype x temperature x sex three-way interaction (F(1,16)=6.231, P=0.0239) were also observed.

Drosophila morphology comparison at 22°C and 25°C; bar chart shows body length analysis results.
Figure 3. The control morphology of w1118 and Ent2*/CyO adults. Representative images showing posture characteristics of female (A, C) and male (B, D) Drosophila at 22 °C and 25 °C, along with quantitative comparison of body length (E). ** P < 0.01. Scale bar: 1 mm. Please click here to view a larger version of this figure.

Survival analysis under different temperature conditions
We statistically analyzed the survival curves of Ent2*/CyO heterozygotes and w1118 flies at 22 °C and 25 °C (Figure 4). The results showed that the survival curve of Ent2*/CyO heterozygous females was the highest, with two individuals still alive at the 14th week. All w1118 females died by the 14th week. All Ent2*/CyO heterozygous males died by the 12th week, while all w1118 males died by the 11th week. These findings indicate that at 22 °C, the overall lifespan of females is longer than that of males, and within the same gender, the survival ability of Ent2*/CyO heterozygotes is slightly stronger than that of the w1118 type.

Under 25 °C conditions, the overall survival period was significantly shortened. The survival curves of w1118 females and Ent2*/CyO heterozygous males dropped to zero by the 10th week. The survival curves of Ent2*/CyO heterozygous females and w1118 males declined to 1–2 individuals by the 8th week and reached zero by the 9th week. The difference between the mutant and w1118 was not statistically significant (P > 0.05). These observations describe the survival characteristics of the mutant line under different environmental conditions.

Survival probability graph; Kaplan-Meier plot; Drosophila lifespan comparison; genetic study results.
Figure 4. Survival curves of Drosophila under different temperature conditions. Survival analysis comparing the lifespan of Ent2*/CyO and w1118 flies at 22 °C and 25 °C. n=3. Please click here to view a larger version of this figure.

Locomotor activity assessment
The climbing abilities of w1118 and Ent2*/CyO fruit flies was compared under two temperature conditions: 22 °C and 25 °C (Figure 5, Table 2). The results show that at 22 °C (Figure 5A), 98.15% of w1118 females successfully climbed more than 8 cm within 30 s, whereas this proportion dropped to 89.74% in Ent2*/CyO heterozygous females (P < 0.05). All w1118 males were able to climb more than 8 cm, while the climbing success rate in Ent2*/CyO heterozygous males was 98.14% (P < 0.05). At 25 °C (Figure 5B), all w1118 females (100%) climbed more than 8 cm within 30 s, but this proportion decreased to 91.31% in Ent2*/CyO heterozygous females (P < 0.05). Among w1118 males, 77.28% successfully climbed more than 8 cm (P < 0.01), whereas only 63.57% of Ent2*/CyO heterozygous males achieved this (P < 0.01). To further assess locomotor performance, the proportion of flies climbing beyond 15 cm was analyzed (Figure 5C). A three-way ANOVA revealed highly significant main effects of sex (F(1,16) = 201.7, P < 0.0001) and rearing temperature (F(1,16) = 72.60, P < 0.0001) on climbing performance. However, the main effect of genotype was not significant (F(1,16) = 0.59, P = 0.4545). These results indicate that locomotor performance varies depending on experimental conditions and may differ between groups in a context-dependent manner.

Fly locomotion analysis; bar charts; % traveled distance at 22°C/25°C; genotype comparisons; study.
Figure 5. Comparison of the climbing ability of Drosophila at different temperatures. Quantification of climbing performance at 22 °C (A) and 25 °C (B) and statistics for individuals with climbing distance > 15 cm (C). ** P < 0.01. n=3. Please click here to view a larger version of this figure.

Body weight measurement
Body weight was measured in w1118 and Ent2*/CyO heterozygous fruit flies at 22 °C and 25 °C (Figure 6). Our results show that, compared with w1118 flies, the weight of Ent2*/CyO heterozygotes was significantly reduced at both 22 °C and 25 °C (P < 0.05 or P < 0.01). We observed that the weight of male w1118 flies was significantly lower than that of female w1118 flies (P < 0.01). Similarly, the weight of male Ent2*/CyO heterozygotes was significantly lower than that of female Ent2*/CyO heterozygotes (P < 0.01). We performed a three-way ANOVA to evaluate the independent and interactive effects of genotype, rearing temperature, and sex on body weight in Drosophila. The analysis showed significant main effects of genotype (F(1,16) = 32.38, P < 0.0001), temperature (F(1,16) = 23.31, P = 0.0002), and sex (F(1,16) = 25.52, P = 0.0001) (Figure 6; Table 3). Additionally, there was a significant two-way interaction between temperature and sex (F(1,16) = 24.76, P = 0.0001), indicating that the effect of temperature on body weight differed by sex. However, no significant interactions were found between genotype and temperature (F(1,16) = 0.40, P = 0.538), genotype and sex (F(1,16) = 1.31, P = 0.269), or the three-way interaction (genotype x temperature x sex: F(1,16) = 0.48, P = 0.497), suggesting that the response of Ent2*/CyO mutants to temperature and sex was similar to that of the wild type.

Given the significant temperature × sex interaction, we performed simple effects analysis to clarify its specific pattern. The results showed that, in female flies, individuals reared at 22 °C had significantly higher body weight than those reared at 25 °C (P = 0.0012); however, in males, there was no significant difference in body weight between the two temperatures (P > 0.9999). This indicates that lowering the temperature from 25–22 °C specifically increased body weight in female flies, while having no significant effect on males.

Although there were no significant interactions between genotype and other factors, the strong main effect of genotype indicated that the Ent2*/CyO mutants had generally lower body weight across all conditions compared to wild type. Post-hoc comparisons further revealed that at 22 °C, wild-type females (w1118:22 °C Females) had significantly higher body weight than all mutant groups (P < 0.0001), and within the same temperature, both genotypes showed significant sexual dimorphism (females > males, P < 0.01). At 25 °C, the body weight difference between wild type and mutants showed a similar trend but did not reach statistical significance. These findings describe the body weight characteristics of the mutant line under different environmental and biological conditions.

Fly weight comparison chart at different temperatures; statistical significance shown with asterisks.
Figure 6. The comparison of the body weight in Drosophila at different temperatures. Body weight measurements at 22 °C and 25 °C. ns P > 0.05, * P < 0.05, ** P < 0.01. n=3. Please click here to view a larger version of this figure.

Antioxidant enzyme activity
The antioxidant enzyme activities of w1118 and Ent2*/CyO heterozygous Drosophila were compared at 25 °C (Figure 7). Our results showed that, compared with w1118 flies, both male and female Ent2*/CyO heterozygotes exhibited significantly reduced catalase (CAT) and superoxide dismutase (SOD) activities (P < 0.01). We also found that CAT and SOD activities in w1118 male flies were significantly higher than those in w1118 females (P < 0.05 or P < 0.01). Similarly, antioxidant enzyme activities in Ent2*/CyO heterozygous males were significantly higher than those in Ent2*/CyO heterozygous females (P < 0.01).

Catalase and SOD activity bar graphs; enzyme activity comparison of Drosophila genotypes at 25°C.
Figure 7. The comparison of the antioxidant capacity of Drosophila at optimal feeding temperature. Enzymatic activity assays showing CAT (A) and SOD (B) activity in Ent2/CyO flies compared to w1118 flies. * P < 0.05, ** P < 0.01. n=3. Please click here to view a larger version of this figure.

SSDFMSF (DFn, DFd)P value
Genotype0.802610.8026F (1, 16) = 230.1P<0.0001
Temperature0.0680310.06803F (1, 16) = 19.50P=0.0004
Gender0.582210.5822F (1, 16) = 166.9P<0.0001
Genotype x Temperature0.00579810.005798F (1, 16) = 1.662P=0.2156
Genotype x Gender0.0521810.05218F (1, 16) = 14.96P=0.0014
Temperature x Gender0.0132310.01323F (1, 16) = 3.793P=0.0692
Genotype x Temperature x Gender0.0217310.02173F (1, 16) = 6.231P=0.0239
Residual0.05581160.003488

Table 1: Variance Analysis of Body Length Measurements in Drosophila.

ANOVA tableSSDFMSF (DFn, DFd)P value
Gender0.148310.1483F (1, 16) = 201.7P<0.0001
Genotype0.000431910.0004319F (1, 16) = 0.5877P=0.4545
Temperature0.0533610.05336F (1, 16) = 72.60P<0.0001
Gender x Genotype0.0141810.01418F (1, 16) = 19.30P=0.0005
Gender x Temperature0.00713410.007134F (1, 16) = 9.708P=0.0067
Genotype x Temperature0.013510.0135F (1, 16) = 18.37P=0.0006
Gender x Genotype x Temperature0.00590310.005903F (1, 16) = 8.032P=0.0120
Residual0.01176160.0007349

Table 2: Variance Analysis of Climbing Ability (> 15 cm) in Drosophila.

SSDFMSF (DFn, DFd)P value
Genotype4.363E-0714.363E-07F (1, 16) = 32.38P<0.0001
Temperature3.141E-0713.141E-07F (1, 16) = 23.31P=0.0002
Gender3.439E-0713.439E-07F (1, 16) = 25.52P=0.0001
Genotype x Temperature5.333E-0915.333E-09F (1, 16) = 0.3958P=0.5381
Genotype x Gender1.765E-0811.765E-08F (1, 16) = 1.310P=0.2692
Temperature x Gender3.336E-0713.336E-07F (1, 16) = 24.76P=0.0001
Genotype x Temperature x Gender6.513E-0916.513E-09F (1, 16) = 0.4834P=0.4968
Residual2.156E-07161.347E-08

Table 3: Variance Analysis of Body Weight Measurements in Drosophila.

Discussion

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Ent is an evolutionarily conserved protein that influences multiple biological processes38. When expressed in Xenopus laevis oocytes, Ent2 exhibits nucleoside transport activity8. Studies have demonstrated that the homozygous mutant of Ent2 is lethal during the late larval or early pupal stage10. In the present study, a CRISPR/Cas9-based genome editing workflow was established to generate Ent2-targeted alleles in Drosophila melanogaster. The observed lethality of homozygous mutants during strain establishment is consistent with these prior reports, supporting the validity of the genome editing strategy. Within this framework, the Ent2*/CyO heterozygous line generated in this study provides a model for documenting phenotypic characteristics associated with partial loss of Ent2. Under the experimental conditions tested, differences in body size, body weight, locomotor activity, and antioxidant enzyme levels were observed between Ent2*/CyO and w1118 flies. These observations describe the phenotypic profile of the established mutant line.

In terms of development and body size, Ent2*/CyO heterozygous individuals were significantly smaller than w1118 flies at both 22 °C and 25 °C. This difference may be attributed to reduced nucleoside transport efficiency resulting from the absence of the Ent2 gene, which, in turn, affects the stability of energy metabolism and ecdysone regulation. Moreover, the negative effects became more pronounced at 25 °C. Research has indicated that animal lifespan is influenced by metabolic rate, a concept known as the metabolic rate theory19. The findings of this study suggest that the elevated metabolic rate of fruit flies at higher temperatures may be closely associated with the nutritional deficiencies and developmental delays resulting from impaired nucleoside metabolism. However, given the use of a single CRISPR-derived allele, these findings should be interpreted as descriptive observations rather than direct evidence of gene function.

Temperature-dependent variation was also evident across multiple phenotypic readouts. The mutant exhibits a modest lifespan extension at 22 °C, particularly in females, a finding consistent with previous studies39,40. In contrast, at 25 °C, the lifespan difference diminishes or even disappears. As poikilothermic organisms, fruit flies exhibit a higher metabolic rate and consequently a shorter lifespan at elevated temperatures41,42, which aligns with the findings of this study. In this context, the observed patterns may reflect general physiological responses to temperature.

Locomotor performance and antioxidant enzyme activities also varied between genotypes, sexes, and temperature conditions. Reduced climbing performance and lower SOD and CAT activities were observed in Ent2/CyO flies under certain conditions. Previous studies have linked nucleoside transporters to NAD⁺ metabolism, mitochondrial function, and oxidative stress regulation17,43,44,45,46,47. While these reports provide a possible biological context, the current data are limited to phenotypic characterization and do not establish mechanistic links between Ent2 and these pathways.

Our results also show that under the same conditions, male fruit flies usually exhibit higher antioxidant enzyme activity than female fruit flies39,48. This means that gender-related factors may regulate the antioxidant response through different signaling pathways. Transcription factors related to antioxidant responses, such as Nrf2/CncC and their downstream target genes, show expression differences between different genders, thereby affecting the overall antioxidant capacity49. This observation is consistent with reports of sex differences in oxidative stress resistance and antioxidant defenses in Drosophila, where females typically maintain lower ROS levels and higher baseline antioxidant enzyme activities relative to males, which may contribute to differences in stress resistance and longevity between the sexes50. These observations further highlight the importance of considering biological variables such as sex when characterizing mutant phenotypes.

From a methodological perspective, this study outlines a reproducible workflow for generating and validating CRISPR/Cas9-mediated mutations in Drosophila. Precise design and selection of gRNA is essential, as effective gRNAs determine the efficiency of targeted cleavage by Cas9 and minimize unintended modifications21,51. High‑accuracy microinjection of Cas9 and gRNA components into embryos is also crucial, because inefficient injections can lead to low editing rates or mosaicism52. Thorough genotype confirmation through sequencing ensures that intended edits are present and excludes off‑target or incomplete edits, thereby strengthening model integrity53. Notably, the use of the CyO balancer chromosome was essential for maintaining the Ent2 mutant allele due to the lethality of homozygous mutants. This approach is widely used in Drosophila genetics to preserve deleterious mutations and enable downstream analyses. The present study demonstrates the practical application of this strategy within a CRISPR/Cas9 editing framework.

Several limitations should be acknowledged. First, phenotypic analyses were conducted using a single CRISPR-derived mutant line. It is well recognized that CRISPR/Cas9 editing can generate heterogeneous alleles, and analysis of multiple independent lines is generally recommended to strengthen genetic conclusions. Therefore, the findings reported here should be interpreted as preliminary characterization of one mutant allele. Future studies incorporating additional independently generated Ent2 alleles will be necessary to improve the robustness of the conclusions.. Second, the mutant line was maintained using the CyO balancer chromosome, whereas the control group (w1118) does not carry a balancer chromosome. As balancer chromosomes themselves can influence developmental and physiological traits, the lack of a balancer-matched control represents a potential source of confounding. This limitation should be taken into account when interpreting phenotypic differences between genotypes. Third, environmental conditions such as humidity, light cycle, and diet were maintained under standard laboratory settings but were not systematically varied. As these factors can influence metabolism and stress responses, future studies incorporating controlled environmental gradients would provide a more comprehensive assessment of phenotype-environment interactions.

In summary, this study establishes a CRISPR/Cas9-based workflow for generating and maintaining Ent2 mutant alleles in Drosophila melanogaster and provides a descriptive characterization of the resulting heterozygous line under different environmental conditions. The results highlight the applicability of this approach for studying genes with lethal phenotypes and underscore the importance of experimental design considerations, including genetic background, balancer chromosomes, and environmental variables.

Disclosures

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

All the authors have no conflicts of interest to declare.

Acknowledgements

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Support this research by the Science and Technology Development Program of Jilin Province (Project No. 20230505044ZP).

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
Ammonium acetateSigma A1542
Catalase (CAT) Assay Kit (Visible Light Method) (Ammonium Molybdate Method)Nanjing Jiancheng Bioengineering InstituteA007-1-1
Dodecyl sulfateSigmaL3771
Injection deviceEppendorf FemtoJet 4i
Linearized plasmid: MLM3613Addgene42251
MicroscopeOLYMPUS CKX3-SLP
mMESSAGE mMACHINE T7 kitThermo FisherAM1344
mMESSAGE mMACHINE T7 Transcription KitThermo FisherAM1344
PmeI restriction enzymeNEB R0560S
Poly(A) polymeraseNEBM0276S
Protease KThermo FisherEO0491
RNeasy Mini KitQIAGEN74104
T7 RiboMAX Express Large Scale RNA Production SystemPromega P1320
T7 RiboMAX KitPromega P1320
Total Superoxide Dismutase (T-SOD) assay kit (Hydroxylamine method)Nanjing Jiancheng Bioengineering InstituteA001-1
w1118 Drosophila Fangjing Biology
Water-saturated phenol/chloroformSigmaP2069

References

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,
  1. Introduction: Drosophila-A Model System for Developmental Biology. J Dev Biol. 5 (3), (2017).">Tolwinski, N. S. Introduction: Drosophila-A Model System for Developmental Biology. J Dev Biol. 5 (3), (2017).
  2. Drosophila as a Model Organism to Study Basic Mechanisms of Longevity. Int J Mol Sci. 23 (19), (2022).">Ogienko, A. A., et al. Drosophila as a Model Organism to Study Basic Mechanisms of Longevity. Int J Mol Sci. 23 (19), (2022).
  3. Aging Fly Cell Atlas identifies exhaustive aging features at cellular resolution. Science. 380 (6650), eadg0934(2023).">Lu, T. C., et al. Aging Fly Cell Atlas identifies exhaustive aging features at cellular resolution. Science. 380 (6650), eadg0934(2023).
  4. Metabolism and growth adaptation to environmental conditions in Drosophila. Cell Mol Life Sci. 77 (22), 4523-4551 (2020).">Koyama, T., Texada, M. J., Halberg, K. A., Rewitz, K. Metabolism and growth adaptation to environmental conditions in Drosophila. Cell Mol Life Sci. 77 (22), 4523-4551 (2020).
  5. Drosophila melanogaster: A Powerful Tiny Animal Model for the Study of Metabolic Hepatic Diseases. Frontiers in Physiology. 12, 2021(2021).">Moraes, K. C. M., Montagne, J. Drosophila melanogaster: A Powerful Tiny Animal Model for the Study of Metabolic Hepatic Diseases. Frontiers in Physiology. 12, 2021(2021).
  6. What fuels the fly: Energy metabolism in Drosophila and its application to the study of obesity and diabetes. Sci Adv. 7 (24), (2021).">Chatterjee, N., Perrimon, N. What fuels the fly: Energy metabolism in Drosophila and its application to the study of obesity and diabetes. Sci Adv. 7 (24), (2021).
  7. Delineating Purinergic Signaling in Drosophila. International Journal of Molecular Sciences. 23 (23), 15196(2022).">Volonté, C., Alberti, F., Vitale, G., Liguori, F. Delineating Purinergic Signaling in Drosophila. International Journal of Molecular Sciences. 23 (23), 15196(2022).
  8. Genomic analysis of nucleoside transporters in Diptera and functional characterization of DmENT2, a Drosophila equilibrative nucleoside transporter. Physiol Genomics. 28 (3), 337-347 (2007).">Machado, J., Abdulla, P., Hanna, W. J., Hilliker, A. J., Coe, I. R. Genomic analysis of nucleoside transporters in Diptera and functional characterization of DmENT2, a Drosophila equilibrative nucleoside transporter. Physiol Genomics. 28 (3), 337-347 (2007).
  9. Residue Ile89 in human plasma membrane monoamine transporter influences its organic cation transport activity and sensitivity to inhibition by dilazep. Biochem Pharmacol. 84 (3), 383-390 (2012).">Ho, H. T., Xia, L., Wang, J. Residue Ile89 in human plasma membrane monoamine transporter influences its organic cation transport activity and sensitivity to inhibition by dilazep. Biochem Pharmacol. 84 (3), 383-390 (2012).
  10. Equilibrative nucleoside transporter 2 regulates associative learning and synaptic function in Drosophila. J Neurosci. 30 (14), 5047-5057 (2010).">Knight, D., et al. Equilibrative nucleoside transporter 2 regulates associative learning and synaptic function in Drosophila. J Neurosci. 30 (14), 5047-5057 (2010).
  11. Mutation in the Drosophila melanogaster adenosine receptor gene selectively decreases the mosaic hyperplastic epithelial outgrowth rates in wts or dco heterozygous flies. Purinergic Signal. 11 (1), 95-105 (2015).">Sidorov, R., Kucerova, L., Kiss, I., Zurovec, M. Mutation in the Drosophila melanogaster adenosine receptor gene selectively decreases the mosaic hyperplastic epithelial outgrowth rates in wts or dco heterozygous flies. Purinergic Signal. 11 (1), 95-105 (2015).
  12. Equilibrative Nucleoside Transporter 2: Properties and Physiological Roles. Biomed Res Int. 2020, 5197626(2020).">Naes, S. M., Ab-Rahim, S., Mazlan, M., Abdul Rahman, A. Equilibrative Nucleoside Transporter 2: Properties and Physiological Roles. Biomed Res Int. 2020, 5197626(2020).
  13. Equilibrative nucleoside transporters-A review. Nucleosides Nucleotides Nucleic Acids. 36 (1), 7-30 (2017).">Boswell-Casteel, R. C., Hays, F. A. Equilibrative nucleoside transporters-A review. Nucleosides Nucleotides Nucleic Acids. 36 (1), 7-30 (2017).
  14. Deletion of equilibrative nucleoside transporter-2 protects against lipopolysaccharide-induced neuroinflammation and blood-brain barrier dysfunction in mice. Brain Behav Immun. 84, 59-71 (2020).">Wu, K. C., Lee, C. Y., Chou, F. Y., Chern, Y., Lin, C. J. Deletion of equilibrative nucleoside transporter-2 protects against lipopolysaccharide-induced neuroinflammation and blood-brain barrier dysfunction in mice. Brain Behav Immun. 84, 59-71 (2020).
  15. ENT2 facilitates brain endothelial cell penetration and blood-brain barrier transport by a tumor-targeting anti-DNA autoantibody. JCI Insight. 6 (14), (2021).">Rattray, Z., et al. ENT2 facilitates brain endothelial cell penetration and blood-brain barrier transport by a tumor-targeting anti-DNA autoantibody. JCI Insight. 6 (14), (2021).
  16. The Critical Role of Equilibrative Nucleoside Transporter-2 in Modulating Cerebral Damage and Vascular Dysfunction in Mice with Brain Ischemia-Reperfusion. Pharm Res. 40 (11), 2541-2554 (2023).">Chiang, H. L., et al. The Critical Role of Equilibrative Nucleoside Transporter-2 in Modulating Cerebral Damage and Vascular Dysfunction in Mice with Brain Ischemia-Reperfusion. Pharm Res. 40 (11), 2541-2554 (2023).
  17. SLC29A1 and SLC29A2 are human nicotinamide cell membrane transporters. Nat Commun. 16 (1), 1181(2025).">Chen, M., et al. SLC29A1 and SLC29A2 are human nicotinamide cell membrane transporters. Nat Commun. 16 (1), 1181(2025).
  18. Extracellular adenosine mediates a systemic metabolic switch during immune response. PLoS Biol. 13 (4), e1002135(2015).">Bajgar, A., et al. Extracellular adenosine mediates a systemic metabolic switch during immune response. PLoS Biol. 13 (4), e1002135(2015).
  19. Effects of Temperature on Lifespan of Drosophila melanogaster from Different Genetic Backgrounds: Links between Metabolic Rate and Longevity. Insects. 11 (8), (2020).">Mołoń, M., et al. Effects of Temperature on Lifespan of Drosophila melanogaster from Different Genetic Backgrounds: Links between Metabolic Rate and Longevity. Insects. 11 (8), (2020).
  20. Temperature-Related Reaction Norms of Gene Expression: Regulatory Architecture and Functional Implications. Mol Biol Evol. 32 (9), 2393-2402 (2015).">Chen, J., Nolte, V., Schlötterer, C. Temperature-Related Reaction Norms of Gene Expression: Regulatory Architecture and Functional Implications. Mol Biol Evol. 32 (9), 2393-2402 (2015).
  21. CRISPR-Cas9 Genome Editing in Drosophila. Curr Protoc Mol Biol. 111, 31.32.31-31.32.20 (2015).">Gratz, S. J., Rubinstein, C. D., Harrison, M. M., Wildonger, J., O'Connor-Giles, K. M. CRISPR-Cas9 Genome Editing in Drosophila. Curr Protoc Mol Biol. 111, 31.32.31-31.32.20 (2015).
  22. CRISPR/Cas9 mediated genome engineering in Drosophila. Methods. 69 (2), 128-136 (2014).">Bassett, A., Liu, J. L. CRISPR/Cas9 mediated genome engineering in Drosophila. Methods. 69 (2), 128-136 (2014).
  23. Systematic Evaluation of Drosophila CRISPR Tools Reveals Safe and Robust Alternatives to Autonomous Gene Drives in Basic Research. G3 Genes|Genomes|Genetics. 5 (7), 1493-1502 (2015).">Port, F., Muschalik, N., Bullock, S. L. Systematic Evaluation of Drosophila CRISPR Tools Reveals Safe and Robust Alternatives to Autonomous Gene Drives in Basic Research. G3 Genes|Genomes|Genetics. 5 (7), 1493-1502 (2015).
  24. Expanding the CRISPR base editing toolbox in Drosophila melanogaster. Communications Biology. 7 (1), 1126(2024).">Clark, M., et al. Expanding the CRISPR base editing toolbox in Drosophila melanogaster. Communications Biology. 7 (1), 1126(2024).
  25. Chemical mutagens, transposons, and transgenes to interrogate gene function in Drosophila melanogaster. Methods. 68 (1), 15-28 (2014).">Venken, K. J., Bellen, H. J. Chemical mutagens, transposons, and transgenes to interrogate gene function in Drosophila melanogaster. Methods. 68 (1), 15-28 (2014).
  26. Drosophila: Methods and Protocols. Dahmann, C. , Springer US. 157-176 (2022).">Port, F., Boutros, M. Drosophila: Methods and Protocols. Dahmann, C. , Springer US. 157-176 (2022).
  27. CRISPR-Cas9-mediated homology-directed repair for precise gene editing. Mol Ther Nucleic Acids. 35 (4), 102344(2024).">Liao, H., Wu, J., VanDusen, N. J., Li, Y., Zheng, Y. CRISPR-Cas9-mediated homology-directed repair for precise gene editing. Mol Ther Nucleic Acids. 35 (4), 102344(2024).
  28. CRISPR/Cas9 as a Mutagenic Factor. International Journal of Molecular Sciences. 25, 823(2024).">Shumega, A. R., et al. CRISPR/Cas9 as a Mutagenic Factor. International Journal of Molecular Sciences. 25, 823(2024).
  29. The joy of balancers. PLoS Genet. 15 (11), e1008421(2019).">Miller, D. E., Cook, K. R., Hawley, R. S. The joy of balancers. PLoS Genet. 15 (11), e1008421(2019).
  30. Creation of a new Drosophila melanogaster X chromosome balancer, First Multiple 8 ( FM8 ), using the CRISPR/Cas9 gene-editing system. MicroPubl Biol. 2022, (2022).">Muron, S., Kucera, S., Oliver, B., Benner, L. Creation of a new Drosophila melanogaster X chromosome balancer, First Multiple 8 ( FM8 ), using the CRISPR/Cas9 gene-editing system. MicroPubl Biol. 2022, (2022).
  31. CHOPCHOP v3: expanding the CRISPR web toolbox beyond genome editing. Nucleic Acids Res. 47 (W1), W171-W174 (2019).">Labun, K., et al. CHOPCHOP v3: expanding the CRISPR web toolbox beyond genome editing. Nucleic Acids Res. 47 (W1), W171-W174 (2019).
  32. CCTop: An Intuitive, Flexible and Reliable CRISPR/Cas9 Target Prediction Tool. PLoS One. 10 (4), e0124633(2015).">Stemmer, M., Thumberger, T., Del Sol Keyer, M., Wittbrodt, J., Mateo, J. L. CCTop: An Intuitive, Flexible and Reliable CRISPR/Cas9 Target Prediction Tool. PLoS One. 10 (4), e0124633(2015).
  33. Highly efficient targeted mutagenesis of Drosophila with the CRISPR/Cas9 system. Cell Rep. 4 (1), 220-228 (2013).">Bassett, A. R., Tibbit, C., Ponting, C. P., Liu, J. L. Highly efficient targeted mutagenesis of Drosophila with the CRISPR/Cas9 system. Cell Rep. 4 (1), 220-228 (2013).
  34. Clinical characteristics and genotypes of patients with Congenital fibrinogen disorders. Zhonghua Yi Xue Yi Chuan Xue Za Zhi. 42 (3), 264-273 (2025).">Wang, H., Zheng, S., Yu, X., Wu, K., Zhao, M. Clinical characteristics and genotypes of patients with Congenital fibrinogen disorders. Zhonghua Yi Xue Yi Chuan Xue Za Zhi. 42 (3), 264-273 (2025).
  35. The Impact of Various Surface Treatments on Adhesion Between Co-Cr Alloy and Acrylic Teeth. Int J Dent. 2026, 2199689(2026).">Chotcomwongse, P., et al. The Impact of Various Surface Treatments on Adhesion Between Co-Cr Alloy and Acrylic Teeth. Int J Dent. 2026, 2199689(2026).
  36. In the artificial intelligence age, is Oswestry spinal risk index still useful? an external validation of Oswestry spinal risk index applied to radiotherapy patients and its relevance. Br J Neurosurg. , 1-9 (2026).">Prakash, S., Havard, M., Hodges, E., Agrawal, A., Ahuja, S. In the artificial intelligence age, is Oswestry spinal risk index still useful? an external validation of Oswestry spinal risk index applied to radiotherapy patients and its relevance. Br J Neurosurg. , 1-9 (2026).
  37. Analysis of Inflammatory and Angiogenic Activities in Patients with Abdominal Aortic Aneurysms with the Radiotracers (99m)Tc-HYNIC-CCR2-L and (99m)Tc-RGD with Single-Photon Emission Computed Tomography. Ann Vasc Surg. 124, 312-317 (2026).">Anaya-Ayala, J. E., et al. Analysis of Inflammatory and Angiogenic Activities in Patients with Abdominal Aortic Aneurysms with the Radiotracers (99m)Tc-HYNIC-CCR2-L and (99m)Tc-RGD with Single-Photon Emission Computed Tomography. Ann Vasc Surg. 124, 312-317 (2026).
  38. Physiology of nucleoside transporters: back to the future. Physiology (Bethesda). 23, 41-48 (2008).">Rose, J. B., Coe, I. R. Physiology of nucleoside transporters: back to the future. Physiology (Bethesda). 23, 41-48 (2008).
  39. Sex differences in oxidative stress resistance in relation to longevity in Drosophila melanogaster. Journal of Comparative Physiology B. 187 (7), 899-909 (2017).">Niveditha, S., Deepashree, S., Ramesh, S. R., Shivanandappa, T. Sex differences in oxidative stress resistance in relation to longevity in Drosophila melanogaster. Journal of Comparative Physiology B. 187 (7), 899-909 (2017).
  40. The 4E-BP growth pathway regulates the effect of ambient temperature on Drosophila metabolism and lifespan. Proc Natl Acad Sci U S A. 114 (36), 9737-9742 (2017).">Carvalho, G. B., et al. The 4E-BP growth pathway regulates the effect of ambient temperature on Drosophila metabolism and lifespan. Proc Natl Acad Sci U S A. 114 (36), 9737-9742 (2017).
  41. Genotype and sex affect the combined impact of temperature and low-dose insecticide exposure on insect survival. Insect Sci. , (2024).">Martelli, F., Alves, A. N., Yang, Y. T., Batterham, P., Wedell, N. Genotype and sex affect the combined impact of temperature and low-dose insecticide exposure on insect survival. Insect Sci. , (2024).
  42. Daily temperature cycles prolong lifespan and have sex-specific effects on peripheral clock gene expression in Drosophila melanogaster. J Exp Biol. 224 (10), (2021).">Goh, G. H., Blache, D., Mark, P. J., Kennington, W. J., Maloney, S. K. Daily temperature cycles prolong lifespan and have sex-specific effects on peripheral clock gene expression in Drosophila melanogaster. J Exp Biol. 224 (10), (2021).
  43. Hypoxanthine uptake and release by equilibrative nucleoside transporter 2 (ENT2) of rat microvascular endothelial cells. Microvasc Res. 75 (3), 351-357 (2008).">Robillard, K. R., Bone, D. B. J., Hammond, J. R. Hypoxanthine uptake and release by equilibrative nucleoside transporter 2 (ENT2) of rat microvascular endothelial cells. Microvasc Res. 75 (3), 351-357 (2008).
  44. Equilibrative Nucleoside Transporters Mediate the Import of Nicotinamide Riboside and Nicotinic Acid Riboside into Human Cells. Int J Mol Sci. 22 (3), (2021).">Kropotov, A., et al. Equilibrative Nucleoside Transporters Mediate the Import of Nicotinamide Riboside and Nicotinic Acid Riboside into Human Cells. Int J Mol Sci. 22 (3), (2021).
  45. De novo NAD(+) synthesis enhances mitochondrial function and improves health. Nature. 563 (7731), 354-359 (2018).">Katsyuba, E., et al. De novo NAD(+) synthesis enhances mitochondrial function and improves health. Nature. 563 (7731), 354-359 (2018).
  46. Deregulation of mitochondrial reverse electron transport alters the metabolism of reactive oxygen species and NAD+/NADH and presents a therapeutic target in Alzheimer's disease. Ageing Neur Dis. 4 (1), 4(2024).">Suman, R., et al. Deregulation of mitochondrial reverse electron transport alters the metabolism of reactive oxygen species and NAD+/NADH and presents a therapeutic target in Alzheimer's disease. Ageing Neur Dis. 4 (1), 4(2024).
  47. Mitochondrial Dysfunction and Metabolic Disturbances Induced by Viral Infections. Cells. 13 (21), (2024).">Pérez, S. E., Gooz, M., Maldonado, E. N. Mitochondrial Dysfunction and Metabolic Disturbances Induced by Viral Infections. Cells. 13 (21), (2024).
  48. Sex differences in survival and mitochondrial bioenergetics during aging in Drosophila. Aging Cell. 6 (5), 699-708 (2007).">Ballard, J. W., Melvin, R. G., Miller, J. T., Katewa, S. D. Sex differences in survival and mitochondrial bioenergetics during aging in Drosophila. Aging Cell. 6 (5), 699-708 (2007).
  49. Drosophila as an emerging model organism for studies of food-derived antioxidants. Food Res Int. 143, 110307(2021).">Yi, Y., Xu, W., Fan, Y., Wang, H. X. Drosophila as an emerging model organism for studies of food-derived antioxidants. Food Res Int. 143, 110307(2021).
  50. Sex differences in antioxidant defence and the regulation of redox homeostasis in physiology and pathology. Mechanisms of Ageing and Development. 211, 111802(2023).">Tiberi, J., et al. Sex differences in antioxidant defence and the regulation of redox homeostasis in physiology and pathology. Mechanisms of Ageing and Development. 211, 111802(2023).
  51. Genome engineering of Drosophila with the CRISPR RNA-guided Cas9 nuclease. Genetics. 194 (4), 1029-1035 (2013).">Gratz, S. J., et al. Genome engineering of Drosophila with the CRISPR RNA-guided Cas9 nuclease. Genetics. 194 (4), 1029-1035 (2013).
  52. Protocol for genetic engineering in Drosophila suzukii using microinjection. STAR Protocols. 5 (3), 103248(2024).">Yan, Y., Schetelig, M. F. Protocol for genetic engineering in Drosophila suzukii using microinjection. STAR Protocols. 5 (3), 103248(2024).
  53. Seamless knockins in Drosophila via CRISPR-triggered single-strand annealing. Developmental Cell. 59 (19), 2672-2686.e5 (2024).">Aguilar, G., et al. Seamless knockins in Drosophila via CRISPR-triggered single-strand annealing. Developmental Cell. 59 (19), 2672-2686.e5 (2024).

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Tags

Geneticsoxidative stress

Related Articles