CRISPR/Cas9-Mediated Generation and Characterization of an Ent2*/CyO Drosophila melanogaster Strain

Summary

Equilibrative nucleoside transporter 2 (ENT2) is a conserved transmembrane protein involved in nucleoside transport and cellular metabolism. In this study, a CRISPR/Cas9-based genome editing workflow was established to generate an Ent2-targeted allele in Drosophila melanogaster. A stable Ent2*/ CyO heterozygous line was constructed and maintained using a balancer chromosome strategy. This work describes the design, generation, and molecular validation of the mutant line, as well as its phenotypic characterization under different temperature conditions. The established workflow and mutant strain provide a practical framework for studying genes with homozygous lethal phenotypes and for investigating temperature-associated phenotypic variation in Drosophila.

Abstract

In this study, a CRISPR/Cas9-based genome-editing approach was used to introduce mutations in the equilibrative nucleoside transporter 2 (Ent2) gene in Drosophila melanogaster. Guide RNAs targeting the coding region of Ent2 were designed and co-injected with Cas9 mRNA into w¹¹¹⁸ embryos. Mutant alleles were identified by Sanger sequencing and maintained as a stable Ent2*/CyO heterozygous line using a balancer chromosome. Subsequently, we evaluated body weight, climbing ability, survival rate, and the activities of superoxide dismutase (SOD) and catalase (CAT) in fruit flies at 22 °C and 25 °C, respectively. The results indicate that at both 22 °C and 25 °C, the body length and weight of Ent2*/CyO fruit flies were significantly reduced compared to the w¹¹¹⁸, and their development was delayed. At 22 °C, the overall lifespan of Ent2*/CyO flies was slightly longer than that of the w¹¹¹⁸, whereas at 25 °C, no significant difference was observed. Regarding locomotor ability, the climbing performance of heterozygous flies was significantly lower than that of the w¹¹¹⁸ at both temperatures, with males being more severely affected. In addition, the antioxidant enzyme activities of CAT and SOD in Ent2*/CyO fruit flies were significantly reduced, indicating a clear impairment of antioxidant capacity. These results describe the phenotypic profile of a CRISPR-generated Ent2 mutant line and demonstrate the feasibility of combining genome editing with balancer chromosome strategies in Drosophila. This study provides a methodological framework and a genetic resource for future investigations of genes associated with metabolism and environmental responses.

Introduction

Drosophila melanogaster remains one of the most widely used model organisms for genetics and developmental biology¹. It is characterized by a short life cycle, rapid reproduction, established genetic manipulation tools, and a fully annotated genome^2,3. This species is extensively applied in studies of gene function, metabolic regulation, and environmental adaptability^4,5. Nucleosides and their derivatives such as ATP are central to cellular energy generation, nucleic acid synthesis, and signal transduction in Drosophila, reflecting conserved metabolic regulation across metazoans⁶. Purinergic signaling pathways in Drosophila, which depend on extracellular adenosine and nucleoside transport mechanisms, highlight the functional role of nucleoside movement across membranes in coordinating energy and signal transduction responses⁷. Among these processes, the transport of nucleosides across the cytoplasmic membrane is primarily mediated by the equilibrative nucleoside transporter (ENT) family, with DmENT2 exhibiting functional transport activity in Drosophila⁸.

The ENT family comprises multiple subtypes, among which ENT2 is a extensively studied transmembrane nucleoside transporter⁹. It facilitates the energy-independent transmembrane transport of various purine and pyrimidine nucleosides^10,11. In mammals, ENT2 is a ubiquitously expressed bidirectional transporter that facilitates the cellular uptake of purine and pyrimidine nucleosides and nucleobases. This transport activity contributes to nucleotide salvage and helps maintain cellular metabolic homeostasis¹². ENT2 also mediates the transport of a variety of nucleoside‑derived drugs, extending its functional relevance beyond endogenous nucleoside movement, highlighting its broader physiological and clinical importance¹³. Moreover, ENT2 has been implicated in neurological disorders¹⁴, tumor metabolism¹⁵, vascular dysfunction¹⁶, and cellular energy metabolism in humans¹⁷. However, studies addressing the organism-level roles of Ent2 in Drosophila remain limited.

The roles of ENT2 in growth and development, energy metabolism, locomotor performance, and antioxidant capacity under varying temperature conditions have not been fully explored¹⁸. Temperature strongly affects basal metabolic rate and lifespan in Drosophila, with higher rearing temperatures generally increasing metabolic activity and reducing longevity¹⁹. These temperature‑dependent changes in gene expression can influence physiological pathways and thus may modify the phenotypic effects of specific gene mutations²⁰.

Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR-associated protein 9 (CRISPR/Cas9) has been widely applied in Drosophila for various genomic modification operations such as site-specific knockout, deletion, replacement, and tag introduction, demonstrating its efficiency and reliability^21,22,23. The latest progress indicates that CRISPR-derived base editors can also be used for finer site-specific base modifications in Drosophila, providing a new tool for point mutations and precise phenotypic control²⁴. Traditional mutagenesis methods, including chemical and radiation mutagenesis as well as transposon‑mediated screens, can generate genetic mutations²⁵. These approaches are often limited by low efficiency and high randomness in the mutation events. As a result, researchers must screen large numbers of individuals to isolate specific alleles of interest²⁶. CRISPR/Cas9 enables programmed guide RNA (gRNA)‑directed cleavage at specified DNA sequences. The resulting double-strand breaks are repaired through non‑homologous end joining or homology‑directed repair, generating defined, heritable mutations and significantly reducing background mutations that could confound phenotypic analysis^27,28. Mutant alleles generated via CRISPR/Cas9 can be maintained in a heterozygous state by linkage with balancer chromosomes, such as Curly O (CyO)²⁹. This strategy has been shown to effectively prevent the loss of lethal alleles in homozygous form in Drosophila genetics. As a result, it supports long-term and systematic phenotypic assessment, including functional studies under varying temperatures or environmental conditions^29,30. The simple design and high efficiency of CRISPR/Cas9 have significantly shortened the cycle of strain construction and enhanced the stability of the genetic background. This is particularly important for studying long-term environmental factors such as temperature response and developmental homeostasis.

Building on this foundation, the Ent2 gene in Drosophila melanogaster was knocked out using the CRISPR/Cas9 system, and a stably inherited Ent2*/CyO heterozygous mutant strain was established. The developmental cycle, body weight, locomotor ability, and activities of the antioxidant enzymes SOD and CAT were systematically assessed. By comparing multidimensional phenotypes of w¹¹¹⁸ and mutant flies under varying temperature conditions, this study aims to present a reproducible strategy for generating and maintaining CRISPR-derived mutant lines and provides a descriptive characterization of the resulting phenotypes. This work offers a methodological framework and a useful genetic resource for future studies investigating genes involved in metabolism and environmental responses.

Protocol

1. Design of CRISPR/Cas9 targets for the Ent2 gene

1. Select candidate CRISPR sites in exons 2 and 5 of Ent2 (FlyBase ID: FBgn0263916) using CHOPCHOP (v3)³¹ and the CCTop (v1.0)³².
2. The reference genome was defined as Drosophila melanogaster Release 6 (dm6) (RefSeq assembly accession: GCF_000001215.4). Then, candidate gRNA sites were identified. Finally, the identified sites were filtered to obtain the optimal gRNAs.
3. Filter targets by MIT Specificity Score ≥ 80 (CHOPCHOP), CFD score ≤ 0.1 (CCTop), GC content 40%–60%, and minimal PAM distance.
4. Rank targets with a weighted score (efficiency 50%, specificity 30%, GC optimization 20%) and choose two gRNAs.
5. Add one “G” to the 5′ end of each gRNA to satisfy the T7 promoter requirement. Use the following gRNA-specific forward oligonucleotides to generate the full-length sgRNA transcription template by PCR:
   Ent2-sg1-F: TAATACGACTCACTAT
   AGGTGACGTTAAATCCATCGTGTTTTAGAGCTAGAAATAGC
   Ent2-sg2-F: TAATACGACTCAC
   TATATTGCCGTTGGAATCATGGGGGTTTTAGAGCTAGAAATAGC
6. The remaining sgRNA scaffold sequence is provided by the universal reverse oligonucleotide during PCR.

2. Preparation of sgRNA transcription templates

1. Preparation of sgRNA transcription templates
   1. Assemble a 60 µL PCR reaction mixture using the double-oligonucleotide annealing–PCR method³³ per the manufacturer’s instructions. Combine the gRNA-specific forward oligonucleotide (Ent2-sg1-F or Ent2-sg2-F) with a universal reverse oligonucleotide encoding the sgRNA scaffold to obtain the full-length dsDNA template for in vitro transcription.
   2. Program the thermocycler: 95 °C 3 min; 35 cycles of 95 °C 30 s, 55 °C 30 s, 72 °C 20 s; then 72 °C 10 min; hold at 12 °C.
2. Purify the transcription template
   1. Add 100 µL ammonium acetate (see Table of Materials) to 60 µL PCR product; mix. Add 400 µL anhydrous ethanol; invert to mix and incubate at -20 °C for 20 min.
   2. Centrifuge at 4 °C, 20,000 x g for 15 min; discard supernatant.
   3. Air-dry the pellet with the tube open for 10 min. Resuspend the pellet in 10 µL of nuclease-free ddH₂O.
3. In Vitro Transcription of gRNA
   1. Set up a 10 µL T7 in vitro transcription reaction following the kit instructions (see Table of Materials).
   2. Incubate at 37 °C for 35 min. Add 0.5 µL DNase I (provided in the transcription kit) and incubate at 37 °C for 15 min.
4. Purify gRNA
   1. Dilute the transcription mixture to 60 µL with nuclease-free ddH₂O. Add 60 µL water-saturated phenol/chloroform (see Table of Materials ); vortex briefly and centrifuge at 4 °C, 16,000 x g for 5 min.
   2. Transfer 45 µL of the aqueous phase to a new 1.5 mL RNase-free tube. Add 5 µL sodium acetate; mix.
   3. Add 125 µL pre-chilled anhydrous ethanol; mix and incubate at -20 °C for 20–30 min. Centrifuge at 4 °C, 20,000 x g for 15 min; discard supernatant.
   4. Wash the pellet with 200 µL of 70% ethanol (RNase-free); centrifuge at 4 °C, 20,000 x g for 5 min; remove supernatant.
   5. Dry the pellet at 37 °C until ethanol evaporates completely. Resuspend in 20 µL ddH₂O; aliquot and store at -80 °C.
   6. Measure the gRNA concentration using a NanoDrop spectrophotometer and adjust the concentration to 250 ng/µL for injection. Ensure the purity of the gRNA with an A260/A280 ratio of approximately 2.0.
      ​NOTE: We emphasize that gloves must be worn throughout the entire process for RNase protection. All consumables, including pre-cooled RNase-free centrifuge tubes and pipette tips, must be used consistently during the procedure. Organic reagent waste generated during the operation must be collected separately in designated waste containers according to type and regularly transported to a certified hazardous waste disposal facility for proper handling.

3. Preparation of Cas9 mRNA

1. Preparation of the Transcription Template
   NOTE: Use RNase-free tips and tubes throughout RNA-related steps.
   1. Thaw the Cas9 expression plasmid MLM3613 (see Table of Materials) on ice. In an RNase-free tube, combine 20 µg plasmid DNA, 7.5 µL 10x restriction buffer, 1 µL PmeI (10,000 U/mL), and nuclease-free ddH₂O to 75 µL.
   2. Incubate at 37 °C for 30 min. Verify complete linearization by loading 5 µL onto a 1% agarose gel at 120 V for 30 min.
2. Purification of Transcription Templates
   1. Add 23 µL 2% sodium dodecyl sulfate (SDS, see Table of Materials for details) and 0.5 µL proteinase K (see Table of Materials for details) to 70 µL of the digest; incubate at 50 °C for 30 min.
   2. Add 45 µL chloroform and 45 µL Tris-saturated phenol; vortex briefly; centrifuge 13,800 x g, 5 min.
   3. Transfer 90 µL aqueous phase to a new tube. Add 10 µL sodium acetate (provided by the kit) and 200 µL pre-cooled anhydrous ethanol; mix; incubate −20 °C, 30 min.
   4. Centrifuge 20,000 x g, 4 °C, 15 min; discard supernatant. Wash the pellet twice with 100 µL 70% ethanol; centrifuge 20,000 x g, 2 min each; air-dry.
   5. Dissolve DNA in 20 µL nuclease-free ddH₂O; confirm >500 ng/µL.
3. In vitro transcription with co-capping
   1. Set up the reaction using a T7 in vitro transcription kit with capping (see Table of Materials) according to the manufacturer’s instructions.
   2. Incubate at 37 °C for 2 h to generate capped Cas9 mRNA.
   3. After the transcription reaction is complete, add 1 µL of DNase (provided in the kit, concentration 2 U/µL), mix thoroughly, and incubate at 37°C for 15 min to degrade the DNA template.
4. Add a poly(A) tail
   1. Bring the RNA to 14 µL ddH₂O.
   2. Add 2 µL 10x E. coli Poly(A) Polymerase buffer, 2 µL ATP (10 mM), 1 µL RNase inhibitor, and 1 µL Poly(A) polymerase.
   3. Incubate at 37 °C for 45 min.
5. Purify the mRNA
   1. Apply the reaction to a spin-column total RNA kit (see Table of Materials). Load the sample onto a 2 mL silica membrane spin column; centrifuge 8,000 x g, 15 s; discard flow-through.
   2. Add 500 µL of RPE buffer to the RNeasy column, centrifuge at 8000 x g for 15 s, and discard the residual liquid. Repeat this step once, then centrifuge for 2 min and discard the residual liquid.
   3. Place the RNeasy column in a new 1.5 mL centrifuge tube. Add 30 µL of RNase-free ddH₂O, centrifuge at 8000 x g for 1 minute to elute the RNA. Adjust the mRNA concentration to 500 ng/µL for injection. Store the eluted RNA at -80 ℃.

4. Microinjection of Drosophila Embryos

1. Preparation of Injection Samples
   1. Mix 15 µg Cas9 mRNA with 7.5 µg double-stranded gRNA at a volume ratio of 2:1.
   2. Adjust to 30 µL with DEPC-treated RNase-free water; keep on ice.
2. Drosophila rearing
   1. Transfer the injected Drosophila strain w¹¹¹⁸ to large food tubes for amplification. w¹¹¹⁸ flies were used as the reference control to represent the baseline physiological state without balancer-associated effects.
   2. Maintain the flies in an artificial climate chamber set at 25 °C with a humidity of 60%–70% and a 12:12 light-dark cycle for 14 days.
   3. At 17:00 on the day following the 14-day rearing period (Day 15), collect adult flies to synchronize timed embryo laying. This specific collection time ensures that embryos used for injection are at a consistent developmental stage. Controlling the time of day is important for minimizing circadian rhythm effects on embryo development and reproductive behavior, thereby ensuring experimental reproducibility and reducing physiological variability between batches.
3. Microinjection of Drosophila
   1. Collect adult flies for injection into fly cages, with approximately 400 adults per cage. Collect embryos on yeast-coated agar plates; collect embryos within 60 min of egg laying and rinse them onto coverslips. No dechorionation was performed prior to injection.
   2. Align the embryos on coverslips with their posterior poles facing outward, arranged in an orderly manner from top to bottom. Ensure that the injection needle penetrates the posterior pole to an appropriate depth (approximately one-fifth of the embryo length) for consistent cytoplasmic delivery. A total of 300 embryos were used in this study.
   3. Under a stereomicroscope, focus the needle tip and embryo in the same plane.
   4. Using the injection instrument, pierce the posterior pole and inject 0.001 µL of the mix into each embryo.
   5. Transfer injected embryos to food vials; incubate at 25 °C, ~70% relative humidity (RH) to obtain P₀ generation (the injected adults that survive to produce progeny).

5. Construction of stable expression strains in Drosophila

1. Cross eclosed P₀ with Bc/CyO flies.
   1. Microinject a mixture of gRNA targeting the gene of interest and Cas9 protein into 300 embryos of the w1118 Drosophila strain. After injection, obtain a total of 30 viable and fertile P0 adults. Cross each P0 adult (mosaic) individually with flies from the w1118 strain, yielding 16 single-pair crosses (8 vials with P0 males crossed to virgin females and 8 vials with P0 females crossed to males). Maintain all crosses at 25 °C under constant culture conditions.
   2. After the appearance of F1 larvae, remove the P0 parental flies. Extract genomic DNA from the F1 progeny and subject it to PCR analysis to determine the F1 adult genotypes (Ent2/+).
   3. Generate F2 progeny by single crosses between Bc/CyO flies. Select individual F2 adults and genotype them to identify flies with the Ent2/CyO genotype.
   4. Intercross F3 flies (Ent2/CyO) to assess the presence of homozygous mutants. If no homozygous flies are recovered, intercross Ent2/CyO flies for an additional generation to further determine whether the homozygous genotype is lethal.
2. Drosophila genomic DNA extraction
   1. Collect one or two adult flies into a 1.5 mL EP tube and add 110 µL of Plant DNA Extraction Buffer PA.
   2. Thoroughly homogenize samples using a tissue grinder for at least 3 min.
   3. Incubate the homogenates in a 65 °C metal bath for no less than 30 min.
   4. Add 100 µL of chloroform, gently invert the mixture to mix, and vortex for 10 s. Centrifuge the samples at 14,000 rpm for 10 min at room temperature.
   5. Carefully transfer approximately 65 µL (or more) of the supernatant to a new tube, add two volumes of pre-chilled absolute ethanol (pre-incubated at 4 °C for at least 10 min), gently invert to mix, and incubate at -20 °C for at least 15 min.
   6. Centrifuge samples at 14,000 rpm for 10 min at 4 °C and carefully discard the supernatant.
   7. Air-dry the DNA pellet at room temperature or in an incubator until completely dry, then resuspend in an appropriate volume of PB buffer. For female (f) samples, add 50 µL of PB buffer, whereas for male (m) samples, add 15 µL.
3. PCR amplification and Sanger sequencing
   1. Perform PCR amplification using specific primers designed to flank the upstream and downstream regions of the gRNA target site.
   2. Purify the PCR products and subject them to Sanger sequencing. Analyze the sequencing chromatograms using SnapGene software³⁴ and align with the wild-type reference sequence for comparative analysis.
   3. Examine the peak plots near the gRNA target site for overlapping peaks indicative of indel mutations. Perform peak splitting to resolve mixed signals and confirm the mutation type, including insertions or deletions at the target site.
   4. Backcross to Bc/CyO males for 4 generations to establish Ent2/CyO.
      Note: It has been observed that Ent2*/Ent2* and CyO/CyO are lethal at early developmental stages; therefore, Ent2*/CyO heterozygotes are maintained.
4. After establishing the Ent2*/CyO heterozygotes, collect samples from the same batch of Ent2*/CyO heterozygotes under a stereomicroscope.
5. Randomly select 20 adult flies, and weigh them using a precision balance with a 0.001 g resolution. Photograph the samples to document the phenotypic characteristics.

6. Descriptive phenotypic characterization

1. Rear 120 males and 120 females (tested three vials for each group, with each vial containing 20 flies) each of Ent2*/CyO and w¹¹¹⁸ at 22 °C and 25 °C.
2. Record the number of deaths weekly and plot the survival curves.
3. Set up 30 random mating pairs per group; allow 24 h mating;
4. Transfer adults to fresh tubes; rear offspring.
5. At 7 days post-eclosion, assess climbing success (≥8 cm within 30 s) with six replicates per group.
6. All observations were recorded as descriptive characteristics of the mutant line and were not used to infer gene function.

7. Measure antioxidant enzyme activities

1. Collect 300 male and 300 female adults (tested three vials for each group, with each vial containing 100 flies) Ent2*/CyO and w¹¹¹⁸ control flies that at 5 days post‑eclosion to ensure physiological maturity and comparable age.
2. Transfer flies to empty tubes without food and starve for 2 h to standardize metabolic state prior to biochemical assays.
3. Add one steel bead/tube; homogenize at 60 Hz, 2 min.
4. Centrifuge 4 °C, 161 x g, 10 min; collect the supernatant.
5. Measure total superoxide dismutase (SOD, see Table of Materials for details) and catalase (CAT, see Table of Materials for details) according to the kit instructions.

8. Data statistics and analysis

1. Express all data as mean ± standard error of the mean (​ ± SEM).
2. Use one-way ANOVA to compare enzyme activity data; apply three-way ANOVA (factors: genotype, temperature, sex) for body weight, climbing ability, and body length. Perform Tukey’s HSD post hoc test when appropriate³⁵.
3. Define significance as P < 0.05 for all statistical tests.
4. Analyze lifespan data using survival curves and perform the log-rank (Mantel-Cox) test, which assesses whether significant differences exist in survival trajectories between experimental cohorts³⁶.
5. Conduct all analyses and plotting in GraphPad Prism 9.5.0 software following the software guidelines³⁷.
6. All statistical analyses were performed for descriptive comparison only and not to establish causal relationships.

Results

Design and effectiveness verification analysis of Ent2 gene targeting sites
Candidate target sites for the Ent2 gene were designed using CHOPCHOP and CCTop platforms (Figure 1). Two gRNAs targeting exon 2 and exon 5 regions were selected based on specificity and efficiency criteria. To verify successful genome editing, genomic DNA from randomly selected individuals of the established Ent2*/CyO line was amplified and subjected to Sanger sequencing. Sequencing chromatograms s...

Discussion

Ent is an evolutionarily conserved protein that influences multiple biological processes³⁸. When expressed in Xenopus laevis oocytes, Ent2 exhibits nucleoside transport activity⁸. Studies have demonstrated that the homozygous mutant of Ent2 is lethal during the late larval or early pupal stage¹⁰. In the present study, a CRISPR/Cas9-based genome editing workflow was established to generate Ent2-targeted alleles in <...

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
Ammonium acetate	Sigma	A1542
Catalase (CAT) Assay Kit (Visible Light Method) (Ammonium Molybdate Method)	Nanjing Jiancheng Bioengineering Institute	A007-1-1
Dodecyl sulfate	Sigma	L3771
Injection device	Eppendorf FemtoJet	4i
Linearized plasmid: MLM3613	Addgene	42251
Microscope	OLYMPUS	CKX3-SLP
mMESSAGE mMACHINE T7 kit	Thermo Fisher	AM1344
mMESSAGE mMACHINE T7 Transcription Kit	Thermo Fisher	AM1344
PmeI restriction enzyme	NEB	R0560S
Poly(A) polymerase	NEB	M0276S
Protease K	Thermo Fisher	EO0491
RNeasy Mini Kit	QIAGEN	74104
T7 RiboMAX Express Large Scale RNA Production System	Promega	P1320
T7 RiboMAX Kit	Promega	P1320
Total Superoxide Dismutase (T-SOD) assay kit (Hydroxylamine method)	Nanjing Jiancheng Bioengineering Institute	A001-1
w1118 Drosophila	Fangjing Biology
Water-saturated phenol/chloroform	Sigma	P2069