RESEARCH
Peer reviewed scientific video journal
Video encyclopedia of advanced research methods
Visualizing science through experiment videos
EDUCATION
Video textbooks for undergraduate courses
Visual demonstrations of key scientific experiments
BUSINESS
Video textbooks for business education
OTHERS
Interactive video based quizzes for formative assessments
Products
RESEARCH
JoVE Journal
Peer reviewed scientific video journal
JoVE Encyclopedia of Experiments
Video encyclopedia of advanced research methods
EDUCATION
JoVE Core
Video textbooks for undergraduates
JoVE Science Education
Visual demonstrations of key scientific experiments
JoVE Lab Manual
Videos of experiments for undergraduate lab courses
BUSINESS
JoVE Business
Video textbooks for business education
Solutions
Language
English
Menu
Menu
Menu
Menu
A subscription to JoVE is required to view this content. Sign in or start your free trial.
Research Article
Erratum Notice
Important: There has been an erratum issued for this article. View Erratum Notice
Retraction Notice
The article Assisted Selection of Biomarkers by Linear Discriminant Analysis Effect Size (LEfSe) in Microbiome Data (10.3791/61715) has been retracted by the journal upon the authors' request due to a conflict regarding the data and methodology. View Retraction Notice
PM2.5 exposure induces delayed testicular injury in rat models through sustained inflammatory responses, enhanced germ cell apoptosis, downregulation of Connexin-43/Occludin, and signaling consistent with activation of the JNK pathway, highlighting its long-term threat to male reproductive health.
Fine particulate matter (PM2.5) is increasingly implicated in male reproductive impairment. However, because most research remains acute-focused, delayed, persistent, or progressive post-exposure testicular damage-critical for long-term risk assessment-remains poorly understood. We established a time-resolved rat model to determine whether injury persists or worsens after exposure. Seventy-two male Sprague-Dawley rats were randomized into nine groups (control; vehicle at 24 h, 1, 2, and 4 months; PM2.5 at the same time points) and received intranasal PM2.5 at 5 mg/kg/day for 7 days. We quantified sperm quality and reproductive organ indices, examined testicular histology and ultrastructure, measured serum testosterone, FSH, LH, and E2, profiled inflammatory cytokine mRNAs (IL-1β, IL-6, TNF-α, IFN-γ), assessed germ-cell apoptosis by TUNEL, and evaluated junctional and stress-related proteins (Connexin-43, Occludin, JNK). PM2.5 exposure resulted in sustained declines in sperm concentration and motility, along with increased malformations and testicular and epididymal atrophy that did not recover over the 4-month post-exposure period. Histology showed progressive thinning of the seminiferous epithelium and ultrastructural degeneration. Endocrine disruption was also evident, with reduced testosterone and altered gonadotropins. Mechanistically, PM2.5 exposure maintained elevated IL-1β and IL-6 expression, promoted germ cell apoptosis, and downregulated Connexin-43 and Occludin while exhibiting patterns consistent with activation of the JNK pathway. Together, these findings demonstrate delayed and progressive testicular toxicity after PM2.5 exposure ends and suggest that preserving junctional integrity and targeting JNK may mitigate long-term reproductive harm.
PM2.5, a complex mixture of fine particulate matter with an aerodynamic diameter of≤2.5µm, originates from industrial emissions, vehicle exhaust, and biomass combustion, and has emerged as a major global environmental pollutant1. Epidemiological studies link PM2.5 exposure to respiratory and cardiovascular disease2, as well as reproductive system impairments3. The impact on male fertility is of particular concern due to evidence that air pollution can reduce sperm quality4. Male factors contribute to over half of infertility cases globally, and multiple studies report significant declines in sperm parameters over recent decades5. Recent global analyses further confirm widespread declines in sperm quality across multiple regions6. While factors such as smoking, alcohol use, radiation, and chemical exposure are established risks7, PM2.5 has emerged as an additional reproductive toxicant targeting the testes8.
The testes are highly sensitive to environmental toxicants due to their unique physiological structure and continuous spermatogenic activity. Previous research has indicated that PM2.5 exposure can induce testicular damage through multiple pathways, such as oxidative stress, inflammatory responses, and disruption of the blood-testis barrier9. These acute effects are characterized by reduced sperm quality, abnormal testicular histology, and hormonal imbalances10. However, most studies focus on immediate injury, leaving the long-term or delayed effects poorly characterized.
Current PM2.5 exposure models have inherent limitations: whole-body inhalation mimics natural exposure but requires specialized equipment and lacks dose precision11, while intratracheal instillation ensures dose control but is invasive and fails to replicate physiological particle deposition12. Our time-resolved intranasal model avoids these drawbacks-its non-invasive delivery aligns with upper respiratory deposition patterns, enables precise dose control, and supports long-term multi-time-point sampling to capture delayed injury, which exceeds the capacity of acute-focused traditional models13.
Our 5 mg/kg/day PM2.5 dose aligns with rodent subacute exposure paradigms proven to elicit reproductive responses, and via body surface area conversion, approximates a human equivalent dose ~6-fold higher than ambient levels-standard for accelerating long-term toxicity manifestations14. Species considerations apply: while rats share conserved testicular physiology with humans, their shorter spermatogenic cycle may accelerate injury progression observed in our timepoints15, and intranasal delivery differs from human lower respiratory deposition, though systemic toxin dissemination to testes is confirmed.
The delayed effects of environmental toxicant exposure are critical for assessing long-term reproductive risks, as they may reveal irreversible damage that is not evident in short-term observations16. For instance, some toxicants can cause latent injuries to the testes, which gradually manifest or worsen over time, even after exposure stops, potentially leading to chronic reproductive dysfunction17. Given the ubiquity and persistence of PM2.5, determining whether its reproductive toxicity continues or worsens post-exposure is critical18.
Sustained inflammation, oxidative stress, and impaired repair mechanisms are plausible drivers of delayed effects. PM2.5-induced upregulation of IL-1β, IL-6, and TNF-α can maintain chronic inflammation, disrupt spermatogenesis, and promote germ cell apoptosis19. Damage to key junction proteins, such as Connexin-43 and Occludin, compromises the blood-testis barrier and may prevent functional recovery20. Activation of the c-Jun N-terminal kinase (JNK) pathway, a mediator of stress and apoptotic signaling, has also been implicated21.
Despite the growing recognition of PM2.5's reproductive toxicity, there is a significant knowledge gap regarding the temporal dynamics of testicular damage after exposure cessation. Specifically, it remains unclear how long the testicular injuries persist, whether they worsen over time, and what molecular pathways drive these delayed effects22. Addressing these questions is crucial for developing targeted preventive and therapeutic strategies to mitigate PM2.5-induced male reproductive harm.
Significant gaps remain regarding the duration, progression, and mechanisms of PM2.5-induced testicular injury after exposure cessation. This study addresses these gaps by assessing reproductive endpoints; histopathology; hormone profiles-specifically follicle-stimulating hormone (FSH), luteinizing hormone (LH), and estradiol (E2); inflammation; apoptosis; and barrier-protein expression at multiple time points after exposure. The findings provide insight into the long-term reproductive risks of PM2.5 and inform public health strategies for protecting male fertility.
All animal procedures were conducted in accordance with institutional regulations and were approved by the Animal Ethics Committee of Fujian Health College (Project Approval No.: DW2024-01).
Safety and hazardous waste
Toxic reagents including formalin, osmium tetroxide, and chloroform were handled in a certified fume hood while wearing appropriate personal protective equipment. Halogenated organic waste and osmium-containing solutions were collected in designated containers and disposed of according to institutional requirements. Pentobarbital sodium was logged as a controlled substance, and sharps were handled safely throughout the study.
PM2.5 material and handling
A PM2.5 standard reference material was used for dosing. Following established particulate-preparation procedures, dry powder was suspended in sterile PBS at the required concentration and sonicated in a water bath for 10-15 min immediately before use, without surfactant. Working suspensions were prepared fresh each day. Endotoxin levels were evaluated by limulus amoebocyte lysate assay and were undetectable. When necessary, polymyxin-B controls were included to exclude LPS-driven effects.
Construction of animal models in vivo
Seventy-two SPF male Sprague-Dawley rats (2 months old, 190 ± 10 g) were housed under standard conditions and randomized into nine groups (n = 8 per group), consisting of a control group, vehicle groups sampled at 24 h, 1, 2, and 4 months, and PM2.5-exposed groups at the same time points. PM2.5 was administered intranasally at 5 mg∙kg-1∙day-1 in 10-20 µL per naris under light isoflurane anesthesia once daily for 7 days. After administration, rats were placed in a supine position for 1-2 min to facilitate inhalation. Animals were maintained until euthanasia at the designated post-exposure time points, and body mass was recorded for organ coefficient calculations. Endpoints included organ coefficients, sperm quality, histology and ultrastructure, serum reproductive hormones, and molecular assays.
Reproductive organ morphology and sperm quality assessment
Testes and epididymides were dissected under deep pentobarbital anesthesia, blotted, and weighed to calculate organ coefficients. Sperm were collected from the cauda epididymis by mincing in pre-warmed buffer at 37 °C. Concentration was determined using a hemocytometer. Motility was assessed by examining at least 200 sperm across five or more non-overlapping fields on pre-warmed slides. Morphology was evaluated after fixation, smearing, and staining with eosin-nigrosin or Diff-Quik, with at least 200 sperm scored per rat. All assessments were blinded, and technical replicates were averaged to obtain one value per animal.
Histological and ultrastructural analysis of testicular tissue
Testes were fixed in 10% neutral-buffered formalin, processed through graded ethanol and xylene, embedded in paraffin, and sectioned at 5 µm for HE staining. Stained sections were evaluated using systematic random sampling, with exclusions applied for oblique cuts, artifacts, or poor fixation. Tubule diameters were calculated from orthogonal axes, and epithelial thickness was measured at evenly spaced points. Analyses were blinded, and a minimum of 10 tubules per rat were evaluated.
For TEM, small tissue blocks were fixed in glutaraldehyde, post-fixed in osmium tetroxide, dehydrated, infiltrated with resin, and polymerized. Ultrathin sections were stained with uranyl acetate and lead citrate and imaged at 60-120 kV under consistent settings. QC included assessment of membrane and mitochondrial integrity and avoidance of extraction artifacts.
Enzyme-linked immunosorbent assay (ELISA)
Blood was collected from the abdominal aorta under anesthesia within a fixed morning window to control for circadian variation. After clotting and centrifugation, serum was aliquoted and stored at −80 °C. Testosterone, FSH, LH, and E2 were quantified using a validated immunoassay platform. Samples were run in duplicate with appropriate controls, and assay precision adhered to the platform's specifications. Hemolyzed or lipemic samples were excluded.
Real-time quantitative polymerase chain reaction (RT-qPCR)
Total RNA was extracted from testicular tissue using phenol-chloroform and purified through isopropanol precipitation and ethanol washing. RNA quality was verified spectrophotometrically. cDNA was synthesized, and RT-qPCR was performed with dye-based chemistry under standard cycling conditions, followed by melt curve analysis. Expression levels were normalized to GAPDH using the 2−ΔΔCq method.
Western blot analysis
Protein lysates were prepared in RIPA buffer with protease inhibitors, quantified by BCA assay, and denatured in loading buffer. SDS-PAGE and PVDF transfer were performed under controlled conditions. Membranes were blocked, incubated with primary antibodies for Connexin-43, Occludin, JNK, and GAPDH, followed by HRP-conjugated secondary antibodies. Bands were detected by chemiluminescence, and densitometry involved background subtraction, normalization to GAPDH, and scaling to the control group.
Statistical analysis
Data were reported as mean ± SD. One-way ANOVA with Tukey's post hoc test or Student's t-test was used where appropriate, with non-parametric data analyzed by Mann-Whitney U test. A p-value < 0.05 was considered significant.
Completion and Cleanup
All hazardous chemical waste was logged and disposed of appropriately. Raw data, including instrument outputs and analysis files, were archived with corresponding notes to ensure traceability.
Persistent deterioration of male reproductive function in rats, characterized by reduced sperm quality and impaired reproductive organ development due to PM2.5 exposure
To investigate the impact of PM2.5 on male reproductive function, sperm quality, reproductive organ coefficients, and related indicators were examined across nine groups of male rats. Analyses were performed relative to the 24 h postexposure time point. Although a Day-7 sampling timepoint was not included, inflammatory responses and histological injury were evident under the present regimen, supporting the validity of the exposure conditions.
PM2.5-exposed rats showed reduced sperm concentration and motility, along with increased sperm malformations, and these abnormalities persisted without evidence of recovery through 4 months post-exposure (Figure 1A). Testis and epididymis weights and organ indices were similarly reduced and did not improve by 4 months, indicating persistent atrophy (Figure 1B). These findings demonstrate that PM2.5 exposure produced long-lasting impairment of sperm quality and reproductive organ development.
Progressive postexposure testicular histopathological damage and hormonal imbalance after a 7-day PM2.5 exposure
Histopathological assessment revealed progressive deterioration of testicular structure after PM2.5 exposure. HE staining demonstrated increasing disorganization of the seminiferous epithelium and reduced spermatogenic layers over time (Figure 2A). Quantitative analysis confirmed sustained reductions in seminiferous epithelial thickness and tubule diameter (Figure 2B). TEM revealed worsening ultrastructural abnormalities, including mitochondrial swelling, cristae rupture, and endoplasmic reticulum dilation (Figure 2C).
Hormonal analysis showed alterations in testosterone, FSH, LH, and E2 levels (Figure 2D), indicating endocrine disruption consistent with the observed structural damage. Together, these results show that PM2.5 exposure led to progressive histopathological and endocrine impairments that persisted well after exposure cessation.
Association of PM2.5-induced testicular injury with sustained inflammatory responses and enhanced germ cell apoptosis
RT-qPCR analysis demonstrated elevated expression of IL-1β, IL-6, TNF-α, and IFN-γ in PM2.5-exposed testes relative to controls and VC animals, with increases maintained or intensified across the 24 h to 4-month postexposure period (Figure 3A). TUNEL staining showed increased germ cell apoptosis in PM2.5-exposed rats, with apoptosis expanding in extent and intensity over time (Figure 3B). The delayed peak in apoptosis relative to sperm motility decline suggests partially offset trajectories for structural and functional injury. Endocrine changes evolved more gradually but remained directionally aligned with inflammatory and apoptotic patterns. Overall, persistent inflammation and enhanced germ cell apoptosis jointly disrupted the testicular microenvironment, contributing to sustained impairment of spermatogenic function.
Association of PM2.5 exposure with compromised testicular barrier function, concomitant with decreased Connexin-43/Occludin and increased JNK signaling
Western blots showed reduced Connexin-43 and Occludin expression and increased total JNK in PM2.5-exposed testes compared with controls (Figure 4A). Quantitative analysis indicated progressive reductions in junctional proteins and increased JNK across the post-exposure period (Figure 4B). These findings are consistent with blood-testis barrier compromise and JNK-related signaling, although causal relationships will require phospho-specific and pathway perturbation studies.
DATA AVAILABILITY:
All raw data underlying the figures and tables are provided in Supplemental File 1.

Figure 1: PM2.5-induced deterioration of reproductive function in rats. Rats were divided into nine groups. (A,B) Reproductive-related indicators: (A) sperm concentration, sperm motility, and sperm deformity rate; (B) testicular weight, epididymal weight, testicular index, and epididymal index. Three independent experiments were done. n = 3 rats per group/timepoint. Data are presented as mean ± SD, with * p < 0.05 and ** p < 0.01. Abbreviations: 24H = 24 h; NM = N months. Please click here to view a larger version of this figure.

Figure 2: Progressive testicular histopathology and endocrine alterations following PM2.5 exposure. (A-D) Pathological and hormone-related indicators of testicular tissue. (A) Representative HE-stained sections (scale bar = 20 µm). Red arrows indicate disordered arrangement and focal necrosis/shedding of spermatogenic cells; yellow arrows indicate expansion of the interstitial area. (B) Quantification of seminiferous epithelial thickness and seminiferous tubule diameter. (C) Representative TEM micrographs (scale bar = 5 µm). Red arrows indicate damaged mitochondria, including swelling, matrix loosening, and cristae disruption; yellow arrows indicate autophagosomes containing damaged mitochondria. (D) Serum testosterone, FSH, LH, and E2 levels measured by ELISA. Three independent experiments were done. n = 3 rats per group/timepoint. Data are presented as mean ± SD, with * p < 0.05 and ** p < 0.01. Abbreviations: 24H = 24 h; NM = N months. Please click here to view a larger version of this figure.

Figure 3: Inflammatory responses and germ cell apoptosis induced by PM2.5. (A,B) Sustained inflammatory and apoptotic responses following PM2.5 exposure. (A) Relative mRNA expression of IL-1β, IL-6, TNF-α, and IFN-γ in testicular tissue by RT-qPCR. (B) Representative TUNEL-stained images of testicular tissue (scale bar = 50 µm). Three independent experiments were done. n = 3 rats per group/timepoint. Data are presented as mean ± SD, with * p < 0.05 and ** p < 0.01. Abbreviations: 24H = 24 h; NM = N months. Please click here to view a larger version of this figure.

Figure 4: Junctional protein alterations and JNK signaling patterns after PM2.5 exposure. (A) Representative Western blot bands for Connexin-43, Occludin, and total JNK, with GAPDH as the loading control. (B) Quantification of relative protein expression based on per-lane target/GAPDH intensities scaled to control = 1.0. Three independent experiments were done. n = 3 rats per group/timepoint. Data are presented as mean ± SD, with * p < 0.05 and ** p < 0.01. Abbreviations: 24H = 24 h; NM = N months. Please click here to view a larger version of this figure.
| Primer | Sequence (5’→3’) | |
| IL-1β | Forward | TCGCAGCAGCACATCAACAAGAG |
| Reverse | AGGTCCACGGGAAAGACACAGG | |
| IL-6 | Forward | TCTGGAGCCCACCAAGAACGATAG |
| Reverse | GTCACCAGCATCAGTCCCAAGAAG | |
| TNF-α | Forward | ACGCTCTTCTGTCTACTGAACTTCG |
| Reverse | TGGTTTGTGAGTGTGAGGGTCTG | |
| IFN-g | Forward | GTGCTGCTGATGGGAGGAGATG |
| Reverse | AGCCTGTTACTACCTGACACATTCG | |
| GAPDH | Forward | GCAAATTCAACGGCACAGTCAAG |
| Reverse | TCGCTCCTGGAAGATGGTGATG |
Table 1: RT-qPCR primers for IL-1β, IL-6, TNF-α, IFN-γ, and GAPDH.
Supplemental File 1: All raw data underlying the figures and tables. Please click here to download this file.
Short-course PM2.5 exposure was followed by progressive, post-exposure deterioration of male reproductive function over 1-4 months. These findings support time-dependent reproductive toxicity that persists after dosing ceases and extend prior observations of PM2.5-associated reproductive impairment23.
To enhance reproducibility, we standardized four elements. First, exposure consistency was maintained by normalizing dose to body mass, controlling intranasal volume and positioning, and using brief anesthesia with supine recovery. Second, a staged post-exposure schedule at 24 h, 1, 2, and 4 months captured the transition from acute responses to chronic progression. Third, molecular quality control included RNA purity thresholds, constrained RT-qPCR technical variance, and lane-matched Western blot normalization. Fourth, morphologic preprocessing followed timed fixation, post-fixation, and dehydration/infiltration for TEM.
Histology and ultrastructure revealed thinner seminiferous epithelium and junctional compromise, consistent with a sustained adverse microenvironment after exposure stops. Endocrine profiles showed discordant testosterone-gonadotropin patterns at later timepoints. Decreased Connexin-43/Occludin supports blood-testis barrier alteration in the post-exposure window24. Higher JNK (total) is consistent with JNK-related signaling observed in rodent PM2.5 models of reproductive toxicity25. Parallel reports describe mitochondrial injury and impaired spermatogenesis after PM2.5 exposure26. Evidence also points to epigenetic contributions to durable reproductive effects following PM2.5 exposure14. A broader literature similarly documents persistent inflammation and reproductive histopathology beyond the exposure window27.
A parsimonious working model is an injury-inflammation-failed repair loop. Low-grade inflammation and oxidative stress maintain a hostile milieu. Incomplete blood-testis barrier repair exposes germ cells to damage. Endocrine disequilibrium delays recovery. Stress signaling consistent with JNK-related pathways sustains apoptosis and helps explain progression after exposure rather than rapid resolution28.
Intranasal instillation differs from whole-body inhalation in deposition. Nevertheless, its dose control and feasibility allow time-resolved follow-up and yield sustained injury profiles compatible with prior exposure-model experience28.
This study has limits. It did not include a functional blood-testis barrier (BTB) permeability assay, so BTB compromise is inferred from marker levels and ultrastructural features rather than direct permeability measurements29. We quantified total JNK and tight-junction markers (Connexin-43, Occludin) but did not include phospho-specific readouts (e.g., p-JNK or p-c-Jun) or pathway perturbations (inhibitors/agonists or genetic tools). We did not evaluate additional routes such as NF-κB, ERK, or oxidative-stress indices. A Day-7 end-of-exposure timepoint was not part of the original design; the 24 h timepoint served as the immediate post-exposure anchor for longitudinal contrasts. These factors may modestly limit causal attribution and temporal granularity but do not alter the overall pattern of post-exposure injury.
Future work can address three points: (i) incorporate functional BTB permeability assays and deposited-dose quantification/tracing to strengthen mechanistic links; (ii) add phospho-specific targets and pathway perturbation to test causality with greater precision; and (iii) evaluate reversibility and therapeutic windows using anti-inflammatory, antioxidant, and barrier-support strategies to define drivers of persistence and translational relevance.
In conclusion, this study confirms that PM2.5 can cause delayed testicular injury in rats. The main mechanisms are persistent inflammation, germ cell apoptosis, and blood-testis barrier disruption linked to increased JNK (total) and Connexin-43/Occludin downregulation. These findings add to the understanding of the reproductive toxicity of air pollutants and show that injury may continue after exposure ends. The delayed effects should be included in pollution control and health risk assessment to better protect male reproductive health.
The authors have no conflicts of interest to declare.
This work was supported by the Natural Science Foundation of Fujian Province, China (Grant No:2023J01170).
| 1% osmium tetroxide | TCI, China | O0308 | For post - fixation in TEM analysis of testicular tissue |
| 10% neutral buffered formalin | Solarbio, China | PC0020 | For fixing testicular tissue samples in HE staining |
| 2.5% glutaraldehyde | Solarbio, China | G1102 | For fixing testicular tissue samples in TEM analysis |
| 75% ethanol | Acros Organics, USA | 61509-0040 | For purifying precipitated RNA in RT - qPCR |
| Automatic Chemiluminescence Imager | Bio-Rad, USA | ChemiDoc | Used for automatic imaging of chemiluminescent signals in Western blotting. |
| BCA protein assay kit | Solarbio, China | PC0020 | For determining total protein concentration in Western blot analysis |
| Blocking buffer | Not specified | T7131A | Used in Western blot analysis to eliminate non - specific binding |
| Chloroform | Acros Organics, USA | 327270010 | Used in RNA separation during RT - qPCR |
| Connexin - 43 | Abcam, USA | ab11370 | Detects the expression and distribution of a key blood - testis barrier protein to help assess the integrity of the barrier |
| ECL kit | Biosharp, China | BL520B | For visualizing protein bands in Western blot analysis |
| ELISA kits (for testosterone, FSH, LH, E2) | Abcam, UK | ab108666; ab108702; ab108651; ab108667 | For detecting serum reproductive hormones |
| Eosin | Solarbio, China | G1002 | Used in HE staining of testicular tissue |
| Epoxy resin | Solarbio, China | GP2001 | For embedding testicular tissue samples in TEM analysis |
| GAPDH | Abcam, USA | ab128915 | Evaluates the apoptosis of testicular cells induced by PM2.5 and provides a morphological basis for studying its impact on testicular cell apoptosis |
| Hematoxylin | Solarbio, China | G1077 | Used in HE staining of testicular tissue |
| Imaging System | Nikon, Japan | Nikon DS-U3 | Used for imaging samples under a microscope. |
| Isopropanol | Acros Organics, USA | AC447080025 | Used in RNA precipitation during RT - qPCR |
| JNK | Abcam, USA | ab124956 | Explores the molecular mechanism of testicular injury caused by PM2.5 and identifies the cell types in which it is activated |
| Microplate Reader | MOLECULAR DEVICES, USA | SpectraMax iD3 | Used for detecting signals in microplates (e.g., absorbance, fluorescence). |
| Occludin | Abcam, USA | ab31721 | Understands the damage degree of the blood - testis barrier and explores the interactions between relevant proteins |
| Optical Microscope | Chongqing Opto - Electronic Instrument , China | BDS200 | Used for general optical microscopic observation. |
| Pathological Microtome | Shanghai Kaiyu Instrument, China | RM2016 | Used for cutting sections of pathological tissues. |
| Pentobarbital sodium | Solarbio, China | G1102 | Used for intraperitoneal injection in rats before blood collection |
| PM2.5 standard reference material | National Institute of Metrology, China | GBW13643 | For PM2.5 exposure in experimental group |
| Polyvinylidene difluoride (PVDF) membrane | Thermo Fisher, USA | 88585 | Used in Western blot analysis for protein transfer |
| PrimeScript RT reagent Kit | TAKARA, Japan | RR037Q | For cDNA synthesis in RT - qPCR |
| Real-Time PCR System | Roche, Switzerland | LightCycler 480 | Used for real - time polymerase chain reaction for gene expression analysis. |
| RIPA lysis buffer | TAKARA, Japan | RR9161 | For extracting proteins in Western blot analysis |
| Shaker | Thermo, USA | MAXQ-4000 | Used for shaking samples in experiments. |
| SPSS | IBM, USA | 28 | For data analysis |
| Sterile saline | Solarbio, China | S8160 | Used in vehicle group treatment |
| TB Green Premix Ex Taq II kit | TAKARA, Japan | RR820S | Used in RT - qPCR |
| Transmission Electron Microscope (TEM) | Hitachi, Japan | HT7800/HT7700 | Used for ultrastructural observation at the nanoscale. |
| Trizol reagent | Ambion, China | 15596018 | For extracting total RNA in RT - qPCR |
| Ultramicrotome | Leica, Germany | Leica UC7 | Used for cutting ultra - thin sections for TEM. |
| Universal Protein Transfer System / Protein Transfer Blot Machine | Bio-Rad, USA | Trans-Blot Turbo | Used for protein transfer in Western blotting. |
| Upright Optical Microscope | Nikon, Japan | Nikon Eclipse E100 | Used for upright optical microscopic observation. |
| Uranyl acetate | Merck, Germany | 201030 | For staining ultrathin sections in TEM analysis of testicular tissue |