Wen Yang Ding Chuan Tang Attenuates Asthmatic Airway Remodeling by Inhibiting M2 Macrophage-Driven Fibroblast Activation

Summary

This article describes a study on the regulation of pulmonary fibroblast fibrosis by Wenyang Dingchuan Decoction through inhibition of M2 macrophage polarization.

Abstract

To study the effects of Wen Yang Ding Chuan Tang (WYDCT) on fibroblast function, airway remodeling in asthma, and the underlying mechanism. IL-4 was used to induce M2 polarization of RAW264.7 macrophages, and the polarized macrophages were then treated with WYDCT to investigate its effect on mouse lung fibroblasts. Polarized RAW264.7 cells were subjected to different treatments and then co-cultured with fibroblasts. M1 and M2 marker levels, cell morphology, and IL-6 concentration were assessed. STAT3 protein level was analyzed. Fibroblast viability, proliferation, colony formation, PCNA expression, and the expression of fibronectin, COL1A1, and α-SMA were analyzed using various assays, including real-time PCR, Western blot, CCK-8, Edu, immunofluorescence, and colony formation assays. WYDCT reversed the IL-4-induced morphological changes in RAW264.7 cells, reduced the levels of M2 markers (Arg-1, CD206) and IL-6, and decreased STAT3 expression in RAW264.7 cells, while supplementation with IL-6 restored the effect of WYDCT on M2 markers. Furthermore, WYDCT inhibited fibroblast viability and proliferation, reduced PCNA expression, and decreased fibrosis markers (fibronectin, COL1A1, α-SMA), suggesting that WYDCT inhibits the viability, proliferation, and fibrosis of lung fibroblasts by suppressing macrophage M2 polarization, in which the IL-6/STAT3 signaling pathway may play a key role.

Introduction

Asthma, also known as bronchial asthma, is a persistent inflammatory condition of the respiratory passages¹. Frequently linked to allergen exposure, cold temperatures, and irritants of both physical and chemical nature, this condition is characterized by infiltration of inflammatory cells, reversible constriction of airways, mucus secretion, and bronchospasm². Currently, there are at least 300 million asthma patients worldwide, and the prevalence is increasing year by year³. In 2015, 400,000 people died from asthma, making it a serious global health issue^4,5. China is also facing the same problem, with studies showing an asthma prevalence rate of 4.2%, accounting for approximately 45.7 million adult patients, with lower control rates compared to developed countries^6,7. The well-being of individuals affected by this ailment is greatly compromised, leading to a substantial financial strain on families.

Airway remodeling is considered a crucial factor in the treatment of asthma that is difficult to control⁸. Therefore, the treatment of chronic persistent asthma becomes a key point. Clinical practice often involves the use of inhaled corticosteroids in combination with bronchodilators, which can effectively alleviate symptoms in patients⁹. However, these treatments have certain side effects and may be less effective in improving symptoms for some patients. Additionally, asthma tends to recur after discontinuation of medication. Research has shown that the activation of lung fibroblasts is related to airway remodeling during the progression of asthma¹⁰. Upon activation, lung fibroblasts undergo phenotypic transformation and secrete key proteins to drive extracellular matrix (ECM) deposition-the core pathological feature of airway remodeling. Specifically, fibronectin serves as an early scaffold for ECM assembly, promoting the recruitment and adhesion of other matrix components; COL1A1 (type I collagen α1 chain) is the main structural protein of ECM, and its excessive accumulation leads to airway wall thickening and stiffness; α-SMA (α-smooth muscle actin) marks the transformation of fibroblasts into myofibroblasts with strong contractile and secretory abilities, further accelerating ECM deposition and airway fibrosis.

IL-6 is the most important cytoplasmic signaling factor for STAT3 pathway activation¹¹. Elevated IL-6 activates the STAT3 pathway. In asthmatic mouse lung tissue, STAT3 and phosphorylated mRNA and protein expression are significantly increased. The IL-6/STAT3 signaling pathway is one of the targets for asthma treatment. Studies have confirmed that the activation of the IL-6/STAT3 signaling pathway is associated with airway inflammation in asthma, and inhibiting this pathway can reduce airway inflammation^12,13. IL-6/STAT3 is also associated with the M2 polarization of macrophages. Foreign studies have demonstrated that IL-6 expression significantly reduces downstream STAT3 activation, which correlates with reduced tumor surface numbers, decreased proliferation, and reduced M2 macrophage numbers in the liver¹⁴.

Immune cells known as macrophages can be categorized into distinct phenotypes, namely classical activation (M1) and alternative activation (M2), each fulfilling unique roles¹⁵. M1 macrophages can induce inflammatory reactions and tissue damage, while M2 macrophages promote cell proliferation and facilitate wound healing and tissue repair. Research has shown that airway remodeling in asthma is associated with M2 macrophages¹⁶. In vitro experiments have demonstrated that inducing M2 polarization of macrophages with IL-4 significantly enhances the proliferation capacity of α-SMA-positive cells¹⁷. Inhibiting M2 macrophage polarization is an effective approach for treating airway remodeling in asthma.

Asthma belongs to the category of "Xiao Bing" in traditional Chinese medicine. The pathological factors of Xiao Bing mainly involve phlegm. The production of phlegm results from an imbalance between Yin and Yang in the viscera, combined with external factors such as exogenous pathogens, diet, and post-illness conditions, which affect the movement of body fluids, leading to stagnation and accumulation. With continued exploration of the mechanisms of traditional Chinese medicine in the treatment of asthma, more and more studies have shown that traditional Chinese medicine has significant effects in alleviating airway inflammation, reducing excessive mucus secretion, and inhibiting airway remodeling^18,19. In Xiao Bing, the lung is primarily affected, followed by the spleen and kidneys. Patients with Xiao Bing have deficient lung qi and a weak defense against external pathogens, leading to a loss of lung qi dissemination and long-term, repeated injury to yang qi, resulting in lung yang deficiency. Yang deficiency leads to the abnormal circulation of body fluids, which condense into phlegm. With long-term attacks, cold phlegm affects the yang of the spleen and kidneys, resulting in a pattern of lung-spleen-kidney yang deficiency, imbalance of yin and yang, excessive preponderance or deficiency of the constitution, and abnormal circulation of body fluids. The lung cannot disperse fluids, the spleen cannot transform water and essence, and the kidneys cannot vaporize and transform fluids, leading to the condensation of phlegm and the formation of stasis, which manifests as asthma. Therefore, yang deficiency is the root cause of Xiao Bing, and phlegm stasis is its characteristic. Wen Yang Ding Chuan Tang is composed of 12 Chinese medicinal herbs, including Epimedium (15 g), Ephedra (processed) (10 g), Ginseng (15 g), Astragalus (15 g), Ginkgo biloba (15 g), Flos Farfarae (15 g), Bitter Apricot Kernel (15 g), Pinellia ternata (processed) (10 g), Schisandra chinensis (10 g), Earthworm (10 g), Persica (10 g), and Licorice (processed) (10 g). This herbal formula is derived from the modified formulation of Ding Chuan Tang in the book "She Sheng Zhong Miao Fang" and has the effects of warming yang, reinforcing qi, resolving phlegm, promoting blood circulation, and relieving cough and asthma. The clinical efficacy of this treatment has been established, prompting current experimental investigations into its mechanism for addressing airway remodeling in asthma.

Compared with current pharmacological therapies for asthma, such as inhaled corticosteroids, β2-agonists, and monoclonal antibody-based biologics targeting IgE or IL-5, Wen Yang Ding Chuan Tang (WYDCT) offers a potential multi-target and safer therapeutic strategy. Conventional corticosteroids effectively relieve airway inflammation but are often associated with side effects such as immunosuppression, hormonal imbalance, and relapse upon withdrawal. Biologic agents, while more specific, are costly and limited to particular asthma phenotypes. In contrast, WYDCT, derived from traditional Chinese medicine theory of "warming yang and resolving phlegm," exerts comprehensive effects on regulating immune balance, reducing airway inflammation, and suppressing airway remodeling, as demonstrated in clinical and experimental studies²⁰. Its multi-component composition may simultaneously modulate macrophage polarization, fibroblast activation, and cytokine release, providing a broader and potentially more sustainable improvement in asthma pathology.

In this study, the water extract of Wen Yang Ding Chuan Tang (WYDCT) was prepared from twelve herbs in a fixed traditional ratio, concentrated to a final stock solution of 1 g/mL (crude drug equivalent), and filtered for cell culture use. The extract was applied at concentrations of 50, 100, and 200 µg/mL, which were selected based on preliminary cell viability assays to ensure non-cytotoxicity while maintaining pharmacological activity. The in vitro model involved IL-4-induced M2 polarization of RAW264.7 macrophages and co-culture with mouse lung fibroblasts (L929 cells), enabling us to assess macrophage paracrine effects on fibroblast activation and fibrosis-related responses. These details provide a reproducible framework for future studies investigating the dose-response characteristics and mechanistic pathways of WYDCT in airway remodeling.

Based on the above findings, we speculate that Wen Yang Ding Chuan Tang exerts its anti-airway-remodeling effects in asthma by inhibiting the M2 polarization of macrophages and suppressing the activation of fibroblasts.

Protocol

This study was conducted following international, national, and institutional guidelines for humane animal treatment and in compliance with relevant legislation. Specifically, all procedures involving mice were approved by the Animal Ethical Care Committee of The Third Affiliated Hospital of Qiqihar Medical College (AECC-2022-009). Mice were housed under standard laboratory conditions with access to food and water ad libitum, and all efforts were made to minimize suffering. Humane endpoints were established and monitored throughout the study.

1. Preparation of WYDCT extract

The 12 herbs of Wen Yang Ding Chuan Tang were weighed according to the traditional ratio: Epimedium (15 g), processed Ephedra (10 g), Ginseng (15 g), Astragalus (15 g), Ginkgo biloba (15 g), Flos Farfarae (15 g), Bitter Apricot Kernel (15 g), processed Pinellia ternata (10 g), Schisandra chinensis (10 g), Earthworm (10 g), Persica (10 g), and processed Licorice (10 g).

Ten times the volume of distilled water was added, and the mixture was boiled for 30 min. The extraction was repeated twice, and the filtrates were combined. The combined extract was concentrated under reduced pressure to a crude drug equivalent concentration of 1 g/mL. The extract was filtered through a 0.22 µm membrane, aliquoted, and stored at −20 °C. Working concentrations (50, 100, and 200 µg/mL) were prepared by dilution immediately before use.

2. Cell culture and M2 polarization

RAW264.7 cells (ATCC, USA) were thawed and seeded at a density of 1 × 10⁶ cells per 10 cm dish in 10 mL DMEM supplemented with 10% fetal bovine serum, 100 U/mL penicillin, and 100 µg/mL streptomycin. The cells were incubated at 37 °C in a humidified atmosphere containing 5% CO₂ for 24 h until 80%-90% confluency was reached.

The culture medium was then replaced with fresh DMEM containing 20 ng/mL IL-4, and the cells were incubated for an additional 24 h to induce M2 polarization. After incubation, the cells were washed twice with PBS and subsequently treated with WYDCT extract (10 mg/mL stock solution diluted to the indicated final concentrations) for 24 h. For IL-6 supplementation experiments, 50 ng/mL IL-6 was added during WYDCT treatment.

Cells treated with 0.1% DMSO served as the negative control. Cellular morphology was examined under an inverted microscope, and representative images were captured.

3. Isolation and culture of mouse lung fibroblasts

Mice were euthanized in accordance with approved ethical protocols. Lung lobes were collected and placed in cold Hanks' balanced salt solution. Visible blood vessels and connective tissue were removed, and the lung tissue was minced into small pieces (~1 mm³).

The tissue fragments were digested in 0.25% trypsin for 40 min at 37 °C with gentle agitation, followed by a second digestion in 0.25% trypsin for 30 min. The cell suspension was centrifuged at 300 × g for 5 min, the supernatant was discarded, and the pellet was resuspended in DMEM supplemented with 10% fetal bovine serum.

The suspension was incubated for 100 min to allow fibroblasts to adhere, after which the cells were centrifuged again at 300 × g for 5 min to enhance purification. Purified fibroblasts were seeded into appropriate culture plates and incubated at 37 °C in a humidified atmosphere containing 5% CO₂ until approximately 80% confluency was reached.

4. Co-culture of fibroblasts with conditioned medium

The supernatant was collected from treated RAW264.7 cells and centrifuged at 3000 × g for 10 min at 4 °C. The fibroblast culture medium was replaced with the collected macrophage-conditioned medium. Fibroblasts were incubated for 24 h at 37 °C in a humidified atmosphere containing 5% CO₂ prior to functional assays. Following incubation, fibroblasts were harvested for RNA and protein extraction for subsequent qRT-PCR and Western blot analyses.

5. Cell viability (CCK-8 assay)

Fibroblasts were seeded at a density of 5 × 10³ cells per well in 96-well plates containing 100 µL of culture medium. The cells were subjected to the indicated treatments for 24 h. Subsequently, 10 µL of CCK-8 reagent was added to each well, and the plates were incubated for 2 h at 37 °C. The optical density (OD) was measured at 450 nm using a microplate reader. Cell viability was calculated as (OD_treated / OD_control) × 100%. All experiments were performed with three biological replicates.

6. Colony formation assay

Cells were seeded at a density of 1 × 10³ cells per well in 6-well plates, with three replicate wells per condition. The plates were incubated for 10-14 days until visible colonies had formed. The colonies were stained with 0.1% crystal violet for 10 min at room temperature. After staining, the colonies were washed and photographed. The bound dye was dissolved in 30% acetic acid for 15 min, and the optical density was measured at 590 nm. Three independent experiments were performed.

7. EdU proliferation assay

Cells were treated as indicated for 24 h. Subsequently, 100 µL of 50 µM EdU was added to each well, and the cells were incubated for 2 h at 37 °C. The cells were fixed in 4% paraformaldehyde for 30 min and quenched with 2 mg/mL glycine for 5 min. The cells were permeabilized with 0.5% Triton X-100 in PBS, washed, and incubated with Apollo staining solution for 30 min. Nuclei were counterstained with Hoechst 33342 (1×) for 30 min. EdU-positive cells were observed and imaged using a fluorescence microscope.

8. ELISA for IL-6

The RAW264.7 cell supernatant was centrifuged at 3000 × g for 15 min at 4 °C. IL-6 levels were measured using a Beyotime ELISA kit according to the manufacturer's instructions. Absorbance was measured using a microplate reader, and IL-6 concentrations were calculated based on a standard curve.

9. Immunofluorescence

Fibroblasts were fixed in pre-chilled acetone for 10 min and washed three times with PBS. The cells were permeabilized with 0.1% Triton X-100 for 10 min and blocked with 1% BSA in PBS for 30 min. Cells were then incubated with a primary antibody against PCNA (1:100) overnight at 4 °C. After washing three times with PBS, the cells were incubated with a FITC-conjugated secondary antibody (1:200) for 1 h at room temperature. Nuclei were counterstained with DAPI, washed, and imaged using a fluorescence microscope.

10. qRT-PCR

Total RNA was extracted using Trizol reagent (Beyotime, China) according to the manufacturer's protocol. Reverse transcription was performed with the cDNA Synthesis Kit using 2 µg of RNA and random primers. PCR reactions were prepared in a 20 µL volume containing 10 µL SYBR Green Master Mix, 0.5 µL of each gene-specific primer (final concentration 0.5 µM), and 1 µL of cDNA template. The primers used included CD16, iNOS, Arg-1, CD206, fibronectin, COL1A1, α-SMA, and GAPDH (sequences provided).

The thermal cycling conditions consisted of an initial denaturation at 95 °C for 5 min, followed by 40 cycles of 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 30 s. Melting curve analysis was performed from 60 °C to 95 °C in 0.5 °C increments to verify the specificity of amplification.

Data Analysis: Relative expression was calculated using the 2^^−ΔΔCT method and normalized to GAPDH. Primers were as follows: CD16 (mouse): 5′- AGGAGCTGAGGAGGAGGAGG-3′ and 5′- TGAGGAGGAGGAGGAGGAGC-3′, iNOS (mouse): 5′-TGCTCCCCAGGAGATGTTGT-3′ and 5′-TGGTCTGGTAGGCTGTACGG-3′, Arg-1 (mouse): 5′- GCTGCTGCTGCTGCTGCTG-3′ and 5′- GGTGGCTTTGCTGGTCTGTC-3′, CD206 (mouse): 5′- GGCTTCTATGAGCTGGGTGA-3′ and 5′- CTGGGCTTCTGGATGTTGTT-3′, fibronectin (mouse): 5'-CGTGGTGAAGGTGTTTCTGC-3' and 5'-GAGGTCACAGTGGTCTTGCT-3', COL1A1 (mouse): 5'-CCCTGGACACCTGGCTTT-3' and 5'-GCGGGTCACCTTCTCTTCTC-3', α-SMA (mouse): 5'-CTGGAACAGCACAGCTTCTC-3' and 5'-GGGACATAGCACAGCTTCTC-3', GAPDH (mouse): 5′- TGTGTCCGTCGTGGATCTGA -3′ and 5′- CCTGCTTCACCACCTTCTTGAT-3′.

11. Western blot

Cells were lysed using RIPA buffer containing protease inhibitors. Protein concentrations were determined using a BCA assay. For SDS-PAGE, 60 µg of protein was loaded into each lane of a 10% polyacrylamide gel and separated at 120 V for 1.5-2 h. The proteins were transferred onto a PVDF membrane using a wet transfer method at 100 V for 1 hour. After blocking with 5% non-fat milk in TBS-T for 1 h at room temperature, the membrane was incubated with primary antibodies (1:1000 dilution) overnight at 4 °C. Following washes with TBS-T, the membrane was incubated with HRP-conjugated secondary antibodies (1:5000 dilution) for 1 h at room temperature. After additional washes, protein bands were detected using an ECL chemiluminescence reagent and imaged with a chemiluminescence imaging system. Band intensities were quantified using ImageJ software, and protein levels were normalized to GAPDH as the internal control.

12. Statistical analysis

Data were analyzed using SPSS 17.0. Continuous variables were expressed as mean ± standard deviation (SD). Comparisons between two groups were performed using an unpaired t-test, while comparisons among multiple groups were conducted using one-way ANOVA followed by the LSD post hoc test. A p-value less than 0.05 was considered statistically significant.

Results

The effects of WYDCT on RAW264.7 cells M2 polarization of macrophages

We observed RAW264.7 cell morphology using a light microscope. As shown in Figure 1A, IL-4 stimulation caused cells to elongate, resulting in a more elongated, spindle-like shape compared to untreated cells. Additionally, the IL-4-stimulated cells exhibited increased cytoplasmic granularity and showed enhanced adherence to the culture substrate. These morphological changes sugge...

Discussion

The objective of this study was to explore the impact of WYDCT on fibroblast activity and airway remodeling in asthma, as well as the underlying mechanisms. The current findings demonstrate that WYDCT can inhibit M2 polarization of RAW264.7 macrophages, which subsequently affects the viability, proliferation, and fibrosis of mouse lung fibroblasts. Moreover, the IL-6/STAT3 signaling pathway played a key role in mediating these effects.

Macrophage polarization is a crucial process in the pathog...

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
Apollo 643 Hybridization Reagent	Guangzhou RiboBio Co., Ltd.	C10371-2
Arginase-1 (E4U1I) Mouse mAb	Cell Signaling Technology, Inc.	43933T
BCA protein concentration determination kit	Beyotime Biotechnology Co., Ltd.	P0012
BeyoBlot HRP-Conjugated Mouse Anti-Rabbit Native IgG (H+L)	Beyotime Biotechnology Co., Ltd.	A0210
Carbon dioxide incubator	Shanghai Lishen Scientific Equipment Co., Ltd.	HF240
CD206/MRC1 (E6T5J) XP® Rabbit mAb	Cell Signaling Technology, Inc.	24595T
Cell Counting Kit-8	Beyotime Biotechnology Co., Ltd.	C0037
COL1A1 (E8F4L) XP Rabbit mAb	Cell Signaling Technology, Inc.	72026T
Dimethyl Sulfoxide	Beyotime Biotechnology Co., Ltd.	ST038-100ml
DMEM high sugar medium	Grand Island Biological Company	11965092
EDU	Beyotime Biotechnology Co., Ltd.	ST067-250mg
FcγRIII/CD16 (F6K6G) Rabbit mAb	Cell Signaling Technology, Inc.	71345T
fetal calf serum	Grand Island Biological Company	A5256701
Fibronectin/FN1 Antibody	Cell Signaling Technology, Inc	63779S
FITC-Conjugated Goat Anti-Mouse IgG (H+L)	Beyotime Biotechnology Co., Ltd.	A0568
Fluorescence quantitative PCR instrument	Yarui Biotechnology Co., Ltd.	MA-6000
Hoechst 33342 Live Cell Staining Solution (100X)	Beyotime Biotechnology Co., Ltd.	C1029
iNOS (E1W4J) Rabbit mAb	Cell Signaling Technology, Inc.	70706SF
inverted microscope	Guangzhou Mingmei Optoelectronics Technology Co., Ltd.	MI52-N
LRRK2 T1348N mut RAW 264.7	ATCC	SC-6005
mmunostaining Permeabilization Buffer (with Triton X-100)	Beyotime Biotechnology Co., Ltd.	P0096-100ml
Mouse IL-6 ELISA Kit	Beyotime Biotechnology Co., Ltd.	PI326
Mouse Lung Fibroblast Cells	Wuhan Procell Life Technology Co., Ltd.	CP-M006
PCNA (PC10) Mouse mAb	Cell Signaling Technology, Inc.	2586T
Penicillin-streptomycin	Grand Island Biological Company	15140148
Recombinant Murine IL-4	Beyotime Biotechnology Co., Ltd.	P5916-5μg
Recombinant Murine IL-6	Beyotime Biotechnology Co., Ltd.	P5925-10μg
Redu enzyme label instrument	Rayto Life Sciences	RT-6100
Stat3 (124H6) Mouse mAb	Cell Signaling Technology, Inc.	9139T
superclean bench	Jinan BioBase Biotech Co., Ltd.	BBS-SDC
SynGAP-α2 (E4Y6I) Rabbit mAb	Cell Signaling Technology, Inc.	56927T
Thermo Fisher Scientific RIPA Lysis and Extraction Buffer	ThermoFisher	89901
Trizol (Total RNA extraction reagent)	Beyotime Biotechnology Co., Ltd.	R0016
β-Actin Antibody	Cell Signaling Technology, Inc.	4967S