A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Hepatitis E Virus Fluorescence Reduction Neutralization Test for Measuring Neutralizing Antibody Titers

160 views

DOI:

10.3791/69892

May 22nd, 2026

In This Article

Summary

There is no standard virus neutralization assay available for the Hepatitis E Virus (HEV), a non-cytopathic positive-strand RNA virus. Here,  a fluorescence reduction neutralization test (FRNT)-based on quantification of fluorescent labeled viral capsid protein is described for evaluating the efficacy of anti-HEV antibodies. 

Abstract

Virus neutralization assay measures the neutralization potential of an antibody or a mixture of antibodies against the corresponding virus. It is a valuable technique to evaluate the efficacy of vaccine candidates and neutralizing antibodies developed against the virus. The plaque reduction neutralization test (PRNT) is a popular method to evaluate the titer of virus-specific neutralizing antibodies. However, PRNT is not feasible in the case of non-cytopathic viruses. Hepatitis E virus (HEV) is a positive-sense single-stranded RNA virus, belonging to the family Hepeviridae. It is a major cause of acute viral hepatitis worldwide. It does not show any cytopathic effect in mammalian cell culture. A vaccine against HEV is available in China. However, vaccines or therapeutic antibodies against HEV are not available in most of the world. Several laboratories have been working on vaccine candidates against the HEV. A neutralization assay to measure the efficacy of HEV vaccines will be a very useful tool for researchers. Here, we describe a fluorescence reduction neutralization test (FRNT) to estimate the 50% neutralization titre (NT50) of anti-HEV antibodies. Anti-HEV ORF2-neutralized, or rabbit IgG-neutralized HEV, was used to infect Huh7 cells, followed by immunofluorescent staining of the viral ORF2 protein. Fluorescent positive cells were quantified in the ImageJ application, and NT50 was estimated to be 2.1 x 103. This method may be applied to estimate the NT50 of anti-HEV antibodies present in immunized-mice sera, HEV-recovered individual sera, and laboratory-produced anti-HEV antibodies.

Introduction

Hepatitis E virus (HEV) is a positive-sense single-stranded RNA virus that belongs to the Hepeviridae family1,2. It usually causes self-limiting acute hepatitis but can cause chronic hepatitis in immunosuppressed individuals3,4. Pregnant women are at high risk of developing fulminant hepatic failure, with the mortality rate increasing up to 30%5. The World Health Organization (WHO) reported about 19.47 million cases of acute hepatitis E (AHE) and 3450 deaths caused by HEV globally in 20216. HEV is transmitted in developing countries primarily through contaminated food and water, due to poor sanitation, while sporadic occupational infection in developed countries is associated with consumption of raw or undercooked meat6. HEV is classified into eight genotypes. Genotype (g) 1- and g2- HEV exclusively infect only humans. g3- and g4-HEV have a wide range of hosts such as human, rabbit, swine, wild boar, and deer. g5- and g6-HEV infect wild boars while g7- and g8-HEV infect camels. A single case of human transmission of g7-HEV has been reported in the Middle East through consumption of camel meat and milk7,8. HEV infection is mostly common in low to middle-income countries. Several waterborne outbreaks have been reported in endemic regions of South and Southeast Asia, Africa, and Mexico, primarily caused by g1- and less frequently by g2-HEV infection. Occupational sporadic infection cases in developed countries in Europe and East Asia are mostly caused by the g3-HEV6,7.

The HEV genome is a 7.2 kb plus-strand RNA that contains a 7-methylguanine cap at the 5′-end, three open reading frames (ORFs) followed by a poly-adenylated 3’-end. ORF1 encodes the non-structural polyprotein, composed of seven distinct domains: Methyltransferase (Met), Y-domain, Papain-like cysteine protease (PCP), V-domain, macro-domain (X-domain), Helicase (Hel), and RNA-dependent RNA polymerase (RdRp). ORF2 encodes the capsid protein, responsible for viral capsid assembly. ORF3 encodes a phosphoprotein that acts as a viroporin and helps in viral egress9. An additional open reading frame, ORF4, is present in the g1-HEV, which is translated via a cap-independent mechanism, using an internal ribosome entry-site-like element located within the ORF1. ORF4 expression is enhanced by endoplasmic reticulum stress-inducing compounds. ORF4 has been proposed to promote g1-HEV replication complex assembly10.

Although HEV does not replicate efficiently in vitro, some strains of the virus, isolated from hepatitis E patients, were successfully propagated in hepatocytes, lung cell line, and colon epithelial cell line11. However, it is hard to propagate the virus robustly in the cultured cells. Infectious cDNA clone of g1-HEV (Sar55 strain) has been used for in vitro studies, but efficient production and propagation of g1-HEV strains in cultured cells have not been achieved so far. Some g3- and g4-HEV strains grow better in cultured cells12. Nevertheless, the purified virus yielded from cells transfected with the in vitro transcribed and capped-p6 HEV genomic RNA is not sufficient for multiple assays. On top of that, all cell culture-produced HEV particles are quasi-enveloped, which affects their infectivity. In contrast, HEV found in contaminated food and water is nonenveloped, and it is highly infectious. HEV present in patient feces is nonenveloped, and it is the common source of natural infection. Therefore, the use of HEV purified from the patient faeces ensures efficient infection in the mammalian cell culture system. Our earlier studies have shown the reliability of the patient faeces-purified g1-HEV in quantifying viral replication in human hepatoma cells (Huh7). Purified virus stored in -80 °C retains infectivity for several years, and it has been used in multiple independent studies to estimate viral replication10,13,14,15. This study designed an HEV-neutralization assay using purified g1-HEV obtained from a patient. The virus was purified, titered, characterized, and stored in aliquots in -80 °C for future use in neutralization assays. Because HEV is non-cytopathic, the traditional PRNT method is not useful for estimating the virus-neutralization potential of anti-HEV antibodies. There were several attempts to develop neutralization assays for HEV, including a flow cytometry-based neutralization assay, an antigen ELISA kit-based neutralization assay for detecting pORF2 secreted into cell supernatants, an in vitro ELISA-based binding assay, an RT-PCR-based assay, and a fluorescence-based neutralization assay16,17,18,19,20. An ELISA-based assay indirectly detects antibody binding to evaluate functional neutralization of the virus, but cannot measure real infection. The flow cytometry-based method usually measures the percentage of infected cells using a pseudovirus. RT-PCR-based neutralizing method is more complicated than FRNT; therefore, the chances of handling error are higher. On the other hand, the FRNT method described here is limited by the availability of high-titer infectious virus and imaging capabilities. Nevertheless, it is an efficient method to measure NT50 of anti-HEV antibodies.

Access restricted. Please log in or start a trial to view this content.

Protocol

Institutional ethics committee (IEC) approval was obtained to collect a fecal sample from an HEV-infected patient admitted to the Department of Gastroenterology, AIIMS, New Delhi. Informed consent was obtained from the patients participating in the study. The details of the reagents and the equipment used are listed in the Table of Materials.

1. Virus isolation and quantification

  1. With informed consent, obtain the fecal sample from an HEV-infected patient for purification of the virus.
  2. Resuspend the faecal sample in Dulbecco’s Phosphate buffered saline (DPBS) at 10% final concentration (w/v) and centrifuge at 7800 x g for 1h at 4 °C.
    ​NOTE: Use gloves when handling the HEV faecal sample, and clean the work area with 70% ethanol after work (perform all steps inside a Biosafety cabinet).
  3. Collect the supernatant and pass it through a 0.45 µm filter.
  4. Add 8% PEG6000 prepared in 0.4 M NaCl to the virus supernatant and incubate for 16 h at 0 °C.
  5. Centrifuge the sample at 18,000 x g for 30 min at 4 °C.
  6. Remove the supernatant and resuspend the pellet in 40 mL of Dulbecco’s Modified Eagle Medium (DMEM).
  7. Concentrate the suspension to 5 mL volume by tangential flow filtration (TFF) using a 30 kDa membrane cartridge. Filter it through a 0.2 µm filter inside the Biosafety cabinet, make aliquots, and store at -80 °C. Use one aliquot to isolate total RNA and perform RT-qPCR.
  8. Use multiple dilutions of pSK-HEV2 plasmid [pBluscript vector containing cDNA of an infectious clone of g1-HEV (Genbank ID: AF444002.1)] (1 ng to 0.000001 ng DNA/reaction at 10x serial dilution) to plot a standard for quantification of viral RNA.
  9. Plot the graph with the amount of pSK-HEV2 DNA on the X-axis and corresponding Ct values on the Y-axis. Extrapolate the concentration of viral RNA from the standard plot.
  10. Quantify the HEV genomic RNA level from the standard plot and calculate the genome copy number of the virus using the following formula: Number of copies = ng*(number/mole) / bases *(ng/g)*(g/mole of bases).

2. Infection of Huh7 cells with g1-HEV

  1. Take a T75 flask containing Huh7 cells. Check under the microscope if the cells are confluent and healthy.
  2. Remove media by aspirator (perform all steps in the biosafety cabinet). Add 10 mL DPBS, swirl, and remove.
  3. Add 1 mL 0.05% trypsin solution, ensuring that it is evenly spread on the surface.
  4. Incubate inside a CO2 incubator for 30–60 s, until cells are 90% detached.
  5. Add 5 mL of complete medium, spread it evenly over the entire surface of the T75, and pipette multiple times to make a uniform single-cell population, free of aggregates.
  6. Transfer the cell suspension to a 50 mL conical tube, centrifuge at 200 x g for 5 min at room temperature.
  7. Aspirate the culture medium from the conical tube inside the biosafety cabinet.
  8. Add 5 mL of complete medium to the tube, and suspend the cells to a uniform suspension by gentle pipetting.
  9. Take 10 µL of cell suspension and put it on a cell counter slide. Count the cells in 4 quadrants, calculate the average/mL.
  10. Seed 0.5 x 106 cells/well of a 6-well plate in 2 mL DMEM (supplemented with10% FBS).
  11. Next day, remove media, wash in 1 mL DPBS, and add 50 µL g1-HEV virus (equivalent to 4.5 × 104genome copies of the purified g1-HEV) in 1 mL serum-free media (SFM).
  12. Incubate the cells in a 5% CO2 incubator at 37 °C for 1 h.
  13. Wash the cells with 500 µL DPBS, then add 2 mL of complete media (DMEM supplemented with 2% FBS).
  14. Incubate the cells for 72 h in a 5% CO2 incubator at 37 °C.
  15. Proceed for downstream assays.

3. RT-qPCR assay

  1. Remove the growth media from the 6-well plate (from step 2.15) and wash the cells with 1 mL DPBS.
  2. Add 1 mL TRI Reagent directly to the 6-well plate to lyse the cells. Pipette the lysate up and down several times, then transfer to a 1.5 mL microcentrifuge tube.
    NOTE: TRI reagent is toxic if inhaled, swallowed, or if it comes into contact with the skin. Use protective gloves while using the reagent, and avoid breathing vapors. Preferably, use inside the chemical hood. All plasticware should be RNAse-free grade.
  3. Incubate the samples at room temperature for 5 min. Add 0.2 mL of chloroform, securely cap the tube, then vortex for 10–15 s (Chloroform is hazardous and toxic; handled with proper PPE). Incubate for 2–3 min.
  4. Centrifuge the samples for 15 min at 12,000 × g at 4 °C. Transfer the aqueous phase to a new 1.5 mL microcentrifuge tube. Add 0.5 mL of isopropanol to the aqueous phase, and mix well by inverting the tube a few times.
  5. Incubate for 10 min at room temperature.
  6. Centrifuge for 10 min at 12,000 × g at 4 °C. Discard the supernatant.
  7. Resuspend the pellet in 1 mL 75% ethanol. Centrifuge for 5 min at 7500 × g at 4 °C. Discard the supernatant.
  8. Air dry the RNA pellet for 5–10 min.
  9. Resuspend the pellet in 50 µL nuclease-free water (NFW), incubate at 55 °C for 10 min, mix by hand-tapping, and measure RNA concentration by spectrophotometry.
  10. Perform TaqMan probe-based one-step RT-qPCR using the following Primers:
    g1-HEV FP: 5′TATACTCGAGGGTGCCGATCGGTCCC3′;
    g1-HEV RP: 5′TATACCATGGCATCTGGCAGCAAGCTCAG3′;
    g1-HEV Probe: 5′[FAM] TTGACGCCTGGGAGCGGAATCACC [BHQ1]3′; Ribonuclease P (RP) FP: 5′AGATTTGGACCTGCGAGCG3′;
    RP RP: 5′GAGCGGCTGTCTCCACAAGT3′;
    ​RP Probe: 5′[FAM]TTCTGACCTGAAGGCTCTGCGCG[BHQ1]3′.
  11. Calculate relative quantification of g1-HEV RNA using the 2−ΔΔCT method.

4. Immunofluorescence assay (IFA)

  1. Split the Huh7 cells as described in earlier steps.
  2. Place the microscopy-grade glass coverslip in a 12-well plate and seed 0.2 × 106 cells/well in 1 mL complete media (DMEM supplemented with 10% FBS).
  3. Infect the cells with 1.8 × 104 genome copies of the purified g1-HEV in 500 µL SFM. Incubate the cells in a 5% CO2 incubator at 37 °C for 1 h.
  4. Wash the cells three times with 500 µL of DPBS.
  5. Add 2 mL of complete media (DMEM supplemented with 2% FBS).
  6. Incubate the cells for 72 h in 5% CO2 incubator, 37 °C.
  7. Wash the cells three times with 500 µL DPBS, incubating for 5 min at room temperature between each wash.
  8. Add 500 µL 4% PFA (Paraformaldehyde) to cells and incubate for 20 min at room temperature.
    ​NOTE: 4% PFA is harmful if inhaled, causes skin and eye irritation, and may cause an allergic skin reaction. For safety, wear protective gloves and eye protection while using the reagent and avoid breathing vapors.
  9. Wash the cells with 500 µL DPBS, three times for 5 min each, and incubate in DPBS for 30 min.
  10. Add 250 µL blocking solution (5% Normal Goat Serum, 0.5% BSA, 0.3% Triton X-100 in DPBS) to the cells and incubate for 1 h at room temperature (RT).
  11. Remove blocking solution, wash once with 500 µL DPBS, and incubate the cells with 250 µL primary antibody (DPBS, 0.3% Triton X-100, 5% BSA, 0.5% Normal Goat Serum, 1:500 dilution of anti-ORF2 antibody or rabbit IgG), overnight at 4 °C.
  12. Wash the cells with 500 µL of DPBS three times for 5 min each.
  13. Incubate the cells with secondary antibody (DPBS, 0.3% Triton X-100, 5% BSA, 0.5% Normal Goat Serum, 1:1000 dilution of goat anti-rabbit Alexa fluor 594 antibody) for 1 h at RT.
  14. Wash the cells three times with DPBS for 5 min each. Add 10 µL of Prolong gold antifade reagent with DAPI (4′,6-diamidino-2-phenylindole) solution to the glass slide. Mount the coverslip-containing cells, with the cells facing towards the DAPI solution on glass slides, avoiding air bubbles.
  15. Seal the coverslip with nail paint.
  16. Acquire fluorescent images in a confocal microscope with a 60x objective.
  17. Set the microscope for fluorescent signal visualization and acquisition.
  18. First, focus the nuclei in the slide corresponding to mock cells (uninfected) at 60x magnification. Adjust the threshold voltage and laser so that no background fluorescence signal is visible. Check the control antibody (rabbit IgG)-stained slide and verify that no background fluorescence signal is visible.
  19. Visualize slides of HEV-infected cells without altering the above parameters. Acquire images in 1028 x 1028 pixels.

5. Fluorescence Reduction Neutralization Test (FRNT)

  1. Virus neutralization and infection of Huh7 cells
    1. Split the Huh7 cells as described in earlier steps. Place the coverslip in a 12-well plate and seed 0.2 × 106 cells/well in 1 mL complete media (DMEM + 10% FBS).
    2. Next day, prepare a 10-fold serial dilution of antibodies (anti-ORF2 and rabbit IgG) in SFM with 25 µg/mL starting concentration of antibody in 1:10 steps up to 1:105 dilution. Final volume of the dilution should be 100 µL.
    3. Add 1.8 x 104 genomic copies equivalent of the purified g1-HEV to each antibody dilution.
    4. Incubate the antibody and virus mixture at 5% CO2 incubator, 37 °C for 1 h.
    5. Remove the 12-well plate containing Huh7 cells (seeded the previous day) and wash the cells with 500 µL DPBS.
    6. Add the antibody-virus mixture to the cells and place the plate in a 5% CO2 incubator at 37 °C for 1 h.
    7. Wash the cells with 500 µL DPBS.
    8. Add DMEM + 2% FBS media to cells and incubate the plate in a 5% CO2 incubator at 37 °C for 72 h.
    9. Perform IFA as mentioned in section 4 (step 4.7 onwards).
    10. Acquire fluorescent images of 5 random fields using a 10x objective in 1028 x 1028 pixels.
    11. Save the images in JPEG/TIFF format. Quantify the fluorescent spots using ImageJ analysis as described below.
    12. To analyze the image in ImageJ, convert the RGB image to an 8-bit image. Click on image > type > 8-bit.
    13. Adjust the threshold of the image. Click on Image > Adjust > Threshold. Select the lower threshold level to be 40 and the upper threshold level to be 255.
    14. For counting, select Analyze> Analyze Particles. Select display results, clear results, summarize, exclude on edges, and composite ROIs. Deselect Add to manager, include holes, and overlay. Press Ok and the fluorescent spot count will appear.
  2. Estimation of NT50
    1. Calculate % neutralization of each dilution using the following formula:
      % Neutralization= 100-[((ORF2-Positive cells in dilution)⁄(ORF2-positive cells in virus control))  X 100]
    2. Calculate NT50 using the following formula:
      log10(NT50) = log10D1+(50-N1 ⁄ N2-N1) X (log10D2-log10D1)
      Where, D1 = Dilution at which % Neutralization is below 50
      D2 = Dilution at which % Neutralization is above 50
      N1= % Neutralization below 50
      N2= % Neutralization above 50
    3. Calculate antilog of Log10 NT50 using formula:
      NT50= 10log10(NT50)
    4. Plot the graph of (mean±SD) of all fields.

Access restricted. Please log in or start a trial to view this content.

Results

Infection of Huh7 cells with g1-HEV and virus characterization

The g1-HEV was isolated from a faecal sample using a series of steps, as illustrated (Figure 1A). Genome copy number of the purified g1-HEV was estimated by RT-qPCR, followed by storage at -80 °C. To confirm viral infection and replication, Huh7 cells were infected with 1.8 × 104 genome copy equivalents of the purified g1-HEV stock for 72 h, followed by RT-qPCR and IFA. Sign...

Access restricted. Please log in or start a trial to view this content.

Discussion

FRNT is an immunostaining-based method for estimating the neutralizing potential of antibodies. It has been used to estimate NT50 values for antibodies against multiple viruses, including Dengue virus (DENV), Severe Acute Respiratory Syndrome Coronavirus-2 (SARS-CoV-2), and Japanese encephalitis virus (JEV)23,24,25. In this method, the virus is incubated with a test antibody (or sera), followed by infection of culture...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors declare no competing interests.

Acknowledgements

This research was partially funded by a grant from the Biotechnology Industry Research Assistance Council, Department of Biotechnology, Government of India, awarded to MS, S, and BN. Research in the MS laboratory is supported by a core grant from the Translational Health Science and Technology Institute. SA is supported by a Project Research Scientist position funded by the Indian Council of Medical Research, Government of India. UB is supported by a Senior Research Fellowship from the Department of Biotechnology, Government of India.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
1.5 mL microfuge tubesAxygenMCT-150-C
12-well cell culture dishCorning3512
37 degree incubator shakerThermo Scientific50163013
4′,6-diamidino-2-phenylindoleAbcamAB104139DAPI
50mL centrifuge tubeFalcon352070
6-well cell culture dishCorning 3516
Alexa flour 594 secondary IgG AntibodyThermo ScientificA-11012
Anti-ORF2 antibodyGenscriptNACustom synthesized by Genscript and characterized in our laboratory14
Anti-rabbit IgG antibodyGenscriptNA
Bovine Serum AlbuminHIMEDIAMB083BSA
Confocal microscopeOlympusFV3000
DMEM, high glucoseHIMEDIAAL007A
Fetal Bovine SerumGIBCO16000-044FBS
ImageJ 1.54gImageJ.org (Wayne Rasband and contributors, NIH, USA)
Normal Goat SerumHIMEDIARM-10701
ParaformaldehydeHIMEDIAGRN3660PFA
Phosphate Buffer Saline pH 7.4HIMEDIATL1006PBS
Polyethyleneglycol 6000SIGMA81255PEG6000
SOLIScript 1-step Probe KitSOLIS BIODYNE08-57-00250
TRI reagentMolecular Research CentreTR118
Triton X100SIGMAX100
Trypsin-EDTAGIBCO25300-54

References

  1. Smith, D. B., et al. International Committee on Taxonomy of Viruses Hepeviridae Study Group. Consensus proposals for classification of the family Hepeviridae. J Gen Virol. 95 (Pt 10), 2223-2232 (2014).
  2. Nan, Y., Zhang, Y. J. Molecular biology and infection of hepatitis E virus. Front Microbiol. 7, 1419(2016).
  3. Kamar, N., et al. Hepatitis E virus and chronic hepatitis in organ-transplant recipients. N Engl J Med. 358 (8), 811-817 (2008).
  4. Purcell, R. H., Emerson, S. U. Hepatitis E: An emerging awareness of an old disease. J Hepatol. 48 (3), 494-503 (2008).
  5. Nimgaonkar, I., Ding, Q., Schwartz, R. E., Ploss, A. Hepatitis E virus: Advances and challenges. Nat Rev Gastroenterol Hepatol. 15 (2), 96-110 (2018).
  6. Hepatitis E. , WHO. Available from: https://www.who.int/news-room/fact-sheets/detail/hepatitis-e (2025).
  7. Songtanin, B., et al. Hepatitis E virus infections: Epidemiology, genetic diversity, and clinical considerations. Viruses. 15 (6), 1389(2023).
  8. Lee, G. H., et al. Chronic infection with camelid hepatitis E virus in a liver transplant recipient who regularly consumes camel meat and milk. Gastroenterology. 150 (2), 355-357 (2016).
  9. Zhou, Z., Xie, Y., Wu, C., Nan, Y. The hepatitis E virus open reading frame 2 protein: Beyond viral capsid. Front Microbiol. 12, 739124(2021).
  10. Nair, V. P., et al. Endoplasmic reticulum stress induced synthesis of a novel viral factor mediates efficient replication of genotype-1 hepatitis E virus. PLoS Pathog. 12 (4), e1005521(2016).
  11. Meister, T. L., et al. Cell culture systems for the study of hepatitis E virus. Antiviral Res. 163, 34-49 (2019).
  12. Fu, R. M., Decker, C. C., Dao Thi, V. L. Cell culture models for hepatitis E virus. Viruses. 11 (7), 608(2019).
  13. Kaushik, N., et al. Zinc salts block hepatitis E virus replication by inhibiting the activity of viral RNA-dependent RNA polymerase. J Virol. 91 (21), 10-1128 (2017).
  14. Gupta, J., et al. Antiviral activity of zinc oxide nanoparticles and tetrapods against the Hepatitis E and Hepatitis C viruses. Front Microbiol. 13, 881595(2022).
  15. Ansari, S., et al. Network controllability analysis reveals the antiviral potential of Etravirine against hepatitis E virus infection. mSystems. 10 (9), e00438-25(2025).
  16. Gremmel, N., et al. Hepatitis E virus neutralization by porcine serum antibodies. J Clin Microbiol. 61 (11), e00373-23(2023).
  17. Cai, W., et al. A high-throughput neutralizing assay for antibodies and sera against hepatitis E virus. Sci Rep. 6 (1), 25141(2016).
  18. Liu, C., et al. An optimized high-throughput neutralization assay for hepatitis E virus (HEV) involving detection of secreted Porf2. Viruses. 11 (1), 64(2019).
  19. Meng, J., Dubreuil, P., Pillot, J. A new PCR-based seroneutralization assay in cell culture for diagnosis of hepatitis E. J Clin Microbiol. 35 (6), 1373-1377 (1997).
  20. Emerson, S. U., et al. Putative neutralization epitopes and broad cross-genotype neutralization of Hepatitis E virus confirmed by a quantitative cell-culture assay. J Gen Virol. 87 (3), 697-704 (2006).
  21. Deshmukh, T. M., et al. Immunogenicity of candidate hepatitis E virus DNA vaccine expressing complete and truncated ORF2 in mice. Vaccine. 25 (22), 4350-4360 (2007).
  22. Gupta, J., et al. Expression, purification and characterization of the hepatitis E virus like-particles in the Pichia pastoris. Front Microbiol. 11, 141(2020).
  23. Guo, J., et al. Fluorescence Reduction Neutralization Test: A novel, rapid, and efficient method for characterizing the neutralizing activity of antibodies against dengue virus. Curr Issues Mol Biol. 47 (3), 140(2025).
  24. Bewley, K. R., et al. Quantification of SARS-CoV-2 neutralizing antibody by wild-type plaque reduction neutralization, microneutralization and pseudotyped virus neutralization assays. Nat Protoc. 16 (6), 3114-3140 (2021).
  25. Islam, M. D., et al. Neutralizing antibodies against the Japanese encephalitis virus are produced by a 12ákDa E coli expressed envelope protein domain III (EDIII) tagged with a solubility-controlling peptide. Vaccine. 56, 127143(2025).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Neutralization AssayVirus NeutralizationAntibody EfficacyVaccine EvaluationImmunofluorescent StainingORF2 ProteinHuh7 Cells