A Two-Dimensional Organoid Culture on Invasin or Basement Membrane Extract to Study Host-Bacteria Interactions

Summary

The study presents a method for in vitro investigation of bacterial infection using tissue stem cell-derived intestinal organoids. The protocol describes how to culture and differentiate organoids in two dimensions, infect them with adherent-invasive Escherichia coli, and assess key readouts, including epithelial barrier breach, infection imaging, and epithelial RNA response.

Abstract

Organoid technology provides an experimental in vitro platform for studying human physiology in health and disease. Compared with other in vitro systems, such as cancer-derived cell lines or explants, tissue stem cell (TSC)-derived organoids offer key advantages: they can be expanded indefinitely while maintaining genomic stability and are amenable to CRISPR modification. Since these organoids are generated from normal TSCs, they contain the cell types of their tissue of origin. This makes organoids particularly valuable for investigating interactions between bacteria and differentiated, non-tumoral human cells. Intestinal organoids are grown as two-dimensional polarized monolayers on cell culture inserts coated with Basement Membrane Extract (BME) or invasin, an animal-free, cost-effective alternative, and can be differentiated into major intestinal epithelial cell types for infection with pathogenic adherent-invasive E. coli. Key infection readouts include monitoring epithelial gene expression by Reverse Transcription quantitative PCR (RT-qPCR), visualizing bacteria-epithelium interactions by confocal microscopy, and quantifying epithelial barrier breaching. The protocol can be readily adapted to study other organs and bacterial species, providing a versatile platform for investigating host-microbe interactions in organoids.

Introduction

The intestinal epithelium forms the first line of defense against pathogenic bacteria present in the gut lumen. In vitro models of the intestinal epithelium have been widely used to study how bacteria interact with epithelial cells, how these cells respond to infection, and how bacteria breach the epithelial barrier¹. These models are particularly valuable for investigating human-specific pathogens in a controlled, reductionist setting. Historically, in vitro infection biology has relied on tumor-derived cell lines e.g., Caco-2 cells, or on patient-derived explants maintained ex vivo^2,3. More recently, intestinal organoids generated from human tissue stem cells have emerged as a powerful tool that combines the advantages of both approaches: like cell lines, organoids can be passaged, expanded, cryopreserved, thawed, and genetically manipulated; and like explants, they are derived from non-tumoral stem cells capable of differentiating into all major epithelial cell types^4,5.

When embedded in a matrix such as Matrigel or Basement Membrane Extract (BME), human intestinal organoids typically self-organize into spherical, polarized structures with an apical surface facing inward and a basal surface facing outward. Because most intestinal pathogens access epithelial cells from the apical side, several strategies have been developed to expose this surface to bacteria in organoids⁴. One approach is micro-injecting bacteria directly into the organoid lumen⁶. Another involves reversing the polarity of organoids by releasing them from the extracellular matrix, producing "apical-out" organoids in suspension⁷. A third strategy is to dissociate organoids into single cells and seed them onto cell culture insert inserts to form polarized, two-dimensional monolayers (2D organoid sheets) with the apical side facing the upper compartment⁸. The first two methods have important limitations: micro-injection is time-consuming and labor-intensive, limiting throughput, and apical-out organoids survive only a few days without matrix support and cannot be differentiated¹. In contrast, 2D organoid sheets support high-throughput experimentation (bacteria can simply be added to the upper compartment) and can be maintained for multiple weeks while differentiating into major intestinal epithelial cell types⁹.

Unlike immortalized cell lines that readily attach to plastic surfaces, organoid-derived cells require plate coating for efficient adhesion. Coating can be performed using diluted BME¹⁰, or alternatively using invasin, a bacterial protein that binds integrins on organoid cells¹¹. Invasin is easy to produce in the laboratory, substantially more cost-effective than BME or Matrigel, and fully animal-free.

This protocol describes the establishment and differentiation of intestinal organoids as two-dimensional polarized monolayers on cell culture insert inserts coated with invasin or Basement Membrane Extract (BME). The differentiated organoid sheets are subsequently infected with Adherent-invasive Escherichia coli (AIEC), a pathogenic strain associated with inflammatory bowel disease¹². Multiple downstream infection readouts are outlined to evaluate epithelial responses and bacterial translocation. Given that AIEC invades epithelial cells and breaches the intestinal epithelium -- a mechanism thought to contribute to its pathogenicity -- epithelial breaching is quantified by measuring bacteria that reach the basolateral chamber of the cell culture insert following confirmation of barrier integrity by transepithelial/transendothelial electrical resistance (TEER) measurement¹³. Procedures are also provided for fixing and imaging infected monolayers to visualize intra- and extracellular AIEC, as well as for RNA extraction to assess epithelial transcriptional responses to infection. The complete protocol can be performed in less than two weeks and requires only commonly available laboratory equipment, including a BSL-2 cabinet, a confocal microscope, and a quantitative PCR instrument.

Overall, this protocol provides a cost-efficient, versatile, and accessible method for studying bacterial infection of differentiated human intestinal epithelium in vitro. It can be readily adapted to other organoid systems and other microbial species, making it a useful blueprint for in vitro infection biology studies.

Protocol

The human intestinal organoids were generated from the waste material of patients undergoing colorectal cancer surgery at the University Medical Centre Utrecht (UMCU). Patients provided informed consent for the generation of their organoids, in accordance with protocol UPORT Cancer Biobank 21-042, approved by the local ethics committee for biobanking. Figure 1A illustrates the 8 sections of the protocol . The reagent and equipment details are listed in Table of Materials.

1. Coating of the cell culture insert

1. Coating with invasin
   1. Perform all procedures inside a tissue culture hood under sterile conditions.
   2. Prepare a 5 µg/mL solution of invasin in sterile phosphate-buffered saline (PBS).
   3. Add 100 µL of this solution to the upper compartment of each 3 µm pore polyester cell culture insert placed in a 24-well plate.
   4. Ensure that the membrane is completely covered.
   5. Incubate overnight at 4 °C.
      NOTE: Avoid generating bubbles during dispensing, as bubbles prevent uniform coating.
2. Coating with Basement Membrane Extract (Alternative)
   1. Thaw Basement Membrane Extract on ice.
   2. Prepare a 10% solution in ice-cold DMEM.
      NOTE: Keep the solution cold to prevent premature polymerization.
   3. Add 100 µL of the diluted solution to the upper compartment of each 3 µm pore cell culture insert.
   4. Ensure complete coverage of the membrane surface.
   5. Incubate for 1 h at room temperature.

2. Seeding of organoid cells

1. Preparing organoids
   1. Remove culture medium from organoid plates maintained in expansion conditions (3-5 days post-splitting).
   2. Resuspend organoids in 1 mL of ice-cold DMEM¹⁴.
   3. Transfer the suspension to a 15 mL conical tube containing 4 mL of ice-cold DMEM.
      NOTE: Use approximately 1 full well from a 12-well plate to seed 4 cell culture inserts.
2. Pelleting organoids
   1. Centrifuge for 5 min at 500 × g at 4 °C.
   2. Remove the supernatant completely.
3. Dissociating organoids
   1. Resuspend the pellet in 3 mL of recombinant trypsin substitute.
   2. Pipette up and down using a P1000 pipette to mechanically disrupt the organoids.
   3. Incubate at 37 °C for 15-20 min until single cells or small clusters (3-4 cells) are obtained.
      NOTE: Do not exceed 20 min incubation. Pipette every 5 min to facilitate dissociation. Insert a P10 tip inside a P1000 tip if further mechanical force is required.
4. Washing cells
   1. Add 5 mL of ice-cold DMEM.
   2. Centrifuge for 5 min at 500 × g at 4 °C.
   3. Remove the supernatant.
5. Prepare Cell Suspension
   1. Resuspend cells in Expansion medium (100 µL per cell culture insert; see Table 1 for Expansion medium's composition).
      NOTE: Do not include antibiotics. Include Rho kinase inhibitor to prevent anoikis.
   2. Count cells using a cell counter or hemocytometer.
   3. Adjust to approximately 2 × 10⁶ cells/mL.
6. Seeding the cell culture inserts
   1. Remove the coating solution from the inserts.
   2. Add 100 µL of cell suspension (2 × 10⁵ cells) to the upper compartment.
   3. Add 500 µL of Expansion medium to the lower compartment.

3. Cell culture insert culture and differentiation

1. Incubate at 37 °C with 5% CO₂ until confluency is reached (approximately 3 days).
   NOTE: Refresh medium in both compartments every 4-5 days if required.
2. Once confluent, wash both compartments with pre-warmed DMEM.
3. Add 500 µL Differentiation medium (Table 2) to the lower compartment.
4. Add 100 µL Advanced DMEM/F12 supplemented with HEPES and Glutamax (AdvDMEM++) (Table 3) to the upper compartment.
5. Incubate for 5 days at 37 °C with 5% CO₂.
6. Replace media in both compartments every 2 days.

4. Measuring transepithelial/transendothelial electrical resistance (TEER)

1. Sterilize TEER electrodes in 70% ethanol for 15 min.
2. Rinse electrodes in sterile PBS.
3. Insert the short electrode into the upper compartment and the long electrode into the lower compartment.
   NOTE: Do not touch the monolayer with the electrode tip.
4. Record resistance values.
5. Measure blank resistance using a cell-free insert containing PBS (100 µL upper, 500 µL lower).
6. Calculate TEER: TEER = (R_cell culture insert − R_blank) × surface area (cm²)
   NOTE: For 24-well inserts, surface area = 0.33 cm².

5. Infection with AIEC

1. Prepare Bacterial Culture
   1. Inoculate fluorescent AIEC in 3 mL LB medium¹⁵.
   2. Incubate overnight at 37 °C with shaking.
      CAUTION: Perform all bacterial procedures in a BSL-2 hood.
2. Prepare Inoculum
   1. Centrifuge 500 µL culture for 5 min at 1500 × g.
   2. Resuspend in 1 mL AdvDMEM++.
   3. Measure optical density (OD).
   4. Dilute to approximately 1 × 10⁸ CFU/mL in AdvDMEM++.
      NOTE: OD = 1 corresponds to approximately 1 × 10⁹ CFU/mL.
3. Infecting the monolayers
   1. Replace media in both compartments.
   2. Add 500 µL Differentiation medium to the lower compartment.
   3. Add 100 µL bacterial suspension to the upper compartment for the infected condition.
   4. Add 100 µL AdvDMEM++ to the upper compartment for the non-infected condition.
   5. Incubate at 37 °C, 5% CO₂.

6. Assessing epithelium breaching

1. At 2.5 h post-infection, collect 100 µL from the lower compartment.
2. Dilute in PBS and plate on LB agar.
3. Add 100 µL fresh Differentiation medium to the lower compartment.
4. Incubate plates overnight at 37 °C.
5. Repeat sampling at 5 h post-infection.
6. Count Colony-Forming Unit (CFU) the following day.
7. Calculate CFUs per cell culture insert: CFUs/cell culture insert = colonies × 5 × dilution factor

7. Image Infection

1. At 5 h post-infection, remove media and fix with 4% paraformaldehyde.
   CAUTION: Paraformaldehyde is toxic and volatile. Handle inside a fume hood while wearing gloves.
2. Fix for 30 min.
3. Wash three times with PBS.
4. Excise the membrane insert and place cells facing upward in a well plate.
5. Stain with fluorescent phalloidin for 1-2 h.
6. Wash three times with PBS.
7. Stain nuclei with DAPI for 10 min.
8. Wash three times with PBS.
9. Mount on a glass slide with mounting medium and apply a coverslip.
10. Seal with nail polish.
11. Acquire confocal images of DAPI, actin, and bacteria channels.
12. Acquire a z-stack spanning basal to apical surfaces with 1 µm intervals.
13. Open images in Fiji.
14. Select Image → Z Project → Average Intensity.
15. Select Image → Stacks → Orthogonal Views to visualize cross-sections.

8. Analyzing epithelial response

1. At 5 h post-infection, remove media.
2. Add 350 µL lysis buffer to the upper compartment.
3. Pipette to lyse cells and transfer to an RNase-free tube on ice.
4. Perform RNA extraction according to kit instructions.
5. Measure RNA concentration and normalize samples.
6. Perform reverse transcription.
7. Perform quantitative PCR following the manufacturer's instructions (primer sequences for TNFα and the reference gene β-actin are provided in Table 4).

Results

After reaching confluency, intestinal cells on the cell culture insert displayed a mosaic-like pattern (Figure 1B) without visible gaps in the monolayer. Following differentiation, epithelial tightness was assessed by measuring transepithelial electrical resistance (TEER) (Figure 1C). TEER values above 500 Ω·cm² were consistent with the formation of a tight epithelial monolayer¹⁶.

The quantity of AIEC detected in the basolateral compartment increased over time, reflecting bacterial breaching of the epithelial barrier (Figure 2A,B). Absence of AIEC in the lower compartment would indicate failure of bacterial translocation.

The workflow for visualizing infection is summarized in Figure 3A. Confocal imaging demonstrated the formation of a polarized monolayer, with nuclei localized basally and an apical enrichment of the actin network (Figure 3B). Higher magnification revealed both intracellular AIEC and extracellular bacteria attached to the apical membrane (Figure 3C).

RT-qPCR analysis showed upregulation of TNFα expression in response to AIEC infection (Figure 4A,B), confirming activation of an epithelial inflammatory response.

Figure 1: Overview of the protocol. (A) Schematics of the protocol. (B) Bright field image of intestinal organoid cells cultured and differentiated on an invasin-coated cell culture insert. Scale bar: 50 µm. (C) Transepithelial/transendothelial electrical resistance (TEER) of intestinal organoids grown and differentiated on invasin-coated cell culture inserts. Each dot shows an independent experiment. Please click here to view a larger version of this figure.

Figure 2: Assessing epithelium breaching (A) Schematics of the protocol. (B) Quantification of Colony-Forming Units (CFUs) of AIEC over time in the bottom compartment of the cell culture insert. Please click here to view a larger version of this figure.

Figure 3: Imaging infection. (A) Schematics of the protocol. (B) Confocal imaging of intestinal organoids infected with fluorescent AIEC for 5 h. Grey: DAPI. Magenta: phalloidin. Cyan: AIEC. Scale bar: 50 µm. Orthogonal views of the merged image are displayed on the top and on the right. (C) High magnification of the white square in B. Grey: DAPI. Magenta: phalloidin. Cyan: AIEC. Scale bar: 10 µm. Orthogonal views are displayed on the right. Intracellular AIEC (*) and extracellular AIEC attached to the apical membrane of epithelial cells ($) are highlighted. Please click here to view a larger version of this figure.

Figure 4: Analyzing epithelial response. (A) Schematics of the protocol. (B) Expression of TNFα by intestinal organoids after 5 h of infection with AIEC (green) versus non-infected control (grey). TNFα expression was normalized to B-actin expression using the formula 2-(Cq(TNFα)-Cq(β-actin)). n=4 replicates. Statistical analysis was performed using an unpaired Student's t-test. ***P < 0.001. Please click here to view a larger version of this figure.

Component	Concentration
Adv DMEM	1X final
HEPES	1% v/v
Glutamax	1% v/v
Wnt surrogate	0.5 nM
R-spo1 UPE	2% v/v
Noggin UPE	1% v/v
B27 without vitamin A	2% v/v
N-acetyl cysteine	1.25 mM
Nicotinamide	10 µM
hEGF	50 ng/mL
A83-01 (TGF-β inhibitor)	0.5 µM
SB202190 (p38 inhibitor)	3 µM
Prostaglandin E2	1 µM
Rho kinase inhibitor	10 µM

Table 1: Expansion medium for human intestinal organoids. Composition of the Expansion medium used for maintenance and proliferation of human intestinal organoids.

Component	Concentration
Adv DMEM	1X final
HEPES	1% v/v
Glutamax	1% v/v
R-spo1 UPE	2% v/v
Noggin UPE	1% v/v
B27 without vitamin A	2% v/v
NAC	1.25 mM
hEGF	50 ng/mL

Table 2: Differentiation medium for human intestinal organoids. Composition of the Differentiation medium used to promote epithelial maturation of human intestinal organoid monolayers.

Component	Concentration
Adv DMEM	1X final
HEPES	1% v/v
Glutamax	1% v/v

Table 3: Adv DMEM++ for infection. Composition of Advanced DMEM/F12 medium supplemented with HEPES and Glutamax (Adv DMEM++) used during bacterial infection assays.

Name	Sequence
TNFα F	CTCTTCTGCCTGCTGCACTTTG
TNFα R	ATGGGCTACAGGCTTGTCACTC
β-actin F	TGACGTTGACATCCGTAAAG
β-actin R	GAGGAGCAATGATCTTGATCT

Table 4: Primers for qPCR of TNFα. Shows the primer sequences used for quantitative PCR analysis of TNFα using β-actin as a reference gene.

Discussion

This study established a protocol to investigate bacterial infection of human intestinal epithelial cells using TSC-derived organoids cultured on cell culture insert inserts. Inserts with 3 µm pores enabled efficient cell attachment and bacterial translocation, whereas 0.4 µm pores do not permit AIEC passage, consistent with the approximate 1 µm size of E. coli. No translocation of organoid cells through 3 µm pores was observed, likely due to their epithelial and non-invasive phenotype.

Several experimental variables were critical for reproducibility, including efficient cell attachment, appropriate seeding density, and complete confluency prior to infection. Organoid-derived epithelial cells do not adhere to uncoated plastic, making coating essential. BME provided consistently high attachment efficiency. Invasin coating yielded comparable results and represents a cost-effective alternative¹¹, although it must be produced in-house. Collagen coating has also been proposed as an alternative¹⁷.

Bacterial growth conditions strongly influence infection efficiency. E. coli strains grow well in DMEM; however, residual antibiotics can inhibit proliferation. Under optimal conditions, infected cultures usually display increased turbidity compared to controls, and bacterial growth can be confirmed by plating apical compartment contents.

The imaging strategy enabled visualization of both intra- and extracellular bacteria by targeting AIEC expressing a fluorophore under a constitutive promoter (e.g., using the plasmid pMB1-spect-PthrC-eGFP). Alternative methods enable selective detection of intracellular bacteria, including differential immunofluorescence staining¹⁸ or reporters expressed at defined stages of invasion¹⁹. Gentamicin protection assays provide an additional quantitative approach²⁰.

This model is intentionally reductionist and focuses on direct interactions between bacteria and the intestinal epithelium. It enables the investigation of infection in a differentiated epithelial monolayer without additional in vivo cell types. The differentiation medium predominantly induced enterocyte and goblet cell differentiation²¹ but can be modified to alter epithelial composition^22,23. System complexity can be increased by co-culturing immune or stromal cells in the basal compartment²⁴.

The system does not recapitulate the three-dimensional architecture of the intestinal mucosa. Organ-on-chip platforms overcome some structural limitations²⁵ but require greater technical complexity and resources. Furthermore, the model is best suited for acute infections, as bacterial overgrowth limits experiments to approximately 8 h. More complex systems, such as microfluidic platforms enabling continuous medium exchange, are required to study chronic infections in vitro²⁶.

Similar cell culture insert-based organoid infection systems have been applied across multiple tissues and pathogens, including stomach organoids infected with Helicobacter pylori^27,28, intestinal organoids infected with Shigella²⁹, airway organoids infected with Pseudomonas aeruginosa¹⁰, and urothelial organoids infected with Enterococcus faecalis³⁰. This protocol, therefore, provides a versatile framework for investigating epithelial-bacterial interactions across organ systems, provided that pathogen-specific growth requirements are considered.

Organoid technology provides physiologically relevant human models to investigate host-pathogen interactions in non-transformed epithelial cells^4,5. Given the increasing burden of antibiotic-resistant infections and their association with chronic inflammatory diseases and cancer, such in vitro systems represent valuable tools for mechanistic and translational research.

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
A83-01 (TGF-β inhibitor)	Tocris	2939
Adherent-invasive Escherichia coli LF82	kind gift of Nicolas Barnich
Advanced DMEM/F12	Invitrogen	12634-010
B27 without vitamin A	Invitrogen	12587010
cDNA kit	Applied Biosystems	4387406	The manual is available here: https://documents.thermofisher.com/TFS-Assets/LSG/manuals/MAN 0017977_highcap_cDNA_RT_UG.pdf
Cell counter	DeNovix	H2796
Cell counter	Leica	Stellaris
Coverslips 24 mm x 50 mm	Menzel-Gläzer	BB024050S1
Cultrex Basement Membrane Extract (BME)	R&D Systems, Bio-Techne	3533-001-02
DAPI	Sigma-Aldrich	10236276001
Disposable Scalpel Sterile N° 10	Swann Morton	3033838
DMEM	Gibco	11965092
Fiji	Fiji		Fiji is open access and can be downloaded here: https://imagej.net/software/fiji/downloads
Glutamax	Gibco	35050-061
hEGF	Peprotech	AF-100-15
HEPES	Gibco	15630-080
Invasin	custom-made according to Wijnakker et al. PNAS 2024
LB	Thermofisher	CM0996
LB Agar	Thermofisher	CM1116
Malassez chamber	KOVA	87144E
Microscope slides	Skycraft	18901
Milli cell Voltohmmeter (TEER measurement)	Merck	MERS00002
mounting medium	Vectors Laboratories	Vectashield H-1000-10
N-Acetyl Cystein	Sigma-Aldrich	A9165
Nicotinamide	Sigma-Aldrich	N0636
Noggin UPE	IPA Therapeutics	N002
ParaFormaldehyde solution 4%	Sigma-Aldrich	1.00496
Phalloidin 647	Sigma-Aldrich	65906-10NMOL
plasmid pMB1-spect-PthrC-eGFP	Addgene	107408
Prostaglandine E2	Tocris	2296
qPCR machine	Biorad	C1000-Touch
Rho kinase inhibitor	AbMole	M1817
RNA extraction kit	Qiagen	74534	The manual is available here: https://www.qiagen.com/us/resources/resourcedetail?id=bf60203 f-291d-48ae-8206-86b0696b28c0& lang=en
R-spo3 UPE	IPA Therapeutics	R001
SB202190 (p38 inhibitor)	Sigma-Aldrich	S7076
Spectinomycin	Sigma-Aldrich	S9007
Suspension plate for organoid culture	Greiner	665102
SYBR green	Biorad	170-8887	the manual is available here: https://www.bio-rad.com/webroot/web/pdf/lsr/literature/4106212.pdf
Thermocycler	Biorad	T100
Cell culture insert	Transwells 24w 3 µm pores, Greiner	662631
Triton X-100	Sigma-Aldrich	T8787
TrypLE	Gibco, Thermo Fisher Scientific	12605-010
Wnt surrogate	U-Protein Express	custom order	https://www.life-sciences-europe.com/organisation/protein-express-immunoprecise-group-utrecht-netherlands-west-europe-2001-30404.html