A Standardized Protocol for Inducing Stress-Induced Premature Senescence in Primary Human Melanocytes Using Tert-butyl Hydroperoxide

Summary

A standardized protocol for inducing premature senescence in HNM using tBHP, standardized protocols for analyzing key senescence markers, including growth arrest, SA-β-galactosidase activity, and SASP factors.

Abstract

Environmental stressors, including UV radiation, air pollution, or cigarette smoke, drive extrinsic skin aging. Exposure to these extrinsic aging factors promotes the accumulation of senescent cells, which contributes to the formation of wrinkles and pigmentation disorders. Melanocytes, which provide primary UV protection, exhibit reduced activity with age. Senescent melanocytes accumulate in aged skin and contribute to its aging appearance; However, there are few models to study melanocyte senescence, and this work aims to develop a reproducible model for further research. In this study, we present a senescence model of human neonatal melanocytes (HNM) using tert-butyl hydroperoxide (tBHP), a well-characterized oxidative stress inducer. tBHP disrupts redox homeostasis by depleting cellular antioxidant defenses and promoting radical overproduction, resulting in DNA and protein damage. We characterize the senescence phenotype of tBHP-treated melanocytes through the analysis of established senescence markers, including restricted growth potential, morphological changes, and SA-β-Galactosidase activity. This model provides a valuable tool for investigating stress-induced premature senescence in melanocytes, offering insight into their role in extrinsic skin aging and pigmentation disorders.

Introduction

Skin aging is composed of two distinct factors: intrinsic and extrinsic aging^1,2. Intrinsic aging is caused by natural chronological processes and genetic factors, while extrinsic aging results from cumulative exposure to environmental stressors, primarily ultraviolet radiation, but also air pollution, cigarette smoke, and chemical agents, which accelerate the aging process beyond normal chronological rates^3,4. Environmental exposures generate oxidative stress that overwhelms cellular antioxidant defenses, resulting in DNA damage, protein oxidation, and lipid peroxidation. These molecular alterations trigger persistent DNA damage responses and cellular dysfunction, ultimately promoting premature senescence^5,6. This stress-induced senescence contributes to the clinical features of aged skin, including wrinkles, uneven pigmentation, reduced elasticity, and impaired barrier function⁷.

Melanocytes reside within the basal epidermis and serve as the skin’s primary defense against UV-induced damage by synthesizing melanin and transferring it to surrounding keratinocytes. Paradoxically, this protective role makes them particularly vulnerable to oxidative stress and premature senescence during extrinsic aging^8,9. The melanogenesis process itself generates substantial reactive oxygen species as by-products of tyrosinase-catalized reactions, creating an inherent oxidative burden that is further amplified by environmental exposures such as UV radiation and pollution^10,11. As a result, chronic environmental stress can induce oxidative damage, mitochondrial dysfunction, and ultimately cellular senescence¹². Despite their importance, key questions remain about the molecular pathways governing melanocyte senescence and how oxidative stress initiates this process. Moreover, the influence of senescent melanocytes on the surrounding skin microenvironment as a driver of age-related skin changes, particularly through the release of SASP factors, remains insufficiently understood^13,14.

Although melanocytes are particularly susceptible to oxidative stress–induced senescence, experimental models to study this process remain limited^15,16. Most senescence research continues to rely on replicative or stress-induced senescence models in fibroblasts, but these approaches do not capture the distinct biology of melanocytes or their potential to influence skin aging through cross-talk with neighboring cells and their own SASP profile¹⁷. This gap highlights the need for melanocyte-specific senescence models that more accurately reflect their physiological responses to environmental stressors^18,19 and their contribution to human skin aging.

Despite the availability of stress-induced senescence approaches, their implementation in primary human melanocytes remains technically challenging and is often associated with substantial variability. Melanocytes are particularly sensitive to oxidative stress, resulting in a narrow experimental window between effective senescence induction and excessive cytotoxicity. In addition, donor-dependent differences in primary cell preparations further contribute to inconsistent outcomes across studies. These challenges are frequently underreported, and protocols are often insufficiently standardized, limiting reproducibility. The present protocol addresses this gap by providing an optimized and reproducible treatment regimen, defined dosing schedule, and standardized readouts for reliable induction and assessment of senescence in primary human melanocytes.

Tert-butyl hydroperoxide (tBHP) is a well-characterized inducer of oxidative stress that promotes senescence by generating reactive oxygen species and depleting cellular antioxidant defenses. It has been widely used to induce senescence in dermal fibroblasts, where it triggers hallmark senescence markers while maintaining cell viability^20,21. Because tBHP produces sustained oxidative stress through defined biochemical pathways, it offers a reproducible and accessible system for studying oxidative stress–induced senescence and investigating the molecular mechanisms linking oxidative damage to aging processes^22,23. In contrast to UV-based models, tBHP is particularly advantageous when a controlled, reproducible induction of oxidative stress is required, independent of irradiation parameters and without the need for specialized equipment.

HNM provides a relevant model for studying extrinsic aging mechanisms²⁴. As primary cells derived from foreskin, they retain intact stress-response pathways and avoid artifacts associated with genetic modification or immortalization²⁵. Neonatal melanocytes provide an optimal experimental model as they exhibit minimal baseline damage, enabling clear assessment of environmental stressor-induced senescence pathways^26,27.

This study employs tBHP-induced oxidative stress in primary human neonatal melanocytes, overcoming limitations of non-melanocytic and immortalized cell models commonly used in senescence research. It provides a standardized platform for examining melanocyte-specific senescence mechanisms and characterizing the senescent phenotype with established markers. Overall, this protocol provides a reproducible, physiologically relevant model for studying oxidative stress–induced senescence in melanocytes.

Protocol

This protocol was optimized for research on primary human neonatal melanocytes (HNM) to study the mechanisms of stress-induced premature senescence induced by tBHP (Figure 1). The melanocytes were derived from neonatal Caucasian foreskin (light pigmentation phototype) and obtained from a commercial source. According to the supplier’s documentation, human tissues are collected from donors who are fully informed and have provided consent, in compliance with established ethical and legal frameworks, including the Declaration of Helsinki and applicable data protection regulations. The cells were provided in a de-identified form. No additional ethical approval was required for their use in this study. All experiments were performed using the same melanocyte line to ensure consistency. Note that when using different primary cell lines, the culture conditions, as well as concentrations and handling procedures, may need to be further adjusted.

1. Preparations

NOTE: To initiate tBHP treatment, melanocytes must be thawed at least three days in advance to allow sufficient recovery and confluency. The treatment phase lasts 4 days, with the seeding day designated as Day 0. Details of all the materials used in this study are given in the Table of Materials.

1. To prepare the culture medium, combine melanocyte basal medium with the corresponding growth factors. Flame the lid of each vial before adding its contents to the medium to minimize contamination. Add 1% (v/v) PenStrep to the prepared medium and store it at 4 °C until use.
2. Before seeding, prepare the trypsin inhibitor solution by diluting soybean trypsin inhibitor in DPBS. Filter the solution through a 0.22 µm membrane, aliquot, and store at −20 °C. Once thawed, it can be used for up to 10 days.

2. Cell thawing (Day -3)

CAUTION: All materials in contact with human cells should be considered biologically contaminated and disposed of in accordance with institutional biosafety guidelines. To assess senescence, we use complementary assays that evaluate growth arrest, SA-β-gal activity, and additional molecular markers. Here, we present the protocols for these assays and the expected outcomes when working with these senescence indicators.

1. Pipette 20 mL of Dulbecco's Phosphate Buffer Saline (cell culture grade) into a 50 mL conical tube at room temperature. Maintain the vial containing cells on ice until thawing.
2. Flame the lid before opening the vial containing the cells, unscrew, and flame the sides again to prevent potential contamination.
3. Transfer 500 µL of DPBS into the vial containing the cells. Gently thaw cells by pipetting up and down, then transfer the entire contents to the tube.
4. Centrifuge at 100 × g for 5 min at room temperature. The resulting pellet should appear beige to brownish (or darker, depending on the donor's ethnicity).
5. Prepare a T75 flask with 14 mL of melanocyte medium.
6. Flame a glass Pasteur pipette (flame each time when handling melanocytes), carefully aspirate the DPBS, and resuspend the pellet in 1 mL of medium.
7. Transfer to the previously prepared flask.
8. Incubate at 37 °C, 5% CO₂, and observe daily under the microscope. Change medium at least every 48 h.
   ​NOTE: Each cryopreserved vial contains approximately 1 × 10⁶ primary human melanocytes. All experiments were performed using cells at passage 9.

3. Cell seeding (Day 0)

1. Ensure confluency of 80–90% of the cells on the seeding day.
2. Aspirate the medium from the flask and wash twice with DPBS.
3. Detach cells by adding 2 mL of trypsin-EDTA solution and incubating for 5 min at 37 °C, 5% CO₂.
4. Gently tap the flask and observe under the microscope to confirm complete cell detachment (incubate longer if necessary).
5. Stop the reaction by adding 1.5 times the volume of trypsin inhibitor.
6. Transfer the cell suspension to a 15 mL conical tube and dilute with DPBS to a final volume of 10 mL.
7. Centrifuge the cell suspension at 100 × g for 5 min.
8. Aspirate the supernatant and resuspend to the desired volume in medium.
9. For tBHP-treated plates, seed 6 × 10⁵ cells per 10 cm dish. For control plates, seed 4 × 10⁵ cells per plate.
   NOTE: For tBHP-treated plates, seed a higher cell density to ensure sufficient cells are available for the experiments, as their growth rate will progressively decrease during treatment. If seeding cells on coverslips for microscopy experiments, coverslips must be coated with 0.1 mg/mL poly-D-lysine and completely dried prior to cell seeding.
10. Incubate overnight at 37 °C with 5% CO₂. Change medium every 48 h for control plates.

4. tBHP treatment (Day 1–4)

1. Prepare a 10 mM working solution from tBHP stock (diluted in DPBS or media).
   NOTE: tBHP is light-sensitive: cover the container when working with it. The working solution can be used for up to one week when stored properly at 4 °C. Treatment schedule: Day 1 (the day after seeding) marks the start of tBHP exposure. Melanocytes are treated twice daily with at least a 4 h interval between applications. This regimen is repeated from Day 1 to Day 4, for a total of 4 days of treatment. The selected tBHP concentration and treatment schedule were adapted from previous work in dermal fibroblasts, where lower concentrations were sufficient to induce senescence. In primary melanocytes, however, higher concentrations were required to achieve robust senescence induction, and 100 µM tBHP was identified as optimal based on titration experiments balancing senescence induction and cell viability
2. Add 100 µM tBHP to cells for 1 h per treatment (To initiate, add the appropriate volume of working solution, ensuring to pipette into the liquid medium.)
3. Move the plate back and forth and side to side to distribute tBHP evenly throughout the medium.
   ​NOTE: Avoid circular motions as this may cause uneven distribution of tBHP through the medium.
4. Incubate for precisely 1 h at 37 °C with 5% CO₂.
5. To terminate tBHP treatment, aspirate the medium.
6. Wash plates twice with pre-heated DPBS (37 °C).
7. Add the appropriate volume of fresh medium to the plates.
8. Allow cells to recover in the incubator for at least 4 h before initiating the subsequent treatment.
9. Repeat this procedure on the same day for the second treatment and continue for the remaining days. Maintain the cells in culture after finishing the treatment until Day 9 to assess senescence markers.
10. Monitor control plates and passage if confluent.

5. Growth curve analysis

1. Count tBHP-treated cells and controls following the seeding protocol.
2. Reseed the same initial density or all the cells in case you count fewer than the 6 × 10⁵ cells for tBHP plates.
3. Perform cell counts on days 4, 9, and 15 of culture.
4. Calculate the growth curve using the following formula:
   lg (count) - log (seed) / 0.301 + cPDL
   count: number of cells obtained at the end of the passage.
   seed: number of cells initially plated at the start of the passage.
   ​cPDL: cumulative population doubling level carried over from previous passages.

6. SA-β-galactosidase activity

1. On day 9, wash cells twice in PBS before fixing with 2% formaldehyde and 0.4% glutaraldehyde.
2. Wash cells twice with PBS.
3. Incubate fixed cells with staining solution with a pH of 6.0 (150 mM NaCl, 2 mM MgCl, 5 mM potassium ferricyanide, 5 mM potassium ferrocyanide, 40 mM citric acid, 12 mM sodium phosphate, and 1 mg/mL 5-bromo-4-chloro-3-indolyl-β-D-galactoside (X-gal).
4. After 18 h of incubation at 37 °C in the absence of CO₂, wash cells twice with PBS.
5. Image using light microscopy.
6. Quantify the number of blue-stained cells under the microscope by counting the number of blue cells and dividing by the total number of cells in a field. Express the results as a percentage of positive cells.

7. Immunofluorescence staining

CAUTION: Formaldehyde, glutaraldehyde, and paraformaldehyde-containing waste must be handled as hazardous chemical waste and disposed of in accordance with institutional safety regulations.

1. Use cells cultured on coverslips pre-coated with 0.1 mg/mL poly-D-lysine.
2. On day 9, wash cells twice, then fix with 4% paraformaldehyde for 15 min.
3. Wash cells twice with PBS.
4. Permeabilize using 0.3% Triton-X and 0.1% sodium citrate in PBS.
5. Block with 1% BSA in PBS-T for 30 min at room temperature.
6. Incubate cells with primary antibody γH2AX to detect permanent DNA damage response overnight at 4 °C in a humidified chamber.
7. The following day, wash twice with PBS.
8. Apply a secondary antibody for 1 h at room temperature.
9. Stain nuclei with DAPI if desired.
10. Wash twice with PBS-T, followed by two washes with PBS and twice with ddH₂O.
11. Mount coverslips and let them dry completely before imaging.
12. Analyze mean fluorescence intensity and/or γH2AX foci using ImageJ software.

8. RNA isolation and RT-qPCR

CAUTION: β-mercaptoethanol is highly toxic and must be handled in a fume hood. Waste containing β-mercaptoethanol should be disposed of as hazardous chemical waste.

1. On day 9, trypsinize cells using 2 mL of trypsin-EDTA.
2. Stop the reaction by applying 1.5x the amount of trypsin inhibitor.
3. Transfer the cell suspension to a 15 mL conical tube and centrifuge at 100 x g for 5 min.
4. Carefully aspirate the supernatant.
5. Lyse cell pellets by resuspending in 350 µL RLT buffer containing 1% β-mercaptoethanol.
6. Isolate RNA using a column-based RNA purification kit.
7. Determine RNA concentration using a spectrophotometer (260 nm).
8. For cDNA synthesis, use 1 µg of RNA for reverse transcription in a total reaction volume of 10 µL using a standard reverse transcription mix (including RT buffer, dNTPs, random primers, reverse transcriptase, and RNase inhibitor) followed by thermal cycling conditions according to the manufacturer’s instructions.
9. Perform RT-qPCR for SASP factors
   NOTE: The selected SASP factors (IL-8, IL-6, and MMP-1) represent well-established components of the senescence-associated secretory phenotype and were chosen based on their relevance to skin biology, including inflammatory signaling and extracellular matrix remodeling
   IL-6 (Fwd: 5’ AAGCCAGAGCTGTGCAGATGAGTA 3’ Rev: 5’ TGTCCTGCAGCCACTGGTTC 3’)
   IL-8 (Fwd: 5’ ACCGGAAGGAACCATCTCAC 3’ Rev: 5’ AAACTGCACCTTCACACAGAG 3’)
   MMP-1 (Fwd: 5’ CATCGTGTTGCAGCTCATGA 3’ Rev: 5’ ATGGGCTGGACAGGATTTTG 3’)
   GAPDH (Fwd: 5’ GAGTCAACGGATTTGGTCGT 3’ Rev: 5’ GATCTCGCTCCTGGAAGATG 3’)
10. Analyze relative mRNA expression using the ΔΔCt method with normalization to the housekeeping gene GAPDH.

9. Protein isolation and Western blot

1. On day 9, collect protein lysates.
2. Aspirate medium and wash plates twice using cold DPBS.
3. Lyse cells mechanically using a cell scraper after adding 150 µL RIPA buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, and 2 mM EDTA) supplemented with protease inhibitors and transfer to a 1.5 mL tube.
4. Perform three cycles of freezing and thawing followed by a 30 min incubation on ice.
5. Centrifuge at 9600 x g at 4 °C for 10 min.
6. Determine protein concentration of the supernatant using the BCA assay.
7. Separate equal amounts (20 µg) of protein on polyacrylamide gels and transfer to activated PVDF membranes.
8. Block membranes in 5% skim milk in TBS-T.
9. Incubate with primary antibodies pRB and LaminB1 overnight at 4 °C.
10. The next day, wash the membranes 3x in TBS-T.
11. Incubate in HRP-conjugated appropriate secondary antibodies for 1 h at room temperature.
12. Detect proteins by chemiluminescence and perform densitometric analysis.

Results

tBHP treatment induces growth arrest in human neonatal melanocytes.
tBHP treatment inhibits melanocyte proliferation compared to untreated controls (n = 3) (Figure 2A). By day 9, treated cells reach only 1.4 cPDL, whereas controls reach 3.1 cPDL. This divergence increases over time, with treated melanocytes approaching a plateau of 1.9 cPDL by day 15, while controls continue to expand to nearly 5.1 cPDL. The sustained reduction in proliferative capacity is consistent w...

Discussion

This protocol establishes a standardized approach for inducing stress-induced premature senescence (SIPS) in human neonatal melanocytes using tBHP, offering a robust model for studying senescence specifically in this cell type. Consistent changes in proliferation, morphology, SA-β-gal activity, DNA damage markers, and SASP components support the induced phenotype. By focusing on melanocytes, cells that remain understudied in senescence research despite their key roles in skin physiology and pigmentation disorders

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
0.22 µm membrane filter	Merck	SLGVR33RS
1 M citric acid	Merck	K91567844	prepare in aq. dest.
1 M MgCl2	Merck	A649033	prepare in aq. dest.
1 M Na2HPO4	Merck	K56036736	prepare in aq. dest.
10 M NaOH	Lab Honeywell	30620	prepare in aq. dest.
37% formaldehyde	Sigma	252549
4% paraformaldehyde	CarlRoth	0335.3
5 M Sodium Chloride	Sigma	S3014	prepare in aq. dest.
50% glutaraldehyde	Sigma	G6403
5-Brom-4-Chlor-3-indolyl-β-D-Galactopyranosid (X-Gal)	Sigma	B9146
Alexa Fluor-conjugated secondary antibody 2 mg/mL	Invitrogen	A11008
BSA (bovine serum albumin)	Sigma	A7030
Chemiluminescent substrate	Sigma	WBKLS0500
Costar CellLifter	Corning	3008
Coverslips for cell culture/microscopy	Epredia	CB00200RA120MNZ0
DermaLife Basal Medium	CellSystems	LM-0004
DermaLife M Melanocyte Kit	CellSystems	LS-1041
Dulbecco's Phosphate Buffered Saline	Sigma	D8537
Human neonatal melanocytes	CellSystems	FC-0023
LaminB1 antibody (rabbit)	Abcam	AB16048	Dilution 1:1000 in 5% BSA
Mounting medium containing DAPI	Abcam	AB104139
Penicillin-Streptomycin solution	Sigma	P4333
Polyacrylamide gradient gels	Bio-Rad	456-8095
Poly-D-Lysine, 0.1 mg/mL	Gibco	A38904-01
Potassium ferricyanide	Sigma	P8131
Potassium ferrocyanide	Sigma	P-9387
pRB antibody (rabbit)	CellSignalling	93085	Dilution 1:1000 in 5% BSA
Protease inhibitor cocktail	self prepared	N/A	500 mM NaF; 2 µg/ml Aprotinin; 1 mM PMSF; 1 mM activated Na-Orthovanadate
RIPA buffer	self prepared	N/A	containing: 50 mM Tris-HCl; 1% NP-40; 0.5% Na-deoxycholate; 0.1% SDS; 150 mM NaCl; 2 mM EDTA
RLT buffer	Qiagen	1015762	Included in RNeasy Mini Kit
RNeasy Mini Kit	Qiagen	74106
Skim milk powder (for 5% milk in TBS-T)	Sigma	70166
Sodium citrate (for 0.1% solution)	Sigma	S4641
Soybean trypsin inhibitor, 0.5 mg/mL	Thermofisher	17075-029
tert-Butyl hydroperoxide (tBHP)	Sigma	458139
Triton X-100 (for 0.3% solution)	Sigma	T9284
Trypsin-EDTA solution	Sigma	T3924
β-mercaptoethanol	CarlRoth	4227.3
γH2AX antibody (rabbit)	CellSignalling	2577S	Dilution 1:200