Research Article

Lycopus lucidus Extract Improves Experimental Polycystic Ovary Syndrome with Gut Microbiota and Metabolome Remodeling

49 views

DOI:

10.3791/71084

August 28th, 2026

In This Article

Summary

ZeLan extract improved endocrine and metabolic phenotypes in DHEA-induced PCOS rats. Integrated 16S rRNA sequencing and serum metabolomics showed partial restoration of gut microbial alpha diversity, altered microbial composition, and metabolite changes involving steroid hormones, bile acids, and short-chain fatty acids.

Abstract

This study investigated the therapeutic effects of ZeLan extract on polycystic ovary syndrome (PCOS) and evaluated its association with gut microbiota-metabolome remodeling. Twenty-four female Sprague-Dawley rats were randomly divided into Control, PCOS Model induced by dehydroepiandrosterone (DHEA), and ZeLan treatment groups (n = 8 each). After 28 days of intervention, serum hormone levels were measured by ELISA; gut microbiota composition was analyzed using 16S rRNA gene sequencing, and serum metabolic profiles were characterized by UHPLC-Q-TOF-MS. Spearman correlation analysis with multiple-testing control was performed to explore microbiota-metabolome associations. ZeLan significantly improved PCOS-associated phenotypes, reducing body weight, testosterone (0.92 vs. 1.85 ng/mL, P < 0.05), LH/FSH ratio, and insulin levels compared with the Model group. Sequencing showed that ZeLan partially restored microbial alpha diversity (Shannon index: 5.79 vs. 4.19) and decreased the Firmicutes-to-Bacteroidetes ratio. ZeLan was associated with enrichment of Lactobacillus and Ruminococcus and lower abundance of Bacteroides, Prevotella, and Escherichia. Metabolomics identified 52 altered metabolite features, with key changes involving steroid hormones, bile acids such as lithocholic acid, and short-chain fatty acids such as butyric acid. These findings suggest that ZeLan ameliorates PCOS-related endocrine and metabolic disturbances and is associated with remodeling of gut microbial and serum metabolic profiles.

Introduction

Polycystic ovary syndrome (PCOS) represents one of the most prevalent endocrine disorders affecting women of reproductive age, with a global prevalence estimated between 6% and 20% depending on the diagnostic criteria employed1. This complex metabolic and reproductive disorder is characterized by a constellation of clinical manifestations, including hyperandrogenism, ovulatory dysfunction, and polycystic ovarian morphology, which collectively contribute to significant reproductive, metabolic, and psychological consequences2. Beyond its immediate impact on fertility, PCOS is increasingly recognized as a systemic condition associated with long-term health complications, including type 2 diabetes mellitus, cardiovascular disease, and endometrial carcinoma, thereby imposing substantial burdens on both individual patients and healthcare systems worldwide3. The pathophysiology of PCOS remains incompletely understood, though it is generally acknowledged to involve intricate interactions between genetic predisposition, environmental factors, and lifestyle determinants that culminate in the characteristic hormonal and metabolic disturbances observed in affected individuals4.

Contemporary therapeutic approaches for PCOS primarily focus on symptomatic management through pharmacological interventions, including oral contraceptives for menstrual regulation, metformin for insulin sensitization, and anti-androgens for hirsutism control5. However, these conventional treatments often provide incomplete symptom relief and are frequently associated with adverse effects that limit their long-term applicability, particularly in women with fertility aspirations6. Consequently, there has been growing interest in exploring complementary and alternative medicine approaches, particularly traditional Chinese medicine (TCM), which has accumulated centuries of empirical experience in treating gynecological disorders through holistic regulatory mechanisms7. Among the numerous botanical medicines investigated for PCOS management, Lycopus lucidus Turcz. (commonly known as ZeLan in Chinese medicine) has attracted considerable attention due to its traditional applications in promoting blood circulation, resolving stasis, and regulating menstruation8. Published phytochemical studies indicate that L. lucidus contains polyphenols and flavonoid-rich fractions with antioxidant and anti-inflammatory activity8,9. Therefore, standardized total flavonoid content was used as the chemical quality-control index for the extract in the present study, although identification of the specific active monomers responsible for microbiota and metabolic regulation requires targeted phytochemical analysis in the future.

The gut microbiota has emerged as a critical regulator of host metabolism and endocrine function, with mounting evidence supporting its involvement in the pathogenesis of various metabolic disorders, including PCOS10. The concept of the gut-ovary axis has been proposed to describe bidirectional communication between intestinal microorganisms and ovarian function, mediated by microbial metabolites, immune signaling, and neuroendocrine pathways11. Women with PCOS have been consistently shown to exhibit gut dysbiosis characterized by reduced microbial diversity, altered Firmicutes-to-Bacteroidetes ratios, and diminished abundance of beneficial bacteria such as Lactobacillus and Bifidobacterium species12. These microbial perturbations are thought to contribute to PCOS pathophysiology through multiple mechanisms, including increased intestinal permeability, systemic low-grade inflammation, and altered bile acid and short-chain fatty acid (SCFA) metabolism, which subsequently influence insulin sensitivity and androgen biosynthesis13. Importantly, interventions targeting the gut microbiota, including probiotics, prebiotics, and dietary modifications, have shown promising results in ameliorating PCOS symptoms, thereby supporting the gut-ovary axis as a therapeutic target14.

Metabolomics, the comprehensive analysis of small-molecule metabolites in biological systems, provides a powerful approach for characterizing the metabolic perturbations associated with disease states and for evaluating the biochemical effects of therapeutic interventions15. Integration of 16S rRNA gene sequencing for microbiome profiling with untargeted metabolomics enables systematic investigation of relationships between gut microbial communities and host metabolism, offering insights into microbiota-metabolome interactions that may accompany both disease pathogenesis and treatment responses. Despite the theoretical rationale for targeting the gut-ovary axis in PCOS management and ZeLan's traditional indications for gynecological disorders, no studies to date have systematically investigated whether ZeLan extract modulates the gut microbiota-metabolome interface in PCOS. This knowledge gap limits our understanding of ZeLan-associated biological responses and hinders rational optimization of this botanical intervention for PCOS treatment.

The present study was designed to investigate the therapeutic efficacy of ZeLan extract in a DHEA-induced rat model of PCOS and to evaluate associated gut microbiota-metabolome changes through integrated 16S rRNA sequencing and untargeted metabolomics analysis. Specifically, we evaluated the effects of ZeLan extract on PCOS-related phenotypes, including body weight, serum testosterone, luteinizing hormone-to-follicle-stimulating hormone (LH/FSH) ratio, and insulin levels; characterized alterations in gut microbiota composition and alpha diversity following ZeLan treatment; identified differential serum metabolite features and enriched metabolic pathways associated with ZeLan intervention; and explored correlations between specific gut microbial taxa and key metabolites. By addressing these objectives, we sought to provide associative multi-omics evidence for ZeLan-related modulation of the gut-ovary axis in PCOS.

Protocol

All experimental procedures in the present study were conducted in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals and were approved by the Institutional Animal Care and Use Committee (Approval No. IACUC-2023-0156).

Animals

Female Sprague-Dawley rats (n = 24, 6 weeks old, body weight 180–200 g) were obtained from the Laboratory Animal Center of the affiliated institution and housed under controlled environmental conditions (temperature 22 ± 2°C, humidity 50 ± 10%, 12-hour light/dark cycle) with ad libitum access to standard rodent chow and purified water. Following a one-week acclimatization period, animals were randomly assigned to three experimental groups (n = 8 per group): Control, PCOS Model, and ZeLan treatment. Sample size was determined based on previous studies investigating gut microbiota alterations in PCOS models, with power analysis indicating that 8 animals per group would provide 80% power to detect a 1.5-fold difference in alpha diversity indices at α = 0.05.

PCOS model establishment and treatment protocol

The PCOS model was established using a well-validated protocol involving subcutaneous injection of dehydroepiandrosterone (DHEA; Sigma-Aldrich, USA) dissolved in sesame oil into the dorsal neck region at a dose of 6 mg/100 g body weight daily for 21 consecutive days. Control animals received equivalent volumes of sesame oil vehicle. The full experimental timeline comprised 7 days of acclimatization, 21 days of model induction, and 28 days of intervention, with endpoint sampling on protocol day 56, including the acclimatization period (Figure 1). The ZeLan extract was prepared from authenticated Lycopus lucidus Turcz. herb through aqueous extraction and was standardized to contain total flavonoids at no less than 2.5% by high-performance liquid chromatography, which served as the chemical quality-control criterion for the botanical extract. Beginning after completion of DHEA-induced model establishment, rats in the ZeLan group received oral gavage of ZeLan extract at 200 mg/kg body weight daily for 28 consecutive days, while the Control and Model groups received equivalent volumes of distilled water. The 200 mg/kg dose was selected as an exploratory pharmacological dose based on prior animal-use experience with botanical extracts and preliminary tolerability considerations; formal dose-response evaluation was not part of the present design. Body weight was recorded weekly throughout the experimental period. In this experimental design, successful PCOS model establishment was evaluated using the DHEA induction protocol together with endpoint endocrine and metabolic phenotypes, including body weight, serum testosterone, LH/FSH ratio, and fasting insulin. Ovarian histopathological examination, follicle counting, corpus luteum quantification, and serial estrous-cycle monitoring were not included as model-confirmation endpoints, and the interpretation of ovarian dysfunction was therefore based on endocrine and metabolic readouts rather than direct tissue-level assessment.

Sample collection and processing

Samples (serum and feces) were collected from all three groups (n = 8 per group) for subsequent biochemical, microbiota, and metabolomics analyses. Endpoint collections were performed in the morning after overnight fasting to reduce circadian and feeding-related variability. Blood samples were collected from the abdominal aorta under anesthesia and centrifuged at 3,000 × g for 15 minutes at 4°C to obtain serum, which was aliquoted and stored at -80°C until hormone and metabolomic analyses. Fresh fecal samples were collected directly from the cecum under aseptic conditions into sterile cryotubes, kept on dry ice during transfer, snap-frozen in liquid nitrogen within 10 minutes of collection, and stored at -80°C until 16S rRNA gene sequencing.

Serum hormone measurements

Serum concentrations of testosterone, luteinizing hormone (LH), follicle-stimulating hormone (FSH), and insulin were quantified using commercially available enzyme-linked immunosorbent assay (ELISA) kits (Cusabio Biotech, Wuhan, China) according to the manufacturer's instructions. The LH/FSH ratio was calculated as a composite index of gonadotropin imbalance characteristic of PCOS. All samples were analyzed in duplicate, and measurements with duplicate coefficients of variation greater than 15% were repeated. The intra-assay and inter-assay coefficients of variation were required to remain below 10% and 15%, respectively. Potential outliers were screened against source records and assay performance information, and no value was excluded solely on statistical grounds without a documented technical reason.

16S rRNA gene sequencing and bioinformatic analysis

Total bacterial genomic DNA was extracted from cecal contents using the QIAamp DNA Stool Mini Kit (Qiagen, Germany) following the manufacturer's protocol. DNA quality and quantity were assessed using NanoDrop spectrophotometry and agarose gel electrophoresis, and DNA extracts were stored at -80°C before library construction. The V3-V4 hypervariable regions of the 16S rRNA gene were amplified using universal primers 338F (5'-ACTCCTACGGGAGGCAGCA-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') with Illumina adapter sequences. Amplicon libraries were constructed, purified, quantified, pooled in equimolar concentrations, and sequenced on the Illumina NovaSeq 6000 platform (Novogene, Beijing, China) using paired-end 250 bp reads.

Raw sequencing reads were processed using the QIIME2 (version 2022.2) pipeline. Paired-end reads were demultiplexed, merged, quality-filtered using a Phred score threshold of at least 20, and processed with DADA2 to remove chimeric sequences and generate amplicon sequence variants (ASVs). Taxonomic classification was performed against the SILVA 138 reference database using a naive Bayes classifier. Alpha diversity metrics, including Shannon index, Simpson index, and Chao1 estimator, were calculated to assess within-sample diversity and richness. Sequencing-depth outputs, including read summaries, ASV abundance tables, Good's coverage, and rarefaction-curve files, were treated as part of the microbiome dataset described in the Data Availability section. Linear discriminant analysis effect size (LEfSe) was used to identify disease-associated taxa in the Control versus Model comparison using an LDA score threshold greater than 2.0 and P < 0.05; ZeLan-associated reversal was evaluated by comparing the direction of taxonomic abundance shifts in the ZeLan group relative to the Model group.

Untargeted metabolomics analysis

Serum metabolomic profiling was performed using ultra-high-performance liquid chromatography coupled with quadrupole time-of-flight mass spectrometry (UHPLC-Q-TOF-MS; Agilent 1290 Infinity II/6550, USA). Serum samples (100 μL) were mixed with 400 μL of cold methanol: acetonitrile (1:1, v/v) containing internal standards, vortexed, and incubated at -20°C for 1 hour to precipitate proteins. Following centrifugation at 14,000 × g for 15 minutes, the supernatants were dried under a nitrogen stream and reconstituted in 100 μL of acetonitrile:water (1:1, v/v) for analysis. Chromatographic separation was achieved on an ACQUITY UPLC HSS T3 column (2.1 × 100 mm, 1.8 μm) maintained at 40°C, using water containing 0.1% formic acid as mobile phase A and acetonitrile containing 0.1% formic acid as mobile phase B at a flow rate of 0.30 mL/min. A gradient program increasing the organic phase from 5% to 95%, followed by column washing and re-equilibration, was used for metabolite separation. Mass spectrometric data were acquired in both positive and negative electrospray ionization modes with a scan range of m/z 50–1200; the source parameters included capillary voltage 3.5 kV, drying gas flow 10 L/min, drying gas temperature 325°C, nebulizer pressure 35 psi, and fragmentor voltage 120 V.

Raw data files were converted to mzXML format and processed using the XCMS package in R for peak detection, retention-time alignment, and peak-area integration. Quality-control samples prepared by pooling equal aliquots of all serum extracts were inserted throughout the analytical sequence to monitor instrument stability. Features with excessive missingness or unstable quality-control reproducibility were removed before statistical modeling. Metabolite identification was performed by matching accurate mass, retention time, and MS/MS fragmentation patterns against the Human Metabolome Database (HMDB), METLIN, and in-house spectral libraries. Multivariate statistical analyses were conducted using MetaboAnalyst 5.0. Metabolite features retained for downstream reporting were prioritized using a combined criterion that incorporated multivariate discriminatory contribution, fold-change direction, and statistical evidence; P values were adjusted using the Benjamini-Hochberg method to account for multiple testing. The complete annotated reporting table, containing 52 metabolite features, is provided as Supplementary Table 1. Pathway enrichment analysis was performed using the Kyoto Encyclopedia of Genes and Genomes (KEGG) database.

Statistical analysis

All statistical analyses were performed using SPSS version 26.0 (IBM Corporation, Armonk, NY, USA) and R software (version 4.2.1). Continuous data were expressed as mean ± standard deviation (SD) and were assessed for normality using the Shapiro-Wilk test before inferential testing. For normally distributed data, one-way analysis of variance (ANOVA) followed by Tukey's post hoc test was used for multiple-group comparisons; for non-normally distributed data, the Kruskal-Wallis test with Dunn's post hoc test was used. Correlations between gut microbial taxa and serum metabolites were evaluated using Spearman's rank correlation coefficient and visualized as hierarchically clustered heatmaps. Correlation P-values were adjusted for multiple testing using the Benjamini-Hochberg false-discovery rate method, and only correlations that were consistent in direction and statistically significant were interpreted. A two-tailed P-value < 0.05 was considered statistically significant unless an adjusted P-value threshold was specified.

Results

Effects of ZeLan extract on PCOS clinical phenotypes

Administration of DHEA induced PCOS-like endocrine and metabolic phenotypes in rats, as evidenced by significant elevations in body weight, serum testosterone concentration, LH/FSH ratio, and fasting insulin levels compared to the Control group (all P < 0.05). Distributional assessment using the Shapiro-Wilk test supported parametric analysis for the principal body weight and hormone endpoints summarized in Table 1. Treatment with ZeLan extract for 28 days significantly improved these metabolic and hormonal disturbances. Body weight was recorded at the end of the treatment period on protocol day 56, including the 7-day acclimatization period. As presented in Table 1, body weight in the Model group (291.12 ± 15.35 g) was substantially higher than that in the Control group (227.45 ± 10.12 g, P < 0.05), while ZeLan treatment significantly reduced body weight to 245.25 ± 10.21 g (P < 0.05 versus Model). Serum testosterone levels were markedly elevated in PCOS model rats (1.85 ± 0.21 ng/mL) compared to controls (0.51 ± 0.05 ng/mL), and ZeLan intervention lowered testosterone to 0.92 ± 0.12 ng/mL. The LH/FSH ratio was significantly increased in the Model group (3.28 ± 0.25) relative to Control (1.25 ± 0.11) and was partially normalized by ZeLan treatment (1.85 ± 0.15). Fasting insulin levels were elevated in model animals (28.95 ± 2.35 mIU/L versus 12.55 ± 1.12 mIU/L in controls) and were significantly reduced following ZeLan administration (18.82 ± 1.55 mIU/L) (Figure 2). These findings confirmed successful establishment of an endocrine-metabolic PCOS-like phenotype; however, ovarian histopathology, follicle counts, corpus luteum analysis, and estrous-cycle monitoring were not performed in this study.

ZeLan extract restored gut microbiota alpha diversity

Analysis of alpha diversity indices revealed substantial alterations in gut microbial community structure associated with PCOS and its treatment. As shown in Table 2 and Figure 3, the Shannon diversity index was significantly lower in PCOS model rats (4.19 ± 0.35) than in healthy controls (6.51 ± 0.28; P < 0.05), indicating decreased microbial alpha diversity in the disease state. ZeLan treatment partially restored microbial diversity, with the Shannon index increasing to 5.79 ± 0.26 (P < 0.05 versus Model). Consistent results were observed for the Simpson index, which decreased from 0.98 ± 0.01 in controls to 0.82 ± 0.03 in model animals and recovered to 0.93 ± 0.02 following ZeLan intervention. The Chao1 estimator, reflecting species richness, showed a similar pattern: PCOS induction substantially reduced Chao1 from 1215.3 ± 45.4 to 665.8 ± 52.1, while ZeLan treatment increased richness to 963.5 ± 38.6. These findings collectively indicate that PCOS is associated with gut microbial dysbiosis characterized by reduced alpha diversity and richness, and that ZeLan extract can partially restore microbial community structure toward the Control profile.

Alterations in gut microbiota composition

Phylum-level taxonomic profiling revealed distinct compositional differences among experimental groups. As illustrated in Figure 4, Firmicutes and Bacteroidetes were the dominant phyla across all groups, collectively accounting for over 85% of the total bacterial community. The Model group exhibited a substantially elevated Firmicutes abundance (approximately 75%) coupled with reduced Bacteroidetes proportion (approximately 15%) compared to the Control group (Firmicutes approximately 40%, Bacteroidetes approximately 45%), resulting in a markedly increased Firmicutes-to-Bacteroidetes (F/B) ratio characteristic of metabolic dysbiosis. ZeLan treatment modulated this imbalance, reducing Firmicutes abundance to approximately 52% while increasing Bacteroidetes to approximately 35%, thereby partially normalizing the F/B ratio toward control levels.

LEfSe analysis was used to identify bacterial taxa that distinguished the Control and Model groups and thereby defined the disease-associated microbial signature. As shown in Figure 5, at the genus level, the PCOS Model group showed significantly elevated abundances of Bacteroides (LDA score > 3.5), Prevotella (LDA score > 3.0), and Escherichia (LDA score > 2.5), all of which are generally previously associated with metabolic dysfunction and inflammation. Conversely, the Control group exhibited enrichment of beneficial genera, including Lactobacillus (LDA score > 3.0) and Ruminococcus (LDA score > 2.5), both of which are recognized for their roles in maintaining gut barrier integrity and producing beneficial metabolites such as short-chain fatty acids. The ZeLan group was not displayed as a separate LEfSe class in Figure 5 because this analysis focused on taxa distinguishing disease from health; ZeLan-related effects were interpreted from abundance shifts toward the Control profile and from microbiome-metabolome correlations.

Metabolomic profiling and differential metabolite identification

Untargeted metabolomics analysis identified substantial metabolic perturbations associated with PCOS and its treatment with ZeLan extract. The volcano plot in Figure 6 shows the distribution of metabolite features between the Model and Control groups, with upregulated and downregulated features highlighted by fold-change direction and statistical significance. A total of 52 annotated metabolite features were retained in the complete metabolomics reporting table for the Model versus Control comparison. The complete list, including metabolite name, HMDB identifier, biochemical class, log2 fold change, P value, and regulation direction, is provided as Supplementary Table 1. Table 3 presents representative annotated metabolites with high biological relevance to PCOS.

Table 3 summarizes representative key differential metabolites with high VIP scores and biological relevance to PCOS pathophysiology. Steroid hormones, including testosterone (VIP = 2.56, P < 0.001) and androstenedione (VIP = 2.34, P < 0.001), were significantly elevated in PCOS model animals, consistent with the hyperandrogenic state characteristic of this condition. Fatty acid metabolism was also perturbed, with palmitic acid (VIP = 2.12) and arachidonic acid (VIP = 1.89) showing significant increases, while the pro-inflammatory lipid mediator prostaglandin E2 was similarly upregulated (VIP = 2.05). Conversely, metabolites associated with beneficial gut microbial activity were reduced in PCOS animals: lithocholic acid, a secondary bile acid produced through microbial biotransformation, decreased substantially (VIP = 2.45), as did the short-chain fatty acid butyric acid (VIP = 2.21). Additionally, succinic acid and the essential amino acid L-tryptophan showed reductions in the Model group, suggesting impaired microbial fermentation and altered amino acid metabolism.

KEGG pathway enrichment analysis

Pathway enrichment analysis using the KEGG database revealed several serum metabolic pathways significantly perturbed in PCOS and modulated by ZeLan treatment. As depicted in Figure 7, steroid hormone biosynthesis emerged as the most significantly enriched pathway (Rich Factor = 0.80, P < 0.01), consistent with the hyperandrogenic phenotype of PCOS. The ovarian steroidogenesis pathway was similarly highly enriched (Rich Factor = 0.75, P < 0.01), reflecting the involvement of altered androgen synthesis in ovarian dysfunction. Primary bile acid biosynthesis showed significant enrichment (Rich Factor = 0.62, P < 0.02), indicating disrupted enterohepatic bile acid circulation that may be related to alterations in gut microbiota. Arachidonic acid metabolism (Rich Factor = 0.56, P < 0.03) and the insulin resistance pathway (Rich Factor = 0.40, P < 0.04) were also significantly enriched, supporting the presence of inflammatory and metabolic disturbances characteristic of PCOS. The fatty acid biosynthesis pathway showed modest enrichment (Rich Factor = 0.30), suggesting involvement of lipid metabolic dysregulation.

Microbiome-metabolome correlation analysis

To evaluate functional relationships between gut microbiota composition and metabolic alterations, Spearman correlation analysis with false-discovery rate control was performed between differentially abundant bacterial genera and key metabolites. The hierarchically clustered correlation heatmap presented in Figure 8 reveals distinct patterns of microbiota-metabolome associations. Beneficial bacteria, including Lactobacillus and Ruminococcus, exhibited strong positive correlations with lithocholic acid (r = 0.72 and 0.68, respectively) and butyric acid (r = 0.65 and 0.60, respectively), while showing negative correlations with testosterone (r = -0.75 and -0.80) and androstenedione (r = -0.68 and -0.72). These findings suggest that beneficial bacteria identified in the taxonomic analysis were associated with androgen-related metabolites and SCFA-related metabolic activity.

Conversely, the PCOS-associated genera Bacteroides, Prevotella, and Escherichia demonstrated opposite correlation patterns. These bacteria were positively correlated with testosterone (r = 0.85, 0.82, and 0.60, respectively), androstenedione (r = 0.78, 0.75, and 0.55), and palmitic acid (r = 0.65, 0.60, and 0.45), while showing negative correlations with beneficial metabolites, including lithocholic acid and butyric acid. These correlation patterns support functional associations between specific gut microbial taxa and the metabolic disturbances characteristic of PCOS, but they do not establish direct causality.

Data Availability:

The datasets generated and analyzed during this study include sample metadata, phenotype source data, 16S alpha-diversity indices, phylum-level abundance summaries, differential bacterial taxa results, metabolomics differential-analysis tables, representative metabolite results, KEGG pathway enrichment results, and the microbiota-metabolite correlation matrix. These underlying source data are provided as the accompanying Supplementary File 1. The processed differential metabolite dataset is provided as Supplementary Table 1.

Experimental timeline diagram showing control, model, ZeLan groups with DHEA injections, sample collection.
Figure 1: Experimental design and treatment timeline. Schematic illustration of the experimental workflow showing the 7-day acclimatization period, 21-day DHEA or vehicle injection period, 28-day ZeLan extract or vehicle treatment, and endpoint collection of serum and fecal samples on protocol day 56. Please click here to view a larger version of this figure.

Box plots of serum testosterone, LH/FSH ratio, body weight; comparison across control, model, ZeLan.
Figure 2: Effects of ZeLan extract on endocrine and metabolic parameters. Box plots showing (A) serum testosterone concentration, (B) LH/FSH ratio, and (C) body weight in the Control, Model, and ZeLan treatment groups following the intervention period. Please click here to view a larger version of this figure.

Shannon Index comparison box plot; Control, Model, ZeLan groups; diversity analysis results.
Figure 3: Gut microbial alpha diversity. Comparison of the Shannon diversity index among the Control, Model, and ZeLan treatment groups, illustrating differences in gut microbial alpha diversity. Please click here to view a larger version of this figure.

Microbial composition bar chart; phylum abundance in Control, Model, ZeLan groups; microbiome analysis.
Figure 4: Gut microbiota composition at the phylum level. Stacked bar chart showing the relative abundance of the predominant bacterial phyla in the gut microbiota of the Control, Model, and ZeLan treatment groups. Please click here to view a larger version of this figure.

Microbiome analysis, LDA Score bar chart showing genus enrichment in control and model groups.
Figure 5: Differential bacterial taxa identified by LEfSe analysis. Linear discriminant analysis effect size (LEfSe) identifying bacterial genera that distinguish the Control and Model groups. LDA scores indicate the effect size of differentially abundant taxa. ZeLan-associated changes are described in the Results based on abundance shifts relative to the Model group. Please click here to view a larger version of this figure.

Volcano plot displaying gene expression analysis; log2 fold change vs -log10 p-value.
Figure 6: Differential metabolite profiling. Volcano plot showing differential metabolite features between the Model and Control groups. Red and blue points represent significantly upregulated and downregulated metabolite features, respectively, based on fold change and statistical significance. Please click here to view a larger version of this figure.

Pathway analysis dot plot; bubble size indicates count; color shows p-value; axes: Rich Factor vs. Pathway.
Figure 7: KEGG pathway enrichment analysis. Bubble plot showing significantly enriched metabolic pathways identified from differential metabolites. Bubble size represents the number of mapped metabolites, and bubble color indicates the statistical significance (P-value) of pathway enrichment. Please click here to view a larger version of this figure.

Heatmap diagram of microbial and metabolite correlations; data analysis on gut microbiota.
Figure 8: Correlation between gut microbiota and serum metabolites. Hierarchically clustered heatmap showing Spearman correlation coefficients between differentially abundant bacterial genera and representative serum metabolites. Red indicates positive correlations, whereas blue indicates negative correlations. Please click here to view a larger version of this figure.

GroupNBody Weight (g)Testosterone (ng/mL)LH/FSH RatioInsulin (mIU/L)
Control8227.45 ± 10.120.51 ± 0.051.25 ± 0.1112.55 ± 1.12
Model8291.12 ± 15.35a1.85 ± 0.21a 3.28 ± 0.25a28.95 ± 2.35a
ZeLan8245.25 ± 10.21b0.92 ± 0.12b1.85 ± 0.15b18.82 ± 1.55b
Note: Data are presented as Mean ± SD. a = p < 0.05 compared with the Control group; b = p < 0.05 compared with the Model group.

Table 1: Endocrine and metabolic parameters in PCOS rats. Body weight, serum testosterone, LH/FSH ratio, and fasting insulin levels were measured in the Control, Model, and ZeLan treatment groups. Data are presented as mean ± SD.

GroupShannon IndexSimpson IndexChao1 Estimator
Control6.51 ± 0.280.98 ± 0.011215.3 ± 45.4
Model4.19 ± 0.35a0.82 ± 0.03a665.8 ± 52.1a
ZeLan5.79 ± 0.26b0.93 ± 0.02b963.5 ± 38.6b
Note: Data are presented as Mean ± SD. a = p < 0.05 compared with the Control group; b = p < 0.05 compared with the Model group.

Table 2: Gut microbial alpha diversity indices. Comparison of the Shannon index, Simpson index, and Chao1 estimator among the Control, Model, and ZeLan treatment groups. Data are presented as mean ± SD.

Metabolite NameHMDB IDClassTrend (Model vs Control)p-valueVIP Score
TestosteroneHMDB0000286SteroidUp ↑< 0.0012.56
AndrostenedioneHMDB0000055SteroidUp ↑< 0.0012.34
Palmitic acidHMDB0000220Fatty AcidUp ↑< 0.0012.12
Arachidonic acidHMDB0001043Fatty AcidUp ↑0.0031.89
Prostaglandin E2HMDB0001036LipidUp ↑< 0.0012.05
Lithocholic acidHMDB0000752Bile AcidDown ↓< 0.0012.45
Butyric acidHMDB0000039SCFADown ↓< 0.0012.21
Succinic acidHMDB0000254Organic AcidDown ↓0.0211.65
L-TryptophanHMDB0000929Amino AcidDown ↓0.0151.58
Note: VIP = Variable Importance in Projection (VIP > 1 considered significant). 

Table 3: Representative differential serum metabolites. Representative annotated metabolites associated with PCOS and regulated by ZeLan extract, including HMDB identifiers, metabolite class, regulation trend, P-value, and VIP score. The complete list of 52 annotated metabolite features is provided in Supplementary Table 1.

Supplementary Table 1: Complete annotated metabolite dataset. Complete list of the 52 annotated metabolite features retained for metabolomics reporting, including metabolite name, HMDB identifier, biochemical class, fold change, P-value, and regulation direction.Please click here to download this file.

Supplementary File 1: Source data supporting the experimental, microbiome, and metabolomics analyses. This workbook contains the sample information, clinical phenotype measurements, 16S rRNA sequencing diversity indices, phylum-level microbial relative abundance, LEfSe differential taxa analysis, metabolomics differential analysis, representative metabolites, KEGG pathway enrichment analysis, correlation matrix data, and data verification summary used to generate the figures and tables presented in the manuscript.Please click here to download this file.

Discussion

The present study provides evidence that ZeLan extract ameliorates PCOS-related endocrine and metabolic phenotypes in a DHEA-induced rat model and that these effects are associated with favorable changes in gut microbiota composition and serum metabolic profiles. The integrated multi-omics approach showed that ZeLan treatment improved hyperandrogenemia, elevated LH/FSH ratio, and insulin resistance, while partially restoring gut microbial alpha diversity, rebalancing microbial composition, and normalizing several metabolic pathways implicated in PCOS pathophysiology. These findings extend current understanding of biological responses to traditional Chinese botanical medicines and support further investigation of the gut-ovary axis as a potential target for PCOS intervention.

The reduction in serum testosterone and LH/FSH ratio following ZeLan treatment aligns with previous investigations demonstrating the anti-androgenic properties of botanical extracts containing flavonoids and phenolic compounds16. A comprehensive review of clinical studies with herbal medicine on PCOS has summarized endocrine and metabolic improvements across botanical interventions17. The mechanism by which ZeLan modulates androgen biosynthesis may involve direct effects on ovarian steroidogenic pathways, systemic anti-inflammatory and insulin-sensitizing effects, or indirect effects associated with gut microbial metabolites, and the present design cannot fully separate these possibilities. The improvement in the LH/FSH ratio indicates partial restoration of hypothalamic-pituitary-gonadal axis function, which is commonly dysregulated in PCOS18. Systematic reviews of animal experiments on traditional Chinese medicine formulas for PCOS have also reported improvements in reproductive and endocrine indices19. The concurrent improvement in insulin-related indices suggests that ZeLan may exert metabolic benefits beyond endocrine regulation, potentially through enhanced peripheral insulin signaling or reduced inflammatory mediators that impair insulin receptor function20.

The restoration of gut microbial alpha diversity following ZeLan treatment is consistent with a microbiome-associated response. The reduced alpha diversity observed in PCOS model rats is consistent with the growing body of literature documenting gut dysbiosis in both experimental PCOS models and clinical populations21. Insenser et al. further reported that gut microbiota profiles in PCOS are influenced by sex, sex hormones, and obesity22. Our observation that ZeLan treatment partially restored the Shannon index from 4.19 to 5.79 suggests that this botanical extract may support microbial community structure. Similar diversity-restoring effects have been reported for other polyphenol-rich plant extracts, which may selectively promote beneficial bacterial populations while suppressing potentially pathogenic taxa23. The taxonomic shifts observed at the phylum level, particularly the reduced Firmicutes-to-Bacteroidetes ratio following ZeLan treatment, are relevant given the established association between elevated F/B ratios and metabolic dysfunction, including obesity and insulin resistance24. Additional studies, including the work of Jobira et al. in adolescents with PCOS, have reported altered gastrointestinal microbial biodiversity, supporting the biological relevance of microbial composition to host metabolism25.

The identification of specific bacterial genera differentially associated with PCOS and ZeLan treatment provides a biological context for the microbiota-metabolome associations observed in this study. The enrichment of Lactobacillus and Ruminococcus in healthy controls and their depletion in PCOS animals is consistent with previous reports highlighting the protective roles of these genera26. Lactobacillus species are recognized for their production of lactic acid and antimicrobial peptides that maintain gut barrier integrity and suppress pathogenic bacteria, while Ruminococcus species are important producers of short-chain fatty acids through fermentation of dietary fiber27. The restoration of these beneficial genera following ZeLan treatment may improve gut barrier function and enhance SCFA-related metabolic activity, as reflected by increased butyric acid levels observed in the metabolomic analysis. Conversely, the elevated abundance of Bacteroides, Prevotella, and Escherichia in PCOS animals aligns with studies implicating these genera in inflammatory and metabolic disorders28. Escherichia species, particularly Escherichia coli, can produce lipopolysaccharide, which may trigger systemic inflammation and insulin resistance through Toll-like receptor 4 signaling, representing a plausible link between gut dysbiosis and PCOS-associated metabolic dysfunction29.

The metabolomic findings provide evidence for gut microbiota-host metabolic associations accompanying ZeLan treatment. Changes in secondary bile acids, such as lithocholic acid, are biologically relevant because these metabolites are generated through bacterial enzymatic activity30. Bile acids function not only in lipid absorption but also as signaling molecules that regulate glucose and lipid metabolism through farnesoid X receptor and Takeda G protein-coupled receptor 5, suggesting that normalization of bile acid profiles may contribute to improved metabolic homeostasis. Similarly, restoration of butyric acid levels is relevant given its multiple beneficial effects, including enhancement of gut barrier function, anti-inflammatory properties, and promotion of insulin sensitivity. The correlations observed between beneficial bacteria and protective metabolites, contrasted with associations between pathogenic bacteria and harmful metabolites, provide associative support for the gut-ovary axis hypothesis while underscoring the need for direct mechanistic validation.

The clinical implications of these findings should be interpreted within the limits of preclinical exploratory design. The results support further evaluation of ZeLan extract as a complementary approach for PCOS management, particularly in the context of botanical interventions that may affect both endocrine-metabolic indices and the intestinal microenvironment. Identification of microbial and metabolic biomarkers associated with treatment response may help guide future mechanistic and translational studies. In addition, the gut-ovary axis may eventually support combination strategies integrating ZeLan with probiotics or dietary modifications, but such strategies require controlled validation before clinical application.

Several limitations of the present study warrant acknowledgment. First, while the DHEA-induced rat model recapitulates several features of human PCOS, it does not fully capture the heterogeneity of human PCOS phenotypes, including lean, obese, insulin-resistant, and inflammatory subtypes; therefore, clinical translation requires validation in well-characterized patient populations. Second, the study used a single ZeLan dose without a dose-response gradient or a positive drug control such as metformin, so the effective dose range, comparative efficacy, and optimal administration cycle remain to be determined. Third, sampling was conducted only at the endpoint, limiting the interpretation of dynamic temporal changes in microbiota, metabolites, and hormone profiles during the intervention period. Fourth, ovarian histopathology, follicle counts, corpus luteum quantification, and serial estrous-cycle monitoring were not included in this experimental design; therefore, ovarian functional recovery was inferred from endocrine and metabolic indices rather than direct tissue-level and cycle-level assessment. Fifth, the study identified correlations between microbial taxa and metabolites but did not include fecal microbiota transplantation, germ-free animal experiments, targeted metabolite supplementation, inflammatory-marker assays, or ovarian steroidogenic enzyme measurements such as CYP17A1, CYP19A1, and StAR; consequently, causal mechanisms cannot be confirmed from the present data. Sixth, untargeted metabolomics provides discovery-level evidence, and targeted quantitative validation of key metabolites such as lithocholic acid, butyric acid, and testosterone is required in future work. Seventh, beta-diversity visualization, microbial functional prediction, and integrated microbiota-metabolite-gene pathway modeling were not available for the current submission, limiting the ability to construct a complete regulatory network. Finally, ZeLan extract was standardized by total flavonoid content, but comprehensive qualitative and quantitative phytochemical characterization of active monomers remains necessary.

In conclusion, ZeLan extract improved PCOS-related endocrine and metabolic phenotypes in a rat model and was associated with partial restoration of gut microbial alpha diversity, altered microbial composition, and modulation of serum metabolic pathways, including steroid hormone biosynthesis, bile acid metabolism, and short-chain fatty acid-related metabolism. The observed correlations between beneficial bacteria and protective metabolites, contrasted with associations between PCOS-enriched bacteria and harmful metabolites, support a biologically plausible gut-ovary axis association. These findings provide a foundation for future mechanistic and translational studies of ZeLan extract in PCOS management while emphasizing the need for causal validation and broader phytochemical characterization.

Disclosures

The authors have no conflicts of interest to declare.

Acknowledgements

This study was funded by the Hebei Provincial Administration of Traditional Chinese Medicine Scientific Research Planning Project (Grant No. 2021316).

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
AcetonitrileFisher Chemical / Thermo Fisher ScientificA955-4Optima LC-MS grade, 4 L; mobile phase and sample reconstitution
ACQUITY UPLC HSS T3 columnWaters Corporation186003539100 Å, 1.8 μm, 2.1 × 100 mm; UHPLC separation
Agarose gel electrophoresis systemBio-Rad Laboratories1704486Mini-Sub Cell GT horizontal electrophoresis system; DNA quality assessment
Agilent 1290 Infinity II/6550 UHPLC-Q-TOF-MSAgilent TechnologiesG7120A/G7167B/G7116B/G6550B1290 Infinity II UHPLC module set coupled to 6550 iFunnel Q-TOF MS; serum untargeted metabolomics platform
DADA2 algorithmBioconductorVersion 1.24.0ASV generation and chimera removal; version inferred to match R 4.2.1/Bioconductor 3.15 workflow
Dehydroepiandrosterone (DHEA)Sigma-Aldrich / MilliporeSigmaD4000PCOS model induction; 6 mg/100 g body weight; CAS 53-43-0
Distilled waterInvitrogen / Thermo Fisher Scientific10977015UltraPure DNase/RNase-Free Distilled Water; vehicle for oral gavage in Control and Model groups
Formic acidFisher Chemical / Thermo Fisher ScientificA117-50Optima LC-MS grade, 50 mL; 0.1% additive for LC-MS mobile phases
Human Metabolome DatabaseUniversity of Alberta / HMDBHMDB 5.0Metabolite annotation database
Illumina NovaSeq 6000 platformIllumina20012850Sequencing system used by sequencing service provider for paired-end 250 bp 16S rRNA sequencing
Lycopus lucidus Turcz. herbBeijing Tongrentang Chinese Medicine Co., Ltd.Batch ZL-20230315Authenticated botanical raw material for ZeLan aqueous extract
MethanolFisher Chemical / Thermo Fisher ScientificA456-4Optima LC-MS grade, 4 L; protein precipitation for serum metabolomics
METLIN databaseScripps ResearchMETLIN Classic 2023Metabolite mass-spectral annotation database
NanoDrop spectrophotometerThermo Fisher ScientificND-ONE-WNanoDrop One microvolume UV-Vis spectrophotometer; DNA quantity and purity assessment
QIAamp Fast DNA Stool Mini KitQiagen51604DNA extraction from cecal contents; 50-prep stool DNA kit
QIIME2QIIME2 development teamVersion 2022.216S rRNA sequence processing
R softwareR FoundationVersion 4.2.1Statistical analysis and XCMS processing
Serum ELISA kits for testosterone, LH, FSH, and insulinCusabio BiotechCSB-E05100r; CSB-E12654r; CSB-E06869r; CSB-E05070rRat testosterone, LH, FSH, and insulin ELISA kits for serum hormone and insulin quantification
Sesame oilSigma-Aldrich / MilliporeSigmaS3547Vehicle for DHEA injection
Sodium pentobarbitalSigma-Aldrich / MilliporeSigmaP3761Anesthesia; 50 mg/kg intraperitoneal
SPSS softwareIBM CorporationVersion 26.0Statistical analysis
Universal 16S rRNA primers 338F/806RSangon Biotech (Shanghai) Co., Ltd.Custom synthesis: 338F/806RAmplification of V3-V4 regions; 338F ACTCCTACGGGAGGCAGCAG, 806R GGACTACHVGGGTWTCTAAT
XCMS packageBioconductor / RVersion 3.18.0Peak detection, retention-time alignment, and integration
ZeLan extractIn-house aqueous extractBatch ZLE-20230402Oral gavage treatment; standardized total flavonoids ≥2.5%

References

  1. Joham AE, Norman RJ, Stener-Victorin E, et al. Polycystic ovary syndrome. Lancet Diabetes Endocrinol. 2022;10(9):668-680.
  2. Islam H, Masud J, Islam YN, et al. An update on polycystic ovary syndrome: a review of the current state of knowledge in diagnosis, genetic etiology, and emerging treatment options. Womens Health (Lond). 2022;18:17455057221117966.
  3. Azziz R, Carmina E, Chen Z, et al. Polycystic ovary syndrome. Nat Rev Dis Primers. 2016;2:16057.
  4. Fahs D, Salloum D, Nasrallah M, et al. Polycystic ovary syndrome: pathophysiology and controversies in diagnosis. Diagnostics (Basel). 2023;13(9):1559.
  5. Conway G, Dewailly D, Diamanti-Kandarakis E, et al. The polycystic ovary syndrome: a position statement from the European Society of Endocrinology. Eur J Endocrinol. 2014;171(4):P1-P29.
  6. Huddleston HG, Dokras A. Diagnosis and treatment of polycystic ovary syndrome. JAMA. 2022;327(3):274-275.
  7. Zhang J, Xin X, Zhang H, et al. The efficacy of Chinese herbal medicine in animal models of polycystic ovary syndrome: a systematic review and meta-analysis. Evid Based Complement Alternat Med. 2022;2022:4892215.
  8. Chen J, Na E, Lim SY. Effect of fractions from Lycopus lucidus Turcz. leaves on genomic DNA oxidation and matrix metalloproteinase activity. Comb Chem High Throughput Screen. 2022;25(10):1778-1784.
  9. Ślusarczyk S, Hajnos M, Skalicka-Woźniak K, et al. Antioxidant activity of polyphenols from Lycopus lucidus Turcz. Food Chem. 2009;113(1):134-138.
  10. Qi X, Yun C, Sun L, et al. Gut microbiota-bile acid-interleukin-22 axis orchestrates polycystic ovary syndrome. Nat Med. 2019;25(8):1225-1233.
  11. He FF, Li YM. Role of gut microbiota in the development of insulin resistance and the mechanism underlying polycystic ovary syndrome. J Ovarian Res. 2020;13(1):73.
  12. Chadchan SB, Singh V, Kommagani R. Female reproductive dysfunctions and the gut microbiota. J Mol Endocrinol. 2022;69(3):R81-R94.
  13. Puspitasari VD, Lestari ES, Pramono N. Testosterone induced Wistar rat model for gut microbiota dysbiosis of polycystic ovarian syndrome research. J Indones Med Assoc. 2024;74(3):132-140.
  14. Zhang J, Sun Z, Jiang S, et al. Probiotic Bifidobacterium lactis V9 regulates the secretion of sex hormones in polycystic ovary syndrome patients. mSystems. 2019;4(2):e00017-19.
  15. Xuan Y, Hong X, Zhou X, et al. The vaginal metabolomics profile with features of polycystic ovary syndrome: a pilot investigation in China. PeerJ. 2024;12:e18194.
  16. Hu M, Zhang Y, Guo X, et al. Hyperandrogenism and insulin resistance induce gravid uterine defects in association with mitochondrial dysfunction and aberrant ROS production. Endocrinology. 2019;160(9):2208-2223.
  17. Moini Jazani A, Nasimi Doost Azgomi H, Nasimi Doost Azgomi A, et al. A comprehensive review of clinical studies with herbal medicine on polycystic ovary syndrome (PCOS). DARU J Pharm Sci. 2019;27(2):863-877.
  18. McCartney CR, Marshall JC. Polycystic ovary syndrome. N Engl J Med. 2016;375(1):54-64.
  19. Cui Y, Zhang C, Li X, et al. Systematic review and meta-analysis of animal experiments on Bushen formulas for the treatment of polycystic ovary syndrome. Sci Rep. 2025;15(1):7648.
  20. Thackray VG. Sex, microbes, and polycystic ovary syndrome. Trends Endocrinol Metab. 2019;30(1):54-65.
  21. Torres PJ, Siakowska M, Banaszewska B, et al. Gut microbial diversity in women with polycystic ovary syndrome correlates with hyperandrogenism. J Clin Endocrinol Metab. 2018;103(4):1502-1511.
  22. Insenser M, Murri M, Del Campo R, et al. Gut microbiota and the polycystic ovary syndrome: influence of sex, sex hormones, and obesity. J Clin Endocrinol Metab. 2018;103(7):2552-2562.
  23. Guo Y, Qi Y, Yang X, et al. Association between polycystic ovary syndrome and gut microbiota. PLoS One. 2016;11(4):e0153196.
  24. Liu R, Zhang C, Shi Y, et al. Dysbiosis of gut microbiota associated with clinical parameters in polycystic ovary syndrome. Front Microbiol. 2017;8:324.
  25. Jobira B, Frank DN, Pyle L, et al. Obese adolescents with PCOS have altered biodiversity and relative abundance in gastrointestinal microbiota. J Clin Endocrinol Metab. 2020;105(6):e2134-e2144.
  26. Bai X, Ma J, Wu X, et al. Impact of visceral obesity on structural and functional alterations of gut microbiota in polycystic ovary syndrome (PCOS): a pilot study using metagenomic analysis. Diabetes Metab Syndr Obes. 2023;16:1-14.
  27. Rizk MG, Thackray VG. Intersection of polycystic ovary syndrome and the gut microbiome. J Endocr Soc. 2021;5(2):bvaa177.
  28. He S, Li H, Yu Z, et al. The gut microbiome and sex hormone-related diseases. Front Microbiol. 2021;12:711137.
  29. Chu W, Han Q, Xu J, et al. Metagenomic analysis identified microbiome alterations and pathological association between intestinal microbiota and polycystic ovary syndrome. Fertil Steril. 2020;113(6):1286-1298.
  30. Yurtdaş G, Akdevelioğlu Y. A new approach to polycystic ovary syndrome: the gut microbiota. J Am Coll Nutr. 2020;39(4):371-382.

Reprints and Permissions

Tags

ZeLan Treatment16S rRNA SequencingSerum MetabolomicsUHPLC-Q-TOF-MSMicrobial DiversitySteroid Hormones