Research Article

miR-486-3p Suppresses Malignant Phenotypes and is Associated with Reduced WNT5B, DVL1, and β-catenin Expression in Lung Adenocarcinoma Cells

23 views

DOI:

10.3791/71545

August 21st, 2026

* These authors contributed equally

In This Article

Summary

Forced miR-486-3p overexpression suppresses proliferation-associated activity, clonogenic growth, wound closure, and Matrigel traversal in A549 and H358 lung adenocarcinoma cells. These effects accompany reduced expression of WNT5B, DVL1, β-catenin, and BCL-2, indicating an in vitro association with Wnt-related changes without establishing direct targeting or pathway causality.

Abstract

Lung adenocarcinoma (LUAD) is the predominant histological subtype of non-small cell lung cancer and remains associated with substantial morbidity and mortality. Previous studies have identified tumor-suppressive functions of miR-486-3p in LUAD, but its relationship with WNT5B, DVL1, and β-catenin-related expression changes has not been clearly defined. Here, baseline miR-486-3p abundance was examined in A549 and H358 LUAD cells and compared with that in Beas-2b bronchial epithelial cells maintained under their respective routine conditions. Stable miR-486-3p-overexpressing models were generated by lentiviral transduction. Cell growth-associated activity, clonogenic growth, wound closure, and traversal of Matrigel-coated membranes were evaluated using Cell Counting Kit-8, colony-formation, wound-healing, and Transwell assays. WNT5B, DVL1, β-catenin, and BCL-2 protein abundance were assessed by Western blotting, and WNT5B, DVL1, CTNNB1, and BCL2 mRNA levels were additionally examined by RT-qPCR. Under the culture conditions used, miR-486-3p abundance was lower in A549 and H358 cells than in Beas-2b cells, and lentiviral transduction produced stable overexpression in both LUAD cell lines. Forced miR-486-3p overexpression reduced the CCK-8 signal, colony formation, wound closure, and Matrigel-coated membrane traversal and was accompanied by lower WNT5B, DVL1, total β-catenin, and BCL-2 protein abundance. RT-qPCR further showed lower WNT5B, DVL1, CTNNB1, and BCL2 transcript abundance in both LUAD cell lines after miR-486-3p overexpression. These findings support an in vitro association between forced miR-486-3p expression, attenuation of several malignant-cell readouts, and altered Wnt-related expression; however, they do not establish direct miRNA-target binding, pathway activity, or a causal linear signaling mechanism.

Introduction

Lung adenocarcinoma (LUAD) is the most common histological subtype of non-small cell lung cancer (NSCLC) and contributes substantially to lung cancer-related morbidity and mortality worldwide1,2,3,4,5. Molecular classification and targeted therapies have improved outcomes for selected patient groups, but advanced LUAD remains difficult to treat and is biologically heterogeneous1,2,3,4,5. Defining regulatory processes that contribute to malignant cell behavior, therefore, remains relevant to the development of testable therapeutic hypotheses.

Wnt signaling comprises β-catenin-dependent and β-catenin-independent branches that regulate proliferation, survival, polarity, and motility6,7,8,9. WNT5B is most often associated with noncanonical signaling, although its biological effects vary with receptor and cellular context10,11. DVL1 is a cytoplasmic signal-transduction protein shared by several Wnt branches and has been linked to β-catenin-related behavior in lung cancer12. Accordingly, concurrent changes in WNT5B, DVL1, and β-catenin should not by themselves be interpreted as evidence for a single linear pathway.

MicroRNAs (miRNAs) are short non-coding RNAs that regulate gene expression through sequence-dependent interactions with target transcripts13,14,15. Because one miRNA may affect multiple RNAs, altered miRNA abundance can influence diverse tumor-associated phenotypes13,14,15,16,17,18. Several miRNAs have been linked to lung cancer growth, motility, and signaling, and crosstalk between miRNAs and Wnt-related networks has been described in multiple cancer contexts16,17,18,19,20.

The MIR486 locus gives rise to the mature strands miR-486-3p and miR-486-5p. miR-486-3p has shown tumor-suppressive activity in oral cancer and glioblastoma, whereas a tumor-promoting effect has been reported in cutaneous squamous cell carcinoma21,22,23,24,25. miR-486-3p was selected for the present study through a hypothesis-driven strategy based on its reduced abundance in public LUAD data, its previously reported tumor-suppressive activity in LUAD, and bioinformatic predictions linking it to WNT-related candidate transcripts. Tomioka et al. demonstrated tumor-suppressive effects of both miR-486 strands in LUAD and identified GINS4 through genome-wide target screening26. Therefore, the present study does not claim the first demonstration of an antitumor phenotype. Instead, it evaluates whether forced miR-486-3p expression is accompanied by changes in WNT5B, DVL1, and β-catenin abundance and by reproducible phenotypic changes in two LUAD cell lines. These analyses assess associations and do not establish direct targeting, pathway activity, or a linear WNT5B/DVL1/β-catenin mechanism.

Protocol

The reagents and the equipment used are listed in the Table of Materials.

Cell culture

Human lung adenocarcinoma (LUAD) cell lines A549 and H358, and the immortalized bronchial epithelial cell line Beas-2b were used. A549 (KRAS G12S) and H358 (KRAS G12C; STK11-deficient) were selected as commonly used LUAD models with distinct KRAS-mutant backgrounds, whereas Beas-2b was included as a non-malignant bronchial epithelial comparator. A549 and H358 cells were maintained in RPMI-1640 medium, and Beas-2b cells were maintained in DMEM; each medium contained 10% fetal bovine serum and 1% penicillin-streptomycin. Cells were cultured at 37 °C in a humidified atmosphere containing 5% CO₂. Because the tumor and epithelial comparator cell lines were maintained in different routine media, cross-cell-line baseline expression comparisons were interpreted with caution.

Lentiviral transduction and stable cell selection

Lentiviral vectors carrying the hsa-miR-486-3p precursor (LV-miR-486-3p) or a scrambled negative-control sequence (LV-NC) were used in a stable gain-of-function design. A549 and H358 cells were seeded in 6-well plates at 5 × 104 cells/well and cultured overnight. The following day, cells were exposed to lentivirus at a multiplicity of infection (MOI) of 10 in the presence of 8 µg/mL polybrene. After 24 h, the viral inoculum was replaced with fresh complete medium. Transduced cells were selected with 2 µg/mL puromycin for 7 days. After selection, surviving cells were allowed to recover and were expanded for the subsequent molecular and functional assays. No miR-486-3p inhibitor arm was included because the present study was designed specifically to evaluate the effects of stable forced overexpression.

NOTE: The MOI, polybrene exposure time, and puromycin selection conditions must be kept identical between the LV-NC and LV-miR-486-3p groups to minimize treatment-related differences in cell viability.

RT-qPCR

RT-qPCR was conducted to determine miR-486-3p expression levels and to confirm the efficiency of lentiviral overexpression in A549 and H358 cells. Total RNA was isolated using TRIzol reagent in accordance with the manufacturer's instructions. RNA concentration and purity were evaluated spectrophotometrically, with an A260/A280 ratio of 1.8–2.1 considered acceptable. For mRNA analysis, 1 µg of total RNA was reverse-transcribed into cDNA using a commercial cDNA synthesis kit according to the manufacturer's protocol. For microRNA analysis, cDNA synthesis was performed using a miRNA-specific stem-loop reverse transcription primer. Quantitative PCR was carried out in a total reaction volume of 20 µL containing 10 µL of 2× SYBR Green Master Mix, 0.4 µM of each primer, and 2 µL of cDNA template. The amplification protocol consisted of an initial denaturation step at 95 °C for 5 min, followed by 40 cycles of denaturation at 95 °C for 10 s and annealing/extension at 60 °C for 30 s. A melting curve analysis was subsequently performed to verify amplification specificity. U6 small nuclear RNA served as the internal control for miRNA quantification, whereas GAPDH was used as the reference gene for mRNA normalization. Relative expression levels were determined using the 2−ΔΔCq method.

The miRNA primer sequences were as follows: stem-loop reverse-transcription primer, 5′-GTCGTATCGACTGCAGGGTCCGAGGTATTCGCAGTCGATACGAC
ATCCTG-3′; miR-486-3p forward primer, 5′-CGCGGGGCAGCTCAGTA-3′; universal reverse primer, 5′-ACTGCAGGGTCCGAGGTATT-3′; U6 forward primer, 5′-CTCGCTTCGGCAGCACA-3′; and U6 reverse primer, 5′-AACGCTTCACGAATTTGCGT-3′. Primer sequences for WNT5B, DVL1, CTNNB1, BCL2, and GAPDH, together with amplicon lengths and amplification efficiencies, are provided in Table 1. mRNA expression was normalized to GAPDH, whereas miR-486-3p expression was normalized to U6. Each experiment included three independent biological replicates, with three technical replicates per biological replicate.

Western blotting

After completion of the 7-day puromycin selection and a recovery period, cells were lysed in RIPA buffer containing protease inhibitors. Protein concentrations were determined using a BCA protein assay. Equal amounts of protein (20 µg per lane) were separated on 10% SDS-PAGE gels and transferred to PVDF membranes by wet transfer at 300 mA for 120 min. The membranes were blocked with 5% skim milk prepared in Tris-buffered saline containing 0.1% Tween-20 (TBST) for 1 h at room temperature. The membranes were incubated overnight at 4 °C with primary antibodies against WNT5B (1:1,000), DVL1 (1:1,000), β-catenin (1:1,000), BCL-2 (0.5 µg/mL), or β-actin (1:5,000). The manufacturers and catalog numbers of all antibodies are provided in the Table of Materials. After three 10-min washes with TBST, the membranes were incubated with an HRP-conjugated goat anti-rabbit IgG secondary antibody diluted 1:5,000 for 1 h at room temperature. The membranes were then washed three times with TBST, and protein bands were visualized using a chemiluminescent substrate and imaged with a gel documentation and imaging system. Band intensities were quantified using ImageJ. The abundance of each target protein was normalized to the corresponding β-actin signal from the same biological sample. Only exposures within the linear, non-saturated detection range were used for densitometric analysis. Three independent biological experiments were performed.

Cell Counting Kit-8 assay

A549 and H358 cells stably transduced with LV-NC or LV-miR-486-3p were seeded in 96-well plates at 1.5 × 104 cells/well in 100 µL of complete medium. After overnight attachment, the medium was replaced, and the 0-h absorbance was measured immediately after the addition of Cell Counting Kit-8 reagent. At 0 h, 24 h, 48 h, 72 h, and 96 h, 10 µL of reagent was added per well and incubated for 1 h at 37 °C before absorbance was read at 450 nm. For the revised time-course analysis, each group was normalized to its own 0-h value before plotting. Three independent biological experiments were performed, and technical wells within each experiment were averaged before statistical analysis.

Colony formation assay

Stably selected A549 and H358 cells were prepared as single-cell suspensions at 5 × 102 cells/mL. One milliliter of cell suspension was seeded into each well of a 6-well plate, followed by 3 mL of complete medium. Cells were cultured for 14 days, with medium replacement every 5 days. Colonies were washed with PBS, fixed with 4% paraformaldehyde for 20 min, stained with crystal violet for 20 min, washed, and air-dried. Colonies containing at least 50 cells were counted in ImageJ. Three independent biological experiments were performed.

NOTE: A uniform single-cell suspension and minimal plate disturbance during colony establishment are required to prevent artificial clustering of cells.

Cell migration assay

Stably transduced A549 and H358 cells were seeded in 6-well plates and cultured until a confluent monolayer formed. A straight scratch was generated with a sterile 10 µL pipette tip, detached cells were removed, and the same marked fields were imaged at 0 h, 24 h, 48 h, and 72 h. Wound area was measured in ImageJ, and wound closure was calculated as (area at 0 h − area at the indicated time point) / area at 0 h × 100%. Three independent biological experiments were performed. No pharmacologic proliferation blocker was used; therefore, this assay was interpreted as a measurement of wound closure rather than a migration-specific readout.

NOTE: Scratches should be generated with consistent width and pressure, and identical fields should be followed throughout the time course.

Cell invasion assay

Transwell invasion assays were performed using 24-well polycarbonate membrane inserts with an 8 µm pore size. The upper surface of each insert was coated with 100 µL of Matrigel basement membrane matrix diluted 1:8 in serum-free DMEM to an approximate final protein concentration of 1 mg/mL and incubated at 37 °C for 4 h. A549 and H358 cells were resuspended in serum-free RPMI-1640 medium at densities of 8 × 105 cells/mL and 4 × 105 cells/mL, respectively. A 200 µL aliquot of the cell suspension was added to the upper chamber, corresponding to 1.6 × 105 A549 cells or 8 × 104 H358 cells per insert. The lower chamber was filled with 500 µL of RPMI-1640 medium containing 20% fetal bovine serum as a chemoattractant. After incubation at 37 °C in a humidified atmosphere containing 5% CO₂ for 48 h, non-invading cells remaining on the upper surface of the membrane were gently removed with a cotton swab. Cells that had invaded through the membrane were fixed with 4% paraformaldehyde for 20 min and stained with 0.1% crystal violet for 20 min at room temperature. Five randomly selected microscopic fields were imaged for each insert, and the number of invaded cells was quantified using ImageJ. The mean cell count from the five fields was considered one value for each insert, and the insert, rather than an individual microscopic field, was treated as the experimental unit. Three independent biological experiments were performed.

NOTE: Remove the non-invading cells gently and consistently to avoid damaging the membrane or dislodging cells that have migrated to its lower surface.

Statistical analysis

Data are presented as mean ± SD, and n denotes independent biological experiments unless otherwise specified. Technical replicates or multiple microscopic fields from the same experimental unit were averaged before inferential testing. For the three-cell-line comparison, one-way analysis of variance followed by Tukey-adjusted pairwise comparisons were used. For CCK-8 and wound-closure time courses, two-way repeated-measures analysis of variance was used to evaluate treatment, time, and treatment-by-time interaction effects, followed by Šídák-adjusted comparisons at individual time points. Two-group comparisons were analyzed using two-sided unpaired Student’s t-tests. Statistical analyses and data visualization were performed using statistical analysis and graphing software. Exact p-values are reported in the figure panels or source-data tables. Statistical significance was defined as p < 0.05; *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001.

Results

TCGA/starBase analysis shows reduced miR-486-3p abundance in LUAD, and TargetScan identifies candidate binding sites

TCGA-derived expression data accessed through starBase v3.0 showed that miR-486-3p abundance was significantly lower in 512 lung adenocarcinoma (LUAD) samples than in 20 non-tumor lung samples (Wilcoxon rank-sum test, p = 3.2 × 10⁻5; Figure 1). TargetScanHuman identified a poorly conserved candidate 7mer-m8 site for miR-486-3p at positions 468–474 of the DVL1 3′ untranslated region (3′ UTR), with a context++ score of −0.23 and a context++ score percentile of 80. A poorly conserved candidate 8mer site was identified at positions 913–920 of the WNT5B 3′ UTR, with a context++ score of −0.46 and a context++ score percentile of 97 (Figure 2). These computationally predicted sites were used to generate the experimental hypothesis and were not considered evidence of direct miRNA–target binding. Source URLs are provided in Table 2.

miR-486-3p abundance is reduced in LUAD cell lines and markedly increased after lentiviral transduction

Under their respective routine culture conditions, RT-qPCR analysis showed that miR-486-3p abundance was lower in A549 and H358 cells than in Beas-2b bronchial epithelial cells. Tukey-adjusted comparisons following one-way analysis of variance showed significant differences between A549 and Beas-2b cells (p < 0.01) and between H358 and Beas-2b cells (p < 0.001; Figure 3A).

Stable transduction with LV-miR-486-3p markedly increased miR-486-3p abundance relative to the corresponding LV-NC groups. Expression increased by approximately 1,470-fold in A549 cells and 220-fold in H358 cells, with both comparisons reaching statistical significance (p < 0.001; Figure 3B,C). These results confirmed the successful establishment of stable miR-486-3p-overexpressing cell models.

Forced miR-486-3p expression is associated with reduced WNT5B, DVL1, β-catenin, and BCL-2 expression

Western blotting showed lower WNT5B, DVL1, total β-catenin, and BCL-2 protein abundance in LV-miR-486-3p-transduced cells than in the respective LV-NC controls (Figure 4A–E). In A549 cells, forced miR-486-3p expression was associated with reduced β-catenin (p = 0.022), WNT5B (p = 0.0008), DVL1 (p = 0.019), and BCL-2 (p = 0.0017) protein abundance. Corresponding reductions were also observed in H358 cells for β-catenin (p = 0.001), WNT5B (p = 0.0002), DVL1 (p = 0.0003), and BCL-2 (p = 0.0018).

RT-qPCR was subsequently performed to determine whether transcript-level changes accompanied the protein findings (Figure 4F–I). In A549 cells, forced miR-486-3p expression reduced CTNNB1 mRNA to 0.226-fold relative to the LV-NC group (p = 0.004), WNT5B mRNA to 0.180-fold (p = 0.004), DVL1 mRNA to 0.278-fold (p = 0.006), and BCL2 mRNA to 0.259-fold (p = 0.003).

Similar transcript-level changes were detected in H358 cells. CTNNB1 mRNA was reduced to 0.288-fold relative to the LV-NC group (p = 0.028), WNT5B mRNA to 0.250-fold (p = 0.019), DVL1 mRNA to 0.271-fold (p = 0.020), and BCL2 mRNA to 0.534-fold (p = 0.003). Thus, the direction of the transcript-level changes was consistent with the corresponding protein-level findings in both cell lines. These results demonstrate coordinated expression changes but do not establish direct targeting or the activity of a linear WNT5B/DVL1/β-catenin signaling mechanism.

Forced miR-486-3p expression reduces the growth-associated CCK-8 signal

CCK-8 measurements were normalized to the corresponding 0-h value for each experimental group. The normalized CCK-8 signal increased over time in both LV-NC- and LV-miR-486-3p-transduced cells, but lower values were generally observed following forced miR-486-3p expression (Figure 5).

In A549 cells, Šídák-adjusted comparisons following two-way repeated-measures analysis of variance showed significantly lower CCK-8 signals in the LV-miR-486-3p group at 24, 48, and 96 h than in the LV-NC group (p < 0.05), whereas the difference at 72 h was not statistically significant (Figure 5A). In H358 cells, the CCK-8 signal was significantly lower in the LV-miR-486-3p group at 24, 48, 72, and 96 h (p < 0.05; Figure 5B). These findings indicate that forced miR-486-3p expression reduced growth-associated metabolic activity, with a more consistent effect across the H358 time course.

Forced miR-486-3p expression reduces clonogenic growth

Colony-formation assays were performed to assess long-term clonogenic growth. A549 cells transduced with LV-miR-486-3p formed significantly fewer colonies than the corresponding LV-NC cells (p = 0.013; Figure 6A). A significant reduction in colony number was also observed in H358 cells (p = 0.006; Figure 6B). The reduction was more pronounced in H358 cells than in A549 cells, indicating that the magnitude of the clonogenic effect differed between the two LUAD models.

Forced miR-486-3p expression reduces wound closure

Wound closure was quantified at 24 h, 48 h, and 72 h after scratching (Figure 7). In A549 cultures, the LV-miR-486-3p group showed significantly lower wound closure than the LV-NC group at 24, 48, and 72 h (p < 0.05 for each comparison; Figure 7A,C).

Similarly, wound closure was reduced in LV-miR-486-3p-transduced H358 cultures at 24 h and 48 h (p < 0.05) and at 72 h (p < 0.01; Figure 7B,D). Because the assay was conducted without a pharmacological proliferation inhibitor, these results were interpreted as reduced wound closure rather than as evidence of an exclusively migration-specific effect.

Forced miR-486-3p expression reduces traversal of Matrigel-coated membranes

The ability of the cells to traverse Matrigel-coated Transwell membranes was evaluated after 48 h. Significantly fewer crystal-violet-stained cells were detected on the lower membrane surface in the A549 LV-miR-486-3p group than in the A549 LV-NC group (p = 0.0001; Figure 8A). A similar reduction was observed in H358 cells (p = 0.0007; Figure 8B).

Five microscopic fields were averaged for each insert, and the insert was treated as the experimental unit. These findings demonstrate reduced traversal of Matrigel-coated membranes following forced miR-486-3p expression under the conditions used in this assay.

DATA AVAILABILITY:

All source data underlying the figures are included in Supplementary File 1, including database source files, RT-qPCR data, uncropped Western blots, densitometry values, microscopy images, counting records, CCK-8 measurements, and statistical analysis files.

Box plot comparing hsa-miR-486-3p expression in cancer vs. normal lung tissue; P value=3.2e-5.
Figure 1: miR-486-3p abundance in LUAD and normal lung samples from TCGA/starBase. TCGA-derived expression data were retrieved through starBase v3.0 in May 2026 and included 512 lung adenocarcinoma (LUAD) samples and 20 normal lung samples. Groups were compared using the Wilcoxon rank-sum test (p = 3.2 × 10⁻5). LUAD, lung adenocarcinoma. Please click here to view a larger version of this figure.

mRNA-miRNA interaction analysis table; includes site types, context scores, and conservation metrics.
Figure 2: TargetScan-predicted candidate miR-486-3p-binding sites in the DVL1 and WNT5B 3′ UTRs. TargetScanHuman identified a candidate 7mer-m8 site at positions 468–474 of the DVL1 3′ untranslated region (3′ UTR) and a candidate 8mer site at positions 913–920 of the WNT5B 3′ UTR. Source URLs are provided in Table 2. These computational predictions were used for hypothesis generation and do not constitute experimental evidence of direct binding. Please click here to view a larger version of this figure.

Bar graph of miR-486-3p expression; statistical significance; comparative RNA analysis; three cell lines.
Figure 3: Baseline miR-486-3p abundance and verification of lentiviral overexpression. (A) RT-qPCR analysis of miR-486-3p abundance in A549, H358, and Beas-2b cells maintained in their respective routine culture media. (B,C) RT-qPCR verification of miR-486-3p overexpression in A549 (B) and H358 (C) cells transduced with LV-NC or LV-miR-486-3p. Expression was normalized to U6. Data are presented as mean ± SD from three independent biological experiments. (A) was analyzed by one-way ANOVA followed by Tukey-adjusted multiple comparisons. (B,C) were analyzed using two-sided unpaired Student’s t-tests. *p < 0.01; **p < 0.001. LV-NC, negative-control lentivirus; RT-qPCR, reverse-transcription quantitative PCR; SD, standard deviation. Please click here to view a larger version of this figure.

Western blot and bar graphs analyzing protein and mRNA levels in A549, H358 cells, miR-486-5p study.
Figure 4: Forced miR-486-3p expression is associated with reduced candidate-gene expression. (A) Representative Western blots showing β-catenin, WNT5B, DVL1, BCL-2, and β-actin abundance in A549 and H358 cells transduced with LV-NC or LV-miR-486-3p. Molecular masses are indicated in kilodaltons. (B–E) Densitometric quantification of β-catenin (B), WNT5B (C), DVL1 (D), and BCL-2 (E), normalized to β-actin. (F–I) RT-qPCR analysis of CTNNB1 (F), WNT5B (G), DVL1 (H), and BCL2 (I) transcript abundance, normalized to GAPDH. Data are presented as mean ± SD from three independent biological experiments; individual points represent independent biological replicates. Groups were compared using two-sided unpaired Student’s t-tests. Exact p-values and fold changes are provided in the corresponding panels. kDa, kilodaltons; LV-NC, negative-control lentivirus; RT-qPCR, reverse-transcription quantitative PCR; SD, standard deviation. Please click here to view a larger version of this figure.

Cell proliferation assay graph; OD vs. time for LV-miR-486-3p impact on A549 and H358 cells.
Figure 5: Forced miR-486-3p expression reduces growth-associated CCK-8 signals over time. A549 (A) and H358 (B) cells transduced with LV-NC or LV-miR-486-3p were analyzed at 0 h, 24 h, 48 h, 72 h, and 96 h. OD450 values were normalized to the corresponding 0-h value within each group. Data are presented as mean ± SD from three independent biological experiments. The effects of treatment, time, and the treatment-by-time interaction were analyzed using two-way repeated-measures ANOVA, followed by Šídák-adjusted comparisons between groups at each time point. *p < 0.05. CCK-8, Cell Counting Kit-8; LV-NC, negative-control lentivirus; OD450, optical density at 450 nm; SD, standard deviation. Please click here to view a larger version of this figure.

Colony formation assay results with A549, H358 cells, miR-486-3p expression; bar graph analysis.
Figure 6: Forced miR-486-3p expression reduces clonogenic growth. Representative whole-well images and quantitative colony counts are shown for A549 (A) and H358 (B) cells transduced with LV-NC or LV-miR-486-3p. Colonies were quantified using ImageJ with identical analysis settings for all groups. Data are presented as mean ± SD from three independent biological experiments and were analyzed using two-sided unpaired Student’s t-tests. Exact p-values are provided in the corresponding panels. LV-NC, negative-control lentivirus; SD, standard deviation. Please click here to view a larger version of this figure.

Wound healing assay, A549/H358 cells, miR-486-3p effect, time-lapse microscopy, bar charts.
Figure 7: Forced miR-486-3p expression reduces wound closure. Representative images and quantitative wound-closure measurements are shown for A549 (A,C) and H358 (B,D) cells at 0 h, 24 h, 48 h, and 72 h after scratching. Wound closure was calculated as follows: (wound area at 0 h − wound area at the indicated time point) / wound area at 0 h × 100%. Data are presented as mean ± SD from three independent biological experiments. The effects of treatment, time, and the treatment-by-time interaction were analyzed using two-way repeated-measures ANOVA, followed by Šídák-adjusted comparisons between groups at each time point. Scale bars, 200 µm. *p < 0.05; **p < 0.01. LV-NC, negative-control lentivirus; SD, standard deviation. Please click here to view a larger version of this figure.

Cell proliferation analysis, microscopy of A549/H358 cells, bar graph comparison, miR-486-3p study.
Figure 8: Forced miR-486-3p expression reduces traversal of Matrigel-coated Transwell membranes. Representative crystal-violet-stained microscopic fields and quantitative insert-level cell counts are shown for A549 (A) and H358 (B) cells transduced with LV-NC or LV-miR-486-3p. Transwell inserts with an 8-µm pore size were used. Five microscopic fields were averaged for each insert, and each insert was treated as one experimental unit. Data are presented as mean ± SD from three independent biological experiments and were analyzed using two-sided unpaired Student’s t-tests. Scale bars, 200 µm. Exact p-values are provided in the corresponding panels. LV-NC, negative-control lentivirus; SD, standard deviation. Please click here to view a larger version of this figure.

GenePrimer sequencesAmplicon lengthsAmplification efficiencies
WNT5BForward: 5'-AAATGCCACGGCGTCTCG-3',118 bp101%
Reverse: 5'-GGGTGAAGCGGCTGTTGA-3'
DVL1Forward: 5'-GAGGGTGCTCACTCGGATG-3',158 bp95.60%
Reverse: 5'-GTGCCTGTCTCGTTGTCCA-3'
CTNNB1Forward: 5'- GCGCCATTTTAAGCCTCTCG -3',140 bp96.30%
Reverse: 5'-AAATACCCTCAGGGGAACAGG-3'
BCL2Forward: 5'- GTCATGTGTGTGGAGAGCGT-3',139 bp97.20%
Reverse: 5'-ATAGTTCCACAAAGGCATCC-3'
GAPDHForward: 5'-GACTTCAACAGCAACTCCCACTC-3',107 bp98.30%
Reverse: 5'-TAGCCGTATTCATTGTCATACCAG-3'

Table 1: Primer sequences used for RT-qPCR.

TargetPrediction informationSource
DVL17mer-m8, positions 468–474TargetScan URL (https://www.targetscan.org/cgi-bin/targetscan/vert_80/view_gene.cgi?
rs=ENST00000397196.2&taxid=9606&members=miR-486-3p&showcnc=1&
shownc=1&shownc_nc=1&showncf1=1&showncf2=1&subset=1)
WNT5B8mer, positions 913–920TargetScan URL (https://www.targetscan.org/cgi-bin/targetscan/vert_80/view_gene.cgi?
rs=ENST00000378891.5&taxid=9606&members=miR-486-3p&showcnc=1&
shownc=1&shownc_nc=1&showncf1=1&showncf2=1&subset=1)

Table 2: TargetScan database and corresponding URL.

Supplementary File 1: Data supporting the findings of this study.Please click here to download this file.

Discussion

The present gain-of-function study evaluated the effects of stable, forced miR-486-3p expression in A549 and H358 lung adenocarcinoma (LUAD) cells. In both models, miR-486-3p overexpression was associated with reduced growth-associated CCK-8 signals, decreased clonogenic growth, lower wound closure, and fewer cells traversing Matrigel-coated Transwell membranes. These phenotypic changes were accompanied by reduced WNT5B, DVL1, total β-catenin, and BCL-2 protein abundance, together with lower WNT5B, DVL1, CTNNB1, and BCL2 transcript levels. Collectively, these findings support an association between forced miR-486-3p expression, attenuation of several malignant cell phenotypes, and coordinated changes in selected Wnt-related molecules. However, they do not establish direct miRNA–target binding, pathway activity, or a causal signaling sequence.

The general tumor-suppressive phenotype observed in this study is consistent with previous reports and should not be interpreted as the principal novel finding. Tomioka et al. previously demonstrated that both miR-486-3p and miR-486-5p suppress malignant phenotypes in LUAD cells and identified GINS4 through an unbiased target-screening strategy26. The contribution of the present study is more specific: forced miR-486-3p expression was accompanied by reductions in WNT5B, DVL1, and β-catenin abundance in two LUAD cell models. In addition, the study provides an integrated experimental workflow combining stable lentiviral transduction, RT-qPCR, Western blotting, CCK-8 analysis, colony formation, wound closure, and Matrigel-coated Transwell assays. This distinction is important because the present work extends the molecular observations associated with miR-486-3p overexpression without claiming the first demonstration of its antitumor activity in LUAD.

The Wnt-related findings require cautious interpretation. WNT5B is commonly described as a noncanonical Wnt ligand and may activate planar-cell-polarity or Wnt/Ca2⁺ signaling in a receptor- and context-dependent manner. In some cellular settings, noncanonical Wnt signaling may also antagonize β-catenin-dependent signaling10,11. DVL1 is a shared intracellular mediator that can participate in both canonical and noncanonical Wnt signaling and has been associated with β-catenin-related phenotypes in non-small cell lung cancer12. Therefore, the simultaneous reduction of WNT5B, DVL1, and total β-catenin does not demonstrate a linear WNT5B→DVL1→β-catenin pathway. The present data instead indicate concomitant reductions in WNT5B expression and in DVL1 and β-catenin abundance after forced miR-486-3p expression.

The transcript-level results were directionally consistent with the Western blot findings. Forced miR-486-3p expression reduced WNT5B, DVL1, and CTNNB1 transcript abundance in both A549 and H358 cells. This concordance suggests that the observed protein changes may be accompanied by altered transcript abundance rather than resulting exclusively from changes in protein stability. Nevertheless, reduced transcript and protein levels do not establish direct binding of miR-486-3p to the predicted 3′ untranslated regions. Dual-luciferase reporter assays using wild-type and mutant binding sites, together with rescue experiments, would be required to determine whether WNT5B or DVL1 is directly regulated by miR-486-3p. Similarly, the reduction in BCL-2 abundance indicates an alteration in a survival-associated protein but cannot, in the absence of validated cell-death assays, be interpreted as evidence of increased apoptosis.

The functional assays also have assay-specific limitations. CCK-8 measures cellular metabolic activity rather than directly determining cell number, and changes in absorbance may reflect alterations in proliferation, metabolism, or viability. Colony formation provides a longer-term measure of clonogenic capacity, but the magnitude of the effect differed between the two cell lines, with a modest reduction in A549 cells and a larger reduction in H358 cells. This difference suggests that the response to forced miR-486-3p expression may depend on the molecular and cellular context.

Reduced wound closure was observed in both cell lines, but no proliferation inhibitor was used during the assay. Because forced miR-486-3p expression also affected growth-associated measurements, reduced proliferation may have contributed to the wound-closure phenotype. The findings should therefore be interpreted as reduced wound closure rather than as a migration-specific effect. Similarly, the 48-h Matrigel-coated Transwell assay may be influenced by differences in membrane traversal, proliferation, survival, or adhesion. The observed reduction in cells on the lower membrane surface consequently supports impaired traversal under the tested conditions but does not isolate a specific invasion mechanism.

An additional consideration is the magnitude of miR-486-3p overexpression. Lentiviral transduction increased miR-486-3p abundance by approximately 1,470-fold in A549 cells and 220-fold in H358 cells relative to the corresponding control groups. Such supraphysiological expression may increase seed-dependent off-target repression, affect the availability of components of the RNA-induced silencing complex, or induce nonspecific cellular stress. Because no dose-response series was performed, the relationship between miR-486-3p abundance and the observed phenotypes could not be defined. Furthermore, the absence of an inhibitor-based loss-of-function experiment prevents conclusions regarding the endogenous physiological role of miR-486-3p in LUAD cells. The present results should therefore be interpreted specifically as the consequences of stable forced overexpression.

Several limitations should be considered. Only two KRAS-mutant LUAD cell lines were examined, and the use of different routine media limits the interpretation of comparisons with Beas-2b cells. Cell-line authentication and mycoplasma testing were not performed during the study, and U6 was used as the sole reference for miR-486-3p quantification. The study also lacked loss-of-function, dose-response, reporter, rescue, and functional Wnt-pathway assays. Moreover, wound-closure and Transwell results may have been influenced by differences in proliferation, viability, or adhesion. Finally, no animal models, patient specimens, or clinical validation cohorts were included. Therefore, the findings are limited to this forced-expression in vitro system and do not establish direct targeting, pathway causality, or clinical utility.

In conclusion, stable forced miR-486-3p expression reduced several growth- and motility-associated measurements in A549 and H358 LUAD cells and was accompanied by lower WNT5B, DVL1, total β-catenin, and BCL-2 expression. These findings provide a basis for further mechanistic investigation but do not establish WNT5B or DVL1 as direct targets, a linear WNT5B/DVL1/β-catenin pathway, or the clinical value of miR-486-3p.

Disclosures

The authors have no conflicts of interest to declare.

Acknowledgements

The Zhejiang Provincial Medical and Health Science and Technology Plan (2025KY349) and the Jiaxing City Key Supporting Discipline (2023-zc-014) provided financial support for this study.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
1 M Tris-HCl (pH 6.8)SolarbioT1020Preparation of SDS-PAGE stacking gel
1.5 M Tris-HCl (pH 8.8)SolarbioT1010Preparation of SDS-PAGE resolving gel
20× TBS bufferSolarbio71080Stock buffer for western blot washing and antibody dilution
30% acrylamide/bis-acrylamide solution (29:1)SolarbioA1010Preparation of SDS-PAGE gels
4% paraformaldehyde fixativeServicebioG1101Fixation for colony-formation and Transwell assays
5× protein loading bufferBeyotimeP0015Protein sample preparation for SDS-PAGE
Ammonium persulfateSolarbio427A038SDS-PAGE gel polymerization initiator
BCA Protein Assay KitBeyotimeP0009-1Protein concentration determination
BCL-2 antibodyBoster Biological TechnologyA00040-2Rabbit polyclonal antibody; western blotting at 1:5,000
Cell Counting Kit-8 (CCK-8)TargetMolC0005Cell growth-associated metabolic activity assay; 10 μL per 100 μL culture medium
Chemiluminescence imaging systemBio-RadChemiDoc MPWestern blot imaging
ChloroformServicebioG3005Phase separation during TRIzol-based RNA extraction
Crystal violet staining solutionServicebioG1014Colony and Transwell membrane staining
DMEMServicebioG4511Routine culture medium for Beas-2b cells
DVL1 antibodySignalway Antibody53180Rabbit primary antibody; western blotting at 1:5,000
Fetal bovine serum (FBS)BiosharpBL203B10% (v/v) supplement for routine cell culture; 20% (v/v) in the Transwell lower chamber
GraphPad Prism 8GraphPad SoftwareVersion 8Graph preparation and statistical analysis
Hieff qPCR SYBR Green Master Mix (No Rox)Yeasen Biotechnology11201ES08SYBR Green-based quantitative PCR
Hifair III 1st Strand cDNA Synthesis SuperMix for qPCR (gDNA digester plus)Yeasen Biotechnology11141ES60Reverse transcription for mRNA RT-qPCR
IBM SPSS StatisticsIBMVersion 22.0Statistical analysis
ImageJNational Institutes of HealthVersion 1.53Western blot densitometry, wound-area measurement, colony counting, and Transwell cell counting
Inverted microscopeOlympusCKX53Imaging of wound-healing and Transwell assays
IsopropanolServicebioG3006RNA precipitation during TRIzol-based extraction
LV-miR-486-3p and LV-NC lentiviral preparationsGenePharmaCustom synthesisStable miR-486-3p overexpression vector and scrambled negative-control vector
Matrigel basement membrane matrixCorning354234Diluted 1:8 in serum-free DMEM; approximately 1 mg/mL final protein concentration
MethanolXilong ScientificGB/T 683-2006PVDF membrane activation
Microplate readerBioTekELx800Measurement of absorbance at 450 nm
Microvolume UV-Vis spectrophotometerAllshengNano-600RNA concentration and A260/A280 purity assessment
Penicillin-streptomycinGibco, Thermo Fisher Scientific152400621% (v/v) supplement for routine cell culture
Phosphate-buffered saline (PBS)ServicebioG0002Cell and membrane washing
Protease Inhibitor CocktailAPExBIOK1007Added to RIPA lysis buffer
Protein ladderBiosharpBL712AMolecular-weight reference for western blotting
PVDF membraneMilliporeK2MA8350EProtein transfer membrane for western blotting
QuantStudio 5 Real-Time PCR SystemThermo Fisher ScientificQuantStudio 5RT-qPCR data acquisition
RIPA lysis bufferBeyotimeP0013BTotal cellular protein extraction
RNA extraction reagent (TRIzol-type)ServicebioG3013Total RNA extraction
RPMI 1640 mediumServicebioG4510Routine culture medium for A549 and H358 cells and serum-free Transwell cell suspension
SDSSolarbioS8010SDS-PAGE reagent
Skim milk powderBD22714705% blocking solution for western blotting
StarBase v3.0Sun Yat-sen Universityhttps://rnasysu.com/encori/TCGA-derived miR-486-3p expression analysis
TargetScanHumanWhitehead Institute for Biomedical Researchhttps://www.targetscan.org/vert_80/Prediction of candidate miR-486-3p binding sites
TEMEDSigma-AldrichT8090SDS-PAGE gel polymerization catalyst
Transwell inserts, 24-well, 8 μm pore sizeCorning3428Matrigel-coated membrane traversal assay
TrypsinServicebioG4000Cell detachment
Tween-20Solarbio815A043Preparation of western blot wash buffer
Vertical electrophoresis systemLiuyi BiotechnologyDYCZ-24DNSDS-PAGE protein separation
Western HRP substrate luminol reagentAffinity BiosciencesKF001Chemiluminescent western blot detection
Wet transfer systemBio-Rad1703930Protein transfer to PVDF membrane
WNT5B antibodySignalway Antibody56808Rabbit primary antibody; western blotting at 1:5,000
β-actin antibodyAbcamab8227Loading control; western blotting at 1:5,000
β-catenin antibodySignalway Antibody21725Rabbit primary antibody; western blotting at 1:5,000

References

  1. Herbst RS, Heymach JV, Lippman SM. Lung cancer. N Engl J Med. 2008;359(13):1367-1380.
  2. Siegel RL, Miller KD, Jemal A. Cancer statistics, 2019. CA Cancer J Clin. 2019;69(1):7-34.
  3. Han B, et al. Cancer incidence and mortality in China, 2022. J Natl Cancer Cent. 2024;4(1):47-53.
  4. Lin JJ, et al. Five-year survival in EGFR-mutant metastatic lung adenocarcinoma treated with EGFR-TKIs. J Thorac Oncol. 2016;11(4):556-565.
  5. She J, Yang P, Hong Q, Bai C. Lung cancer in China: challenges and interventions. Chest. 2013;143(4):1117-1126.
  6. Barker N, Clevers H. Mining the Wnt pathway for cancer therapeutics. Nat Rev Drug Discov. 2006;5(12):997-1014.
  7. Komiya Y, Habas R. Wnt signal transduction pathways. Organogenesis. 2008;4(2):68-75.
  8. Stewart DJ. Wnt signaling pathway in non-small cell lung cancer. J Natl Cancer Inst. 2014;106(1):djt356.
  9. Zhang Z, et al. Wnt/β-catenin signaling in the development and therapeutic resistance of non-small cell lung cancer. J Transl Med. 2024;22(1):565.
  10. Zhang Q, et al. WNT5B exerts oncogenic effects and is negatively regulated by miR-5587-3p in lung adenocarcinoma progression. Oncogene. 2020;39(7):1484-1497.
  11. Suthon S, et al. WNT5B in physiology and disease. Front Cell Dev Biol. 2021;9:667581.
  12. Ji H, et al. SPATA2 suppresses epithelial-mesenchymal transition to inhibit metastasis and radiotherapy sensitivity in non-small cell lung cancer via. impairing DVL1/β-catenin signaling. Thorac Cancer. 2023;14(11):969-982.
  13. Wang Y, Wang L, Chen C, Chu X. New insights into the regulatory role of microRNA in tumor angiogenesis and clinical implications. Mol Cancer. 2018;17(1):22.
  14. Iqbal MA, Arora S, Prakasam G, Calin GA, Syed MA. MicroRNA in lung cancer: role, mechanisms, pathways and therapeutic relevance. Mol Aspects Med. 2019;70:3-20.
  15. Lee YS, Dutta A. MicroRNAs in cancer. Annu Rev Pathol. 2009;4:199-227.
  16. Lin G, et al. MiR-26a enhances invasive capacity by suppressing GSK3β in human lung cancer cells. Exp Cell Res. 2017;352(2):364-374.
  17. Jiang W, et al. MicroRNA-1258 suppresses tumor progression via. GRB2/Ras/Erk pathway in non-small-cell lung cancer. Cell Prolif. 2018;51(6):e12502.
  18. Xie Y, Xue C, Guo S, Yang L. MicroRNA-520a suppresses pathogenesis and progression of non-small-cell lung cancer through targeting the RRM2/Wnt axis. Anal Cell Pathol (Amst). 2021;2021:9652420.
  19. Peng Y, Zhang X, Feng X, Fan X, Jin Z. The crosstalk between microRNAs and the Wnt/β-catenin signaling pathway in cancer. Oncotarget. 2017;8(8):14089-14106.
  20. Wang X, et al. MiR-214 inhibits cell growth in hepatocellular carcinoma through suppression of β-catenin. Biochem Biophys Res Commun. 2012;428(4):525-531.
  21. Lulli V, et al. MicroRNA-486-3p regulates γ-globin expression in human erythroid cells by directly modulating BCL11A. PLoS One. 2013;8(4):e60436.
  22. Chou ST, et al. MicroRNA-486-3p functions as a tumor suppressor in oral cancer by targeting DDR1. J Exp Clin Cancer Res. 2019;38(1):281.
  23. Wu H, et al. Overexpression of miR-486-3p promoted by allicin enhances temozolomide sensitivity in glioblastoma via. targeting MGMT. Neuromolecular Med. 2020;22(3):359-369.
  24. Garajei A, et al. Evaluation of the expression of miR-486-3p, miR-548-3p, miR-561-5p and miR-509-5p in tumor biopsies of patients with oral squamous cell carcinoma. Pathogens. 2022;11(2):211.
  25. Li X, et al. MicroRNA-486-3p promotes the proliferation and metastasis of cutaneous squamous cell carcinoma by suppressing flotillin-2. J Dermatol Sci. 2022;105(1):18-26.
  26. Tomioka Y, et al. The molecular pathogenesis of tumor-suppressive miR-486-5p and miR-486-3p target genes: GINS4 facilitates aggressiveness in lung adenocarcinoma. Cancers (Basel). 2023;15(13):3408.

Reprints and Permissions

Tags

WNT5B ExpressionDVL1 ExpressionBeta CateninLentiviral TransductionColony FormationWound Healing AssayWestern BlotRT qPCR