Research Article

Yangjing Capsule Alleviates Spermatogenic Dysfunction in Mice by Inhibiting the QKI-5/p38 MAPK Pathway Through Upregulation of IncRNA NONMMUT031883.2

11 views

⸱

DOI:

10.3791/73166

⸱

August 28th, 2026

 ,  ,  ,  , 
1Department of Andrology, The Affiliated Hospital of Nanjing University of Chinese Medicine/Jiangsu Provincial Hospital of Chinese Medicine, 2Medical College of Qinghai University, 3Department of Traditional Chinese Medicine, Zhongda Hospital, School of Medicine, Southeast University, 4Anorectal Surgery, Jiangbei Branch of Zhongda Hospital, School of Medicine, Southeast University, 5Department of Andrology, Shaanxi Provincial Hospital of Traditional Chinese Medicine

In This Article

Summary

This study evaluates the protective effects of Yangjing Capsule on cyclophosphamide-induced spermatogenic dysfunction in mice and examines the involvement of the lncRNA NONMMUT031883.2/QKI-5/p38 MAPK signaling pathway.

Abstract

Spermatogenic dysfunction is an important cause of male infertility, and cyclophosphamide (CP) can impair spermatogenesis by inducing abnormal spermatogonial apoptosis. Yangjing Capsule (YC) has been used to improve reproductive function, but its underlying molecular mechanism remains unclear. This study investigated the protective effects of YC in a CP-induced mouse model of spermatogenic dysfunction and in GC-1 spermatogonial cells. Sperm count and motility, male fertility, serum sex hormone levels, and histopathological changes in the testes and epididymides were evaluated. Cell viability, lactate dehydrogenase release, apoptosis, and apoptosis-related proteins were assessed in GC-1 cells. Quantitative reverse transcription polymerase chain reaction, RNA pull-down assays, immunofluorescence, and Western blotting were used to examine lncRNA NONMMUT031883.2, Quaking-5 (QKI-5), and p38 mitogen-activated protein kinase (MAPK) signaling. YC dose-dependently improved sperm quality, serum sex hormone levels, reproductive organ morphology, testicular histopathology, and fertility in CP-treated mice. In GC-1 cells, YC increased cell viability and reduced cellular damage and apoptosis. LncRNA NONMMUT031883.2 physically interacted with QKI-5, and YC treatment increased lncRNA NONMMUT031883.2 expression while reducing QKI-5 expression and p38 phosphorylation. YC treatment inhibited apoptosis induced by lncRNA NONMMUT031883.2 knockdown in GC-1 cells, whereas QKI-5 overexpression reduced the anti-apoptotic effects of YC. These findings suggest that YC alleviates CP-induced spermatogenic dysfunction and that its protective effects are mediated by regulation of the lncRNA NONMMUT031883.2/QKI-5/p38 MAPK pathway.

Introduction

Spermatogenic dysfunction refers to reproductive impairment caused by abnormalities in sperm production, maturation, or function in the male reproductive system. It is characterized by reduced sperm count and motility and an increased rate of sperm deformity rate1,2. The pathogenesis of spermatogenic dysfunction is complex and is associated with genetic factors, autoimmune disorders, environmental toxins, chemotherapy-induced damage, and reproductive organ lesions3-5. Chemotherapeutic drugs such as cyclophosphamide (CP) can directly damage the testicular seminiferous tubules and induce spermatogonial apoptosis, thereby contributing to male spermatogenic dysfunction6,7. Hormone replacement therapy, antioxidant supplementation, and assisted reproductive technologies are currently used as clinical interventions. However, these approaches inconsistent efficacy and substantial adverse effects8,9,10. Therefore, identifying safe and effective interventions and clarifying their molecular targets are clinically important for improving fertility outcomes in patients with spermatogenic dysfunction.

Chinese herbal medicine has shown potential in protecting male reproductive function and treating spermatogenic dysfunction because of its multitarget properties and relatively low toxicity11,12. Yangjing Capsule (YC) is a traditional Chinese patent medicine composed of Rehmannia glutinosa, Epimedium, placenta, Polygonatum sibiricum, Angelica sinensis, and other Chinese herbal medicines. It is used to tonify the kidney and essence, nourish the blood and marrow, and regulate reproductive function13. Previous studies have shown that YC can regulate sex hormone levels in male animals, improve sperm quality, repair testicular tissue damage, and protect against reproductive injury induced by chemical agents14,15. Spermatogonial cells form the basis of spermatogenesis, and abnormal spermatogonial apoptosis is a central event in the development of spermatogenic dysfunction16. YC has also been reported to improve spermatogonial viability, increase the proportion of cells in the S phase, and inhibit apoptosis17. However, its protective effects and specific molecular mechanisms in CP-induced spermatogenic dysfunction remain unclear.

Long noncoding RNAs (lncRNAs) are RNA molecules longer than 200 nucleotides that lack protein-coding capacity18. LncRNAs can regulate gene expression through mechanisms including chromosomal silencing, chromatin modification, genomic imprinting, and transcriptional activation19,20. The RNA-binding protein Quaking-5 (QKI-5) participates in physiological and pathological processes, including cell proliferation and apoptosis, by regulating the alternative splicing of downstream genes21. The p38 mitogen-activated protein kinase (MAPK) pathway is involved in apoptosis regulation and also plays an important role in male fertility and testicular development22,23. A previous study showed that QKI-5 overexpression activates the p38 MAPK pathway in hepatocellular carcinoma cells24. In addition, lncRNA NONMMUT074098.2 was shown to bind QKI-5 in spermatogonia, whereas QKI-5 knockdown inhibited the p38 MAPK pathway and reduced spermatogonial apoptosis25. This study used a CP-induced mouse model of spermatogenic dysfunction to investigate whether YC regulates lncRNA NONMMUT031883.2 expression and the QKI-5/p38 MAPK signaling axis, thereby reducing abnormal spermatogonial apoptosis and alleviating CP-induced spermatogenic dysfunction (Figure 1). The objective was to clarify the molecular mechanism underlying YC's protective effects on spermatogenesis and to expand understanding of its pharmacological role in protecting male reproductive function.

figure-introduction-1
Figure 1: Schematic diagram of the experimental design. The upper panel summarizes the in vitro experiments in GC-1 spermatogonial cells. Knockdown of lncRNA NONMMUT031883.2 was used to induce apoptosis and cellular damage, followed by QKI-5 knockdown to evaluate its effects on apoptosis and cell injury. The lower panel summarizes the in vivo experiments in cyclophosphamide (CP)-induced mouse models of spermatogenic dysfunction. Mice received Yangjing Capsule treatment and/or lncRNA NONMMUT031883.2 or QKI-5 intervention. Fertility, serum hormone levels, testicular and epididymal tissues, sperm suspension, sperm reserves, sperm quality, and testicular histopathological damage were subsequently evaluated. Please click here to view a larger version of this figure.

Protocol

All animal experiments were performed in accordance with the ARRIVE guidelines and the National Institutes of Health Guide for the Care and Use of Laboratory Animals. All experimental protocols were reviewed and approved by the Animal Ethics Committee of Southeast University (approval no. 20230216022).

1. Preparation of YC-containing serum
Two Yangjing Capsules (YC; 0.5 g/capsule) were opened, and 0.8 g of the capsule contents was weighed. Normal saline was added to a final volume of 10 mL, and the mixture was vortexed thoroughly to prepare an 80 mg/mL suspension. Specific pathogen-free male BALB/c mice weighing 22–25 g and aged 8 weeks were maintained at 22 °C and 55%–60% humidity under a 12 h light/dark cycle, with food and water provided ad libitum. After 1 week of acclimatization, the mice received YC by oral gavage at 800 mg/kg body weight in a volume of 10 mL/kg once daily for 5 consecutive days. Two hours after the final administration, the mice were anesthetized with intraperitoneal 1% sodium pentobarbital, and blood samples were collected to prepare YC-containing serum. The serum was inactivated at 56 °C for 30 min, filtered through a 0.22 µm membrane, and stored at −80 °C until use.

2. Cell culture and transfection
Mouse GC-1 spermatogonial cells were maintained in DMEM containing 1% penicillin-streptomycin and 10% fetal bovine serum. All cultures were maintained at 37 °C in an atmosphere containing 5% CO₂ (v/v).

LncRNA-specific short hairpin RNA (sh-lncRNA), a QKI-5 overexpression plasmid (OE-QKI-5), QKI-5 small interfering RNA (si-QKI-5), and their corresponding negative controls (sh-NC, OE-NC, and si-NC) were synthesized and constructed. GC-1 cells were transfected with sh-lncRNA or sh-NC, si-QKI-5 or si-NC, or OE-QKI-5 or OE-NC according to the transfection reagent instructions. After incubation for 48 h, transfection efficiency was assessed by measuring lncRNA NONMMUT031883.2 or QKI-5 expression.

For the sh-lncRNA + si-QKI-5 + etoposide group, GC-1 cells were transfected with sh-lncRNA and si-QKI-5 and subsequently treated with 100 µM etoposide for 12 h26. For subsequent cell viability assays, GC-1 cells were cultured in medium supplemented with 5%, 10%, or 20% YC-containing serum and designated as the low-dose YC (L-YC), medium-dose YC (M-YC), and high-dose YC (H-YC) groups, respectively. The concentrations of YC-containing serum (5%, 10%, and 20% YC) were determined based on the results of preliminary concentration-gradient experiments. For the sh-lncRNA + H-YC + OE-NC and sh-lncRNA + H-YC + OE-QKI-5 groups, GC-1 cells were transfected with sh-lncRNA plus OE-NC or sh-lncRNA plus OE-QKI-5 for 48 h and then exposed to 20% YC-containing serum for 24 h.

3. Cell Counting Kit-8 assay
GC-1 cells were seeded into 96-well plates at 5 × 103 cells/well and cultured for 24 h. After cell attachment, the original medium was replaced with 100 µL of complete medium supplemented with YC-containing serum, and the cells were incubated for 6, 12, or 24 h. After incubation, 10 µL of Cell Counting Kit-8 reagent was added to each well, and the cells were incubated at 37 °C in darkness for 2 h. Absorbance at 450 nm was measured using a microplate reader.

4. Lactate dehydrogenase assay
Following transfection with sh-NC or sh-lncRNA for 48 h, the GC-1 cell culture medium was collected, and the supernatant was obtained by centrifugation. According to the lactate dehydrogenase assay kit instructions, the supernatant was gently mixed with the detection working solution and transferred to a 96-well plate. The plate was incubated at 25 °C in darkness for 30 min. Absorbance at 490 nm was measured using a microplate reader, and lactate dehydrogenase release was calculated to assess cell damage.

5. Calcein AM/propidium iodide staining
After transfection with sh-NC or sh-lncRNA for 48 h, GC-1 cell survival was assessed using Calcein AM/propidium iodide (PI) staining. Cells were seeded into 12-well plates at 5 × 104 cells/well and cultured until they reached 60%–70% confluence. The cells were gently rinsed with phosphate-buffered saline, and 500 µL of Calcein AM/PI staining solution was added to each well. The cells were incubated at 37 °C in darkness for 30 min and observed under a fluorescence microscope. Live and dead cells were counted using image-analysis software, and the proportion of surviving cells was calculated.

6. Flow cytometry
GC-1 cells were collected by centrifugation and gently rinsed with phosphate-buffered saline. The cell pellet was resuspended in 500 µL of binding buffer at a density of 5 × 105 cells/mL. Annexin V-APC and PI were then added at 5 µL each, and the suspension was mixed thoroughly and incubated at 25 °C in darkness for 10 min. Apoptosis was analyzed by flow cytometry using excitation/emission wavelengths of 633/660 nm for APC and 488/630 nm for PI. The apoptosis rate was evaluated using flow cytometry analysis software.

7. Caspase-3 activity assay
After the indicated treatments, approximately 1 × 106 GC-1 cells were collected, rinsed, and resuspended in phosphate-buffered saline. The cells were mixed with 100 µL of reagent II from the caspase-3 activity assay kit and lysed on ice for 15 min. Following centrifugation, 50 µL of the lysate supernatant was collected and mixed with 40 µL of reagent I and 10 µL of reagent III. The mixture was incubated at 37 °C for 2 h. Absorbance at 405 nm was measured using a microplate reader, and caspase-3 activity was evaluated according to the kit instructions.

8. RNA pull-down assay
The sense and antisense strands of lncRNA NONMMUT031883.2 were synthesized according to the corresponding sequence and labeled with biotin. Cells were lysed in immunoprecipitation cell lysis buffer on ice for 30 min, and the protein-containing supernatant was collected by centrifugation. Streptavidin magnetic beads were washed three times with RNA-binding buffer and incubated in binding buffer containing 1% bovine serum albumin for 30 min.

The pretreated beads were combined with the biotin-labeled probes and incubated at 25 °C for 30 min. Unbound probes were removed by magnetic separation. The cell lysate supernatant was then added, and the mixture was incubated at 4 °C for 4 h to form magnetic bead-RNA-protein complexes. The magnetic beads were washed three times with washing buffer to remove nonspecifically bound proteins. The washing buffer was removed by magnetic separation, and 2× SDS sample-loading buffer was added. The samples were heated at 95 °C for 10 min, and the supernatant was collected by magnetic separation for subsequent Western blot analysis.

9. Construction of a mouse model of spermatogenic dysfunction
After 5 days of acclimatization, specific pathogen-free male BALB/c mice weighing 22–25 g and aged 8 weeks received cyclophosphamide (CP) intraperitoneally at 50 mg/kg once daily for 7 days to establish a spermatogenic dysfunction model14,27. Successfully modeled mice were randomly assigned using a random-number table to the CP, 200 mg/kg YC, 400 mg/kg YC, 800 mg/kg YC, 800 mg/kg YC + sh-NC, and 800 mg/kg YC + sh-lncRNA groups, with six mice in each group.

Mice in the YC-treated groups received the corresponding dose of YC by oral gavage once daily for 30 days13. For the 800 mg/kg YC + sh-NC and 800 mg/kg YC + sh-lncRNA groups, after successful model establishment, the mice were anesthetized by inhalation of 2% isoflurane. After confirming that each mouse showed no foot withdrawal reflex and that the respiratory rate was stable, the surgical site was shaved and disinfected with povidone-iodine. Under aseptic conditions, a ventral midline incision was made through the skin and body wall anterior to the genitalia. The testis was exposed by carefully manipulating the epididymal fat pad, with care taken to avoid vascular damage. Using a micromanipulator, the seminiferous tubules were visualized, and 1 µL of the adenoviral suspension (1 × 1010 TU/mL) was slowly injected using a microinjection needle28. The needle was left in place for 5 min after injection before being slowly withdrawn, and hemostasis was achieved with a sterile cotton swab. The same procedure was subsequently performed on the contralateral testis. The incision was then sutured, and the mice were allowed to recover on a warming pad postoperatively. Control mice received an equal volume of saline solution by gavage and injection daily.

10. Assessment of fertility
After completion of drug administration, male mice in each group were mated freely with female BALB/c mice at a ratio of 1:2 for 7 days. Vaginal plug formation in the female mice was monitored and recorded daily. After successful mating was confirmed, the male mice were removed, and the female mice were housed individually until natural delivery. Nine pregnant female mice per group were obtained and included in the analysis. The average litter size was recorded to evaluate male fertility in each group.

At the end of the experimental period, the mice were euthanized by intraperitoneal administration of pentobarbital sodium at 100 mg/kg. This euthanasia method was approved by the Animal Ethics Committee of Southeast University (approval no. 20230216022). The testes and epididymides were carefully separated, photographed, and weighed. The testis and epididymis indices were calculated as organ weight/body weight. One epididymis from each mouse was collected, cut into pieces, placed in 1 mL of prewarmed phosphate-buffered saline (37 °C), and incubated for 20 min to allow sperm to swim out29. The sperm suspension was gently mixed, and 10 µL of the sperm suspension was placed on a preheated blood cell counting plate. Sperm were counted manually under a light microscope at 200× magnification, and the results were expressed as 106/L. Furthermore, the percentage of progressively motile spermatozoa relative to the total number of spermatozoa was calculated as sperm motility13.

11. Determination of sex hormone levels
Blood was collected from the orbital vein of mice in each group and allowed to stand at 25 °C for 30 min. Serum was collected by centrifugation at 3,000 × g for 10 min30. Serum testosterone, luteinizing hormone (LH), and follicle-stimulating hormone (FSH) levels were measured using the corresponding enzyme-linked immunosorbent assay kits.

12. RNA stability assay
GC-1 cells were seeded into 96-well culture plates, transfected with si-QKI-5 or si-NC, and cultured for 48 h. Actinomycin D was then added at 5 µg/mL, and the cells were collected at 0, 3, 6, and 9 h. Total RNA was isolated, and the relative expression level of lncRNA NONMMUT031883.2 was determined by quantitative reverse transcription polymerase chain reaction following reverse transcription. The relative RNA level at each time point was calculated using the expression level at 0 h as 100%.

13. Quantitative reverse transcription polymerase chain reaction
GC-1 cells and mouse testicular tissues were rinsed with phosphate-buffered saline and lysed for total RNA isolation. Complementary DNA was generated by reverse transcription using AMV reverse transcriptase. Polymerase chain reaction amplification was performed using a real-time PCR system and a quantitative PCR kit, with complementary DNA used as the amplification template. U6 was used as the internal reference for lncRNA NONMMUT031883.2, and GAPDH was used as the internal reference for QKI-5. Relative target-gene expression was calculated using the 2−ΔΔCt method25. RNA was also isolated separately from the cytoplasmic and nuclear fractions to determine the subcellular localization of lncRNA NONMMUT031883.2. The primer sequences are provided in Table 1.

GeneForward primer (5' to 3')Reverse primer (5' to 3')
QKI-5CTGTCATGCCAAACGGAACGATGGACACGCATATCGTG
GAPDHAGGTCGGTGTGAACGGATTTGTGTAGACCATGTAGTTGAGGTCA
lncRNA NONMMUT031883.2CCACTGTGGCACATTGAAGTATTAAGTTAATGGGTGCTGTGTT
U6 RNACTCGCTTCGGCAGCACAAACGCTTCACGAATTTGCGT

Table 1: Primer sequences used for quantitative reverse transcription polymerase chain reaction. Forward and reverse primer sequences are listed in the 5′–3′ direction for lncRNA NONMMUT031883.2, QKI-5, U6, and GAPDH.

14. Hematoxylin and eosin staining
Mouse testicular and epididymal tissues were immersed in 4% paraformaldehyde and fixed at 4 °C for 24 h. After rinsing with phosphate-buffered saline, the tissues were dehydrated through a graded ethanol series, embedded in paraffin, and sectioned at 5 µm. The sections were heated at 60 °C for 60 min and dewaxed in xylene for 30 min.

After hydration through a graded ethanol series, the sections were stained with hematoxylin for 5 min, treated with hydrochloric acid-ethanol differentiation solution for 10 s, washed with tap water for bluing, and stained with 1% eosin for 2 min. The sections were then dehydrated in 95% ethanol and absolute ethanol and cleared in xylene for 30 min. After air-drying, the sections were mounted with neutral gum. Morphological changes in the testes and epididymides were observed under a microscope.

15. Immunofluorescence
Mouse testicular paraffin sections were dewaxed and hydrated through a graded ethanol series, followed by microwave-mediated antigen retrieval in citrate buffer at pH 6.0. After cooling naturally to room temperature, the sections were incubated with 0.3% Triton X-100 for 10 min. The sections were blocked with 5% bovine serum albumin at 25 °C for 60 min, rinsed with phosphate-buffered saline, and incubated overnight at 4 °C with a primary antibody against Ki67. The following day, a fluorochrome-labeled secondary immunoglobulin G antibody was applied, and the sections were incubated at 37 °C in darkness for 60 min. After rinsing with phosphate-buffered saline, the sections were counterstained with DAPI for 10 min and observed under a fluorescence microscope. Fluorescence intensity was analyzed using image-analysis software.

For immunofluorescence staining of GC-1 cells, the cells were seeded into 12-well plates at 1 × 105 cells/well and incubated for 24 h. The cells were fixed with 4% paraformaldehyde for 30 min, permeabilized with 0.3% Triton X-100 for 10 min, blocked with 5% bovine serum albumin, and incubated overnight at 4 °C with a primary antibody against QKI-5. The remaining procedure was performed as described for the testicular tissue sections.

16. TUNEL staining
Mouse testicular paraffin sections were dewaxed, hydrated through a graded ethanol series, and incubated with 0.1% Triton X-100 for 5 min to increase cell membrane permeability. Proteinase K working solution at 20 µg/mL without DNase was applied uniformly to the sections, which were then incubated at 37 °C for 15 min. TUNEL detection solution was added, and the sections were incubated at 37 °C in darkness for 90 min. After incubation with DAPI for 10 min, antifade mounting medium was applied, and the testicular tissue was observed under a fluorescence microscope.

GC-1 cells were seeded into 12-well plates and fixed with 4% paraformaldehyde for 30 min. After permeabilization with 0.1% Triton X-100 for 5 min, TUNEL detection solution was applied to the cells, followed by incubation in darkness for 60 min. The cells were then stained with DAPI for 10 min and observed under a fluorescence microscope.

17. Western blotting
Mouse testicular tissues and GC-1 cells were lysed in immunoprecipitation cell lysis buffer on ice for 30 min and disrupted by ultrasonication. After centrifugation, the protein-containing supernatant was collected, and protein concentration was determined using a bicinchoninic acid assay kit. The protein supernatant was mixed with SDS loading buffer and heated in boiling water for 10 min. After separation by gel electrophoresis, the proteins were transferred to polyvinylidene fluoride membranes and blocked with 5% bovine serum albumin for 2 h31.

The membranes were incubated overnight at 4 °C with primary antibodies against cleaved caspase-3 (1:500), Bcl-2 (1:1000), caspase-3 (1:2000), Bax (1:500), QKI-5 (1:1000), phosphorylated p38 (1:1000), or p38 (1:500). On the following day, the membranes were rinsed with Tris-buffered saline containing Tween 20 and incubated with goat anti-rabbit immunoglobulin G at 1:10000 for 2 h at 25 °C. The enhanced chemiluminescence working solution was applied to the membrane surface, and the protein bands were imaged with a gel imaging system. Band intensity was analyzed using image-analysis software, and relative protein expression was normalized to GAPDH (1:3000).

Cycloheximide at 50 µg/mL was used to inhibit protein synthesis. To determine the half-life of QKI-5, cells were collected at 0, 3, 6, and 9 h, and QKI-5 protein levels were subsequently determined by Western blotting25.

18. Statistical analysis
All data were statistically analyzed and plotted using statistical, graphing, and image-analysis software. The Shapiro-Wilk test was used to assess data normality. Experimental data are presented as the mean ± standard deviation. One-way analysis of variance was used to evaluate differences among groups. The LSD-t test was used for post hoc pairwise comparisons when variances were homogeneous, whereas Dunnett’s T3 test was used when variances were heterogeneous. A value of p < 0.05 was considered statistically significant.

Results

Knockdown of lncRNA NONMMUT031883.2 induces spermatogonial apoptosis
GC-1 cells were transfected with sh-lncRNA to knock down lncRNA NONMMUT031883.2 expression. Compared with sh-NC-transfected cells, the transcriptional level of lncRNA NONMMUT031883.2 was markedly reduced following sh-lncRNA transfection, confirming successful knockdown (Figure 2A). Following lncRNA NONMMUT031883.2 knockdown, GC-1 cell viability was significantly reduced (Figure 2B), while LDH release was significantly increased, indicating greater cellular damage (Figure 2C). Calcein-AM/PI staining showed an increased number of PI-positive GC-1 cells and a reduced proportion of surviving cells in the sh-lncRNA group (Figure 2D, E). The apoptosis rate of GC-1 cells was markedly increased following lncRNA NONMMUT031883.2 knockdown (Figure 2F, G). The TUNEL-positive rate was also significantly elevated in the sh-lncRNA group, further indicating increased apoptosis (Figure 2H, I). In addition, lncRNA NONMMUT031883.2 knockdown significantly increased caspase-3 activity in GC-1 cells (Figure 2J). In the sh-lncRNA group, Bax expression was markedly increased, Bcl-2 expression was reduced, and the cleaved caspase-3/caspase-3 ratio was significantly elevated (Figure 2K, L). These results indicate that knockdown of lncRNA NONMMUT031883.2 induces apoptosis in GC-1 cells. All quantified data were obtained with n = 6.

figure-results-1
Figure 2: Knockdown of lncRNA NONMMUT031883.2 induces spermatogonial apoptosis. (A) Quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis of lncRNA NONMMUT031883.2 expression in GC-1 cells. (B) Cell Counting Kit-8 (CCK-8) assay of GC-1 cell viability following lncRNA NONMMUT031883.2 knockdown. (C) Lactate dehydrogenase (LDH) release from GC-1 cells following lncRNA NONMMUT031883.2 knockdown. (D, E) Calcein-AM/propidium iodide (PI) staining of GC-1 cell survival (20×; scale bar, 100 µm). (F, G) Flow cytometric analysis of apoptosis following lncRNA NONMMUT031883.2 knockdown. (H, I) Terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL) analysis of GC-1 cells (40×; scale bar, 50 µm). (J) Caspase-3 activity following lncRNA NONMMUT031883.2 knockdown. (K, L) Western blot analysis of Bcl-2, Bax, caspase-3, and cleaved caspase-3 expression following sh-lncRNA transfection. Data are presented as the mean ± standard deviation; n = 6. ***p < 0.001 versus sh-NC. Please click here to view a larger version of this figure.

LncRNA NONMMUT031883.2 interacts with QKI-5
The interaction between lncRNA NONMMUT031883.2 and QKI-5 was examined to elucidate the molecular mechanism underlying spermatogonial apoptosis. Following separation of the nuclear and cytoplasmic fractions, qRT-PCR analysis showed that lncRNA NONMMUT031883.2 was primarily localized in the nuclei of GC-1 cells (Figure 3A). Immunofluorescence analysis showed that QKI-5 was also concentrated in the nucleus, providing a spatial basis for interaction between lncRNA NONMMUT031883.2 and QKI-5 (Figure 3B). The half-life of lncRNA NONMMUT031883.2 was measured following actinomycin D treatment to assess whether QKI-5 regulated lncRNA stability. QKI-5 knockdown had no notable effect on the half-life of the lncRNA transcript (Figure 3C). Following inhibition of protein synthesis by cycloheximide, lncRNA NONMMUT031883.2 knockdown did not alter QKI-5 protein expression (Figure 3D, E). The capture efficiency of the biotin-labeled antisense probe targeting lncRNA NONMMUT031883.2 was then evaluated by qRT-PCR. The antisense probe efficiently enriched the target lncRNA and was therefore used for the subsequent RNA pull-down assay (Figure 3F). RNA pull-down followed by Western blotting showed a specific physical interaction between lncRNA NONMMUT031883.2 and QKI-5 (Figure 3G, H). These results indicate that lncRNA NONMMUT031883.2 and QKI-5 colocalize in the nuclei of GC-1 cells and interact specifically. The quantitative data of Figure 3C and Figure 3D, F were obtained with n = 3, and the rest of the quantitative data were obtained with n = 6.

figure-results-2
Figure 3: LncRNA NONMMUT031883.2 interacts with QKI-5. (A) qRT-PCR analysis of the nuclear and cytoplasmic distribution of lncRNA NONMMUT031883.2 in GC-1 cells. (B) Immunofluorescence analysis of the subcellular localization of QKI-5 in GC-1 cells (40×; scale bar, 50 µm). (C) qRT-PCR analysis of the half-life of lncRNA NONMMUT031883.2 following actinomycin D treatment and QKI-5 knockdown (n = 3). (D, E) Western blot analysis of QKI-5 protein expression following cycloheximide treatment and lncRNA NONMMUT031883.2 knockdown (n = 3). (F) qRT-PCR validation of the enrichment efficiency of the biotin-labeled antisense probe targeting lncRNA NONMMUT031883.2. (G, H) RNA pull-down and Western blot analysis of the interaction between lncRNA NONMMUT031883.2 and QKI-5. Data are presented as the mean ± standard deviation; n = 6. Please click here to view a larger version of this figure.

QKI-5 knockdown inhibits spermatogonial apoptosis by suppressing the p38 MAPK pathway
The role of QKI-5 and the downstream p38 MAPK pathway in spermatogonial apoptosis was examined. Following transfection with si-QKI-5, QKI-5 protein levels were significantly reduced in GC-1 cells, confirming successful knockdown (Figure 4A, B). LncRNA NONMMUT031883.2 knockdown significantly increased the p-p38/p38 ratio, whereas simultaneous QKI-5 knockdown decreased this ratio, indicating inhibition of p38 MAPK pathway activation (Figure 4C, D). QKI-5 knockdown alleviated the damage to GC-1 cells caused by lncRNA NONMMUT031883.2 knockdown, whereas treatment with the apoptosis inducer etoposide significantly reduced cell viability (Figure 4E). QKI-5 knockdown significantly reduced the apoptosis rate of GC-1 cells, while etoposide treatment markedly increased apoptosis (Figure 4F, G). Transfection with si-QKI-5 also significantly reduced caspase-3 activity, whereas etoposide treatment increased caspase-3 activity (Figure 4H). QKI-5 knockdown reduced Bax expression, increased Bcl-2 expression, and significantly decreased the cleaved caspase-3/caspase-3 ratio, whereas etoposide treatment reversed these expression patterns (Figure 4I, J). These results indicate that QKI-5 knockdown suppresses apoptosis in GC-1 spermatogonia by inhibiting the p38 MAPK pathway. All quantified data were obtained with n = 6.

figure-results-3
Figure 4: QKI-5 knockdown inhibits spermatogonial apoptosis by suppressing the p38 MAPK pathway. (A, B) Western blot analysis of QKI-5 expression in GC-1 cells following transfection with si-NC or si-QKI-5. (C, D) Western blot analysis of phosphorylated p38 (p-p38) and total p38 expression. (E) CCK-8 analysis of GC-1 cell viability in the different treatment groups. (F, G) Flow cytometric analysis of apoptosis following etoposide treatment. (H) Caspase-3 activity in the different treatment groups. (I, J) Western blot analysis of Bax, Bcl-2, caspase-3, and cleaved caspase-3 expression in GC-1 cells. Data are presented as the mean ± standard deviation; n = 6. ***p < 0.001 versus si-NC or sh-NC; ###p < 0.001 versus sh-lncRNA; &&&p < 0.001 versus sh-lncRNA + si-QKI-5. Please click here to view a larger version of this figure.

YC inhibits spermatogonial apoptosis via the lncRNA NONMMUT031883.2/QKI-5/p38 MAPK pathway
Following treatment of GC-1 cells with YC-containing serum for 6, 12, and 24 h, cell viability gradually increased with increasing YC concentrations and prolonged exposure times. Therefore, these concentrations were selected for subsequent experiments, with a treatment duration of 24 h (Figure 5A). YC treatment for 24 h markedly increased the transcriptional level of lncRNA NONMMUT031883.2 in GC-1 cells (Figure 5B) and enhanced its binding capacity to QKI-5 (Figure 5C, D). Following YC treatment, QKI-5 expression and the p-p38/p38 ratio were notably reduced in GC-1 cells, suggesting inhibition of the p38 MAPK pathway (Figure 5E, F). YC treatment also markedly decreased the apoptosis rate (Figure 5G, H), reduced caspase-3 activity (Figure 5I), increased Bcl-2 expression, and reduced Bax expression and the cleaved caspase-3/caspase-3 ratio (Figure 5J, K).

To further assess pathway specificity, GC-1 cells were transfected with OE-NC or OE-QKI-5. QKI-5 protein expression was significantly increased in OE-QKI-5-transfected cells, confirming successful overexpression (Figure 5L, M). Knockdown of lncRNA NONMMUT031883.2 significantly reduced cell viability, whereas YC treatment reversed this effect. QKI-5 overexpression attenuated the cytoprotective effect of YC (Figure 5N). YC treatment also reduced apoptosis induced by lncRNA NONMMUT031883.2 knockdown (Figure 5O, P), decreased caspase-3 activity (Figure 5Q), reduced Bax expression, increased Bcl-2 expression, and decreased the cleaved caspase-3/caspase-3 ratio (Figure 5R, S). In contrast, QKI-5 overexpression attenuated the anti-apoptotic effects of YC. These results indicate that YC upregulates lncRNA NONMMUT031883.2 and promotes its binding to QKI-5, thereby inhibiting the p38 MAPK pathway and suppressing apoptosis in GC-1 cells. All quantified data were obtained with n = 6.

figure-results-4
Figure 5: YC inhibits spermatogonial apoptosis via the lncRNA NONMMUT031883.2/QKI-5/p38 MAPK pathway. (A) CCK-8 analysis of GC-1 cell viability following exposure to Yangjing Capsule (YC)-containing serum for 6, 12, and 24 h. (B) qRT-PCR analysis of lncRNA NONMMUT031883.2 expression in GC-1 cells after 24 h of YC treatment. (C, D) RNA pull-down analysis of the binding of lncRNA NONMMUT031883.2 to QKI-5 following YC treatment. (E, F) Western blot analysis of QKI-5, p-p38, and p38 expression following YC treatment. (G, H) Flow cytometric analysis of GC-1 cell apoptosis following YC treatment. (I) Caspase-3 activity following YC treatment. (J, K) Western blot analysis of Bcl-2, Bax, caspase-3, and cleaved caspase-3 expression following YC treatment. (L, M) Western blot analysis of QKI-5 expression following transfection with OE-NC or OE-QKI-5. (N) CCK-8 analysis of GC-1 cell viability. (O, P) Flow cytometric analysis of apoptosis in GC-1 cells following QKI-5 overexpression. (Q) Caspase-3 activity following QKI-5 overexpression. (R, S) Western blot analysis of Bax, Bcl-2, caspase-3, and cleaved caspase-3 expression following QKI-5 overexpression. Data are presented as the mean ± standard deviation; n = 6. ***p < 0.001 versus control; ###p < 0.001 versus sh-lncRNA; &&&p < 0.001 versus sh-lncRNA + H-YC + OE-NC. Please click here to view a larger version of this figure.

YC improves CP-induced spermatogenic dysfunction in mice
The protective effects of YC were evaluated in mice with spermatogenic dysfunction. The testes and epididymides of mice in the CP group showed marked atrophy, reduced volume, and a dull appearance. Following treatment with different doses of YC, the morphology, fullness, and color of the reproductive organs gradually improved (Figure 6A). The relative weights of the testes and epididymides were significantly increased, with the greatest effect observed in the 800 mg/kg YC group (Figure 6B, C).

The sperm deformity rate was significantly increased in the CP group, with frequent abnormalities including head distortion, tail curling, and structural damage. Sperm number and motility were also markedly reduced. Following YC treatment, sperm morphology improved (Figure 6D), sperm number increased (Figure 6E), and sperm motility was significantly enhanced (Figure 6F). Mating experiments showed that fertility and litter size were markedly reduced in the CP group, whereas YC treatment improved fertility (Figure 6G). Serum testosterone, follicle-stimulating hormone, and luteinizing hormone levels were also markedly reduced in the CP group and increased following YC treatment (Figure 6H-J). These findings indicate that YC improves reproductive-organ atrophy, sperm quality, fertility, and sex hormone secretion in mice with spermatogenic dysfunction. The quantitative data of Figure 6G were obtained with n = 9, and the rest of the quantitative data were obtained with n = 6.

figure-results-5
Figure 6: YC improves CP-induced spermatogenic dysfunction in mice. (A-C) Morphology of the reproductive organs in the control, cyclophosphamide (CP), and YC treatment groups (A), testis index (B), and epididymis index (C). (D-F) Sperm morphology (D) (40×; scale bar, 50 µm), sperm density (E), and sperm motility (F). (G) Male fertility assessed by mating experiments (n = 9). (H-J) Serum follicle-stimulating hormone (FSH), testosterone, and luteinizing hormone (LH) levels measured using enzyme-linked immunosorbent assay kits. Data are presented as the mean ± standard deviation; n = 6. ***p < 0.001 versus control; #p < 0.05, ##p < 0.01, and ###p < 0.001 versus CP. Please click here to view a larger version of this figure.

YC improves testicular histopathological damage in mice with spermatogenic dysfunction
The reparative effect of YC on testicular tissue damage was evaluated by histological staining. Hematoxylin and eosin staining showed intact tissue structure, distinct cellular layers, and adequate cell numbers in the control group. In contrast, the CP group showed marked seminiferous tubule atrophy and structural disorganization, reduced cell numbers, and collapse of the epididymal lumen. Following YC treatment, testicular and epididymal damage was reduced, seminiferous tubule structure was gradually restored, and the cells became more orderly and increased in number (Figure 7A, B).

The proportion of TUNEL-positive cells in testicular tissue was significantly increased in the CP group and significantly reduced following YC treatment (Figure 7C, D). Bax expression and the cleaved caspase-3/caspase-3 ratio were notably increased in the CP group, whereas Bcl-2 expression was reduced. YC treatment reversed these expression patterns (Figure 7E, F). Immunofluorescence analysis showed that Ki67 fluorescence intensity was markedly reduced in the CP group and significantly increased following YC treatment, suggesting restoration of spermatogenic cell proliferation (Figure 7G, H). These findings suggest that YC reduces CP-induced histopathological damage in the testes and epididymides, inhibits excessive apoptosis, and promotes spermatogenic cell proliferation. All quantified data were obtained with n = 6.

figure-results-6
Figure 7: YC improves CP-induced histopathological damage in mouse testicular tissue. (A, B) Hematoxylin and eosin (HE) staining of the testes (A) and epididymides (B) following YC treatment (20×; scale bar, 100 µm). (C, D) TUNEL analysis of apoptosis in mouse testicular tissue (40×; scale bar, 50 µm). (E, F) Western blot analysis of Bax, Bcl-2, caspase-3, and cleaved caspase-3 expression in testicular tissue following YC treatment. (G, H) Immunofluorescence analysis of Ki67 expression in mouse testicular tissue (40×; scale bar, 50 µm). Data are presented as the mean ± standard deviation; n = 6. ***p < 0.001 versus control; p < 0.001 versus CP. Please click here to view a larger version of this figure.

YC improves spermatogenic dysfunction and testicular pathological damage in mice via the lncRNA NONMMUT031883.2/QKI-5/p38 MAPK pathway
The involvement of the lncRNA NONMMUT031883.2/QKI-5/p38 MAPK pathway in the effects of YC was further evaluated. LncRNA NONMMUT031883.2 expression was significantly reduced in testicular tissue from mice in the CP group, whereas QKI-5 expression and the p-p38/p38 ratio were markedly increased (Figure 8A-D). Following YC treatment, lncRNA NONMMUT031883.2 expression increased, whereas QKI-5 expression and the p-p38/p38 ratio decreased.

To further assess pathway specificity, lncRNA NONMMUT031883.2 was knocked down in mice using sh-lncRNA. The expression level of lncRNA NONMMUT031883.2 was significantly reduced, confirming successful knockdown (Figure 8E). After knockdown of lncRNA NONMMUT031883.2, QKI-5 level in testicular tissue did not change significantly, but p-p38/p38 level was significantly increased (Figure 8F, G). Sh-lncRNA treatment attenuated the effects of 800 mg/kg YC, resulting in reduced lncRNA NONMMUT031883.2 expression in testicular tissue (Figure 8H) and increased p-p38/p38 levels (Figure 8I, J). YC treatment significantly increased sperm count and motility after CP induction, whereas knockdown of lncRNA NONMMUT031883.2 attenuated these effects (Figure 8K, L). YC treatment also increased testosterone, follicle-stimulating hormone, and luteinizing hormone levels in the CP group, whereas lncRNA knockdown attenuated these effects (Figure 8M-O).

Hematoxylin and eosin staining showed that YC improved CP-induced testicular damage, including seminiferous tubule atrophy and disorganized spermatogenic cell arrangement. LncRNA NONMMUT031883.2 knockdown attenuated these protective effects (Figure 8P). Following YC treatment, Bax expression and the cleaved caspase-3/caspase-3 ratio were reduced, whereas Bcl-2 expression was increased. LncRNA NONMMUT031883.2 knockdown reversed these effects on apoptosis-related proteins (Figure 8Q, R). These findings indicate that YC improves sperm quality and reduces testicular tissue damage following CP induction by upregulating lncRNA NONMMUT031883.2, downregulating QKI-5, and inhibiting the p38 MAPK pathway. All quantified data were obtained with n = 6.

figure-results-7
Figure 8: YC improves spermatogenesis and reduces testicular histopathological damage via the lncRNA NONMMUT031883.2/QKI-5/p38 MAPK pathway. (A) qRT-PCR analysis of lncRNA NONMMUT031883.2 expression in mouse testicular tissue. (B-D) Western blot analysis of QKI-5, p-p38, and p38 expression in mouse testicular tissue following YC treatment. (E) qRT-PCR validation of lncRNA NONMMUT031883.2 knockdown in mouse testicular tissue following sh-lncRNA administration. (F, G) Western blot analysis of QKI-5 and p-p38/p38 levels in the testis tissue of the mice after knockdown of lncRNA NONMMUT031883.2. (H) qRT-PCR analysis of lncRNA NONMMUT031883.2 expression in mouse testicular tissue following YC treatment and sh-lncRNA administration. (I, J) Western blot analysis of p-p38 and p38 expression in mouse testicular tissue. (K, L) Sperm count (K) and sperm motility (L) in the different treatment groups. (M-O) Serum FSH, testosterone, and LH levels were measured using enzyme-linked immunosorbent assay kits. (P) HE staining of testicular tissue in CP-treated mice (20×; scale bar, 100 µm). (Q, R) Western blot analysis of Bcl-2, Bax, cleaved caspase-3, and caspase-3 expression in mouse testicular tissue. Data are presented as the mean ± standard deviation; n = 6. ***p < 0.001 versus control; p < 0.001 versus CP; p < 0.001 versus 800 mg/kg YC + sh-NC. Please click here to view a larger version of this figure.

Data Availability:
The raw data supporting the findings of this study are provided as a Supplementary File 1.

Supplementary File 1: Original data. This Excel file contains the raw numerical data underlying the quantitative analyses presented in Figures 2–8. Please click here to download this file.

Discussion

Chemotherapy-induced acquired spermatogenic dysfunction is an important cause of male infertility32,33,34. However, the specific molecular mechanisms remain incompletely understood. The findings of this study demonstrate that Yangjing Capsule (YC) dose-dependently improves cyclophosphamide (CP)-induced sex hormone abnormalities, testicular histopathological damage, and fertility impairment in male mice. These improvements were associated with upregulation of lncRNA NONMMUT031883.2 and inhibition of the QKI-5/p38 MAPK pathway, suggesting that YC may act through this axis to reduce abnormal spermatogonial apoptosis.

The reproductive toxicity of CP has been widely documented. Its metabolite acrolein can accumulate in testicular tissue and induce germ cell apoptosis through oxidative stress, DNA damage, and other pathways. Spermatogonia, as the initial cells of spermatogenesis, are particularly sensitive to the cytotoxic effects of CP35,36. Cao et al. found that DNA damage checkpoint signaling was significantly enriched in testicular tissue from patients with azoospermia after CP chemotherapy, whereas genes associated with sperm development were significantly downregulated and the structural integrity of the seminiferous tubules was disrupted37. Bcl-2 is an anti-apoptotic protein that functions by maintaining mitochondrial membrane integrity38. Bax is a pro-apoptotic protein, and its upregulation can promote the release of cytochrome c from the mitochondria into the cytoplasm, activate the caspase cascade, and induce apoptosis39,40. Saleh et al. demonstrated that CP exposure caused seminiferous tubule atrophy and interstitial edema in mice, accompanied by Bcl-2 downregulation and Bax upregulation, ultimately resulting in reduced sperm count and motility41. Therefore, inhibition of excessive CP-induced spermatogonial apoptosis may represent an important target for protecting reproductive function after chemotherapy. In the present study, YC intervention dose-dependently reduced CP-induced abnormalities in serum sex hormone secretion, repaired seminiferous tubule damage, and improved sperm motility and male fertility. YC also increased Bcl-2 expression and reduced Bax expression, the cleaved caspase-3/caspase-3 ratio, and the number of TUNEL-positive cells in testicular tissue. In vitro, YC-containing serum markedly reduced GC-1 cell apoptosis and increased cell viability, further supporting an inhibitory effect on spermatogonial apoptosis.

Long noncoding RNAs (lncRNAs) play important regulatory roles in physiological and pathological processes, including spermatogenesis and germ cell apoptosis42,43. Abnormal lncRNA expression can impair testicular spermatogenic function through the regulation of oxidative stress and apoptotic pathways, representing an important molecular mechanism of male infertility44. Wang et al. found that lncRNA DNM3OS regulates the miR-214-5p/E2F2 axis, resulting in reduced spermatogonial cell activity and increased apoptosis and senescence, ultimately contributing to non-obstructive azoospermia45. Previous research also showed that knockdown of lncRNA NONMMUT074098.2 in spermatogonia induces apoptosis25. These studies indicate that lncRNAs are important regulators of spermatogonial apoptosis and spermatogenesis. In the present study, knockdown of lncRNA NONMMUT031883.2 induced spermatogonial apoptosis. Its expression was significantly reduced in mouse testicular tissue following CP induction, whereas YC intervention partially restored its expression. In addition, YC intervention attenuated the abnormal spermatogonial apoptosis induced by lncRNA NONMMUT031883.2 knockdown, suggesting that the protective effect of YC may be associated with regulation of this lncRNA.

QKI-5 is an RNA-binding protein belonging to the STAR family and participates in several physiological and pathological processes by regulating target mRNA splicing, stability, and translational efficiency46,47. Previous research established that QKI-5 is an important regulator in the reproductive system and that its abnormal expression can promote germ cell apoptosis and impair sperm function through activation of the downstream p38 MAPK pathway25. Li et al. found that inhibition of p38 MAPK pathway activation reduced CP-induced testicular tissue damage and restored blood-testis barrier function in rats48. These findings suggest that the QKI-5/p38 MAPK axis may be an important pathway regulating spermatogonial apoptosis and a potential target for the treatment of spermatogenic dysfunction. In the present study, QKI-5 expression and p38 phosphorylation were significantly increased in mouse testicular tissue following CP induction, whereas YC intervention reduced QKI-5 expression and p38 MAPK pathway activation. LncRNA NONMMUT031883.2 directly bound to QKI-5, while QKI-5 expression did not affect the stability of the lncRNA, suggesting that lncRNA NONMMUT031883.2 may regulate QKI-5 function through direct interaction. QKI-5 knockdown attenuated the damage to GC-1 cells caused by lncRNA NONMMUT031883.2 knockdown, whereas QKI-5 overexpression reduced the protective effects of YC on GC-1 cells. Li et al. reported that lncRNA NONMMUT074098.2 regulates germ cell apoptosis by binding to QKI-525. The present findings show that lncRNA NONMMUT031883.2 also binds to QKI-5 and is implicated in the regulation of spermatogonial apoptosis. Taken together, these data suggest that YC may upregulate lncRNA NONMMUT031883.2, inhibit the QKI-5/p38 MAPK pathway, reduce abnormal spermatogonial apoptosis, and alleviate CP-induced spermatogenic dysfunction. However, it should be noted that YC is a multicomponent herbal formulation that likely acts on multiple targets. Other mechanisms, such as direct antioxidant effects of YC components, modulation of other signaling pathways, or epigenetic regulation independent of the lncRNA-QKI-5 axis, cannot be excluded and may contribute to the observed protective effects.

Several limitations should be acknowledged. The study was conducted only in a mouse model and the GC-1 cell line and lacked validation using clinical samples from patients with infertility. Spermatogenesis is a complex process, and the complete spermatogenic cycle of mice lasts approximately 35 days49,50. The 30-day YC regimen used in this study did not cover a complete spermatogenic cycle. Therefore, future studies employing intervention protocols of ≥35 days are warranted to systematically evaluate the therapeutic effects of YC over an entire spermatogenic cycle. In addition, the precise molecular events following lncRNA NONMMUT031883.2 binding to QKI-5, such as alterations in QKI-5 splicing activity and its subcellular localization, and the recognition and regulation of downstream splicing targets, remain to be explored. Moreover, although YC treatment upregulated the expression of lncRNA NONMMUT031883.2, the upstream transcription factors and epigenetic mechanisms remain to be elucidated. Future studies incorporating promoter analysis and chromatin immunoprecipitation assays are needed to clarify the molecular basis of YC-induced expression of the lncRNA NONMMUT031883.2. Furthermore, future studies should evaluate the effects of YC in patients with chemotherapy-associated male infertility and assess the expression of lncRNA NONMMUT031883.2 in testicular tissue or semen to determine its potential clinical value as a diagnostic or therapeutic marker.

In conclusion, YC upregulates lncRNA NONMMUT031883.2 and inhibits the activation of the QKI-5/p38 MAPK pathway, thereby reducing spermatogonial apoptosis and testicular damage and alleviating spermatogenic dysfunction in mice. These findings clarify the molecular mechanism underlying the protective effects of YC against spermatogenic dysfunction and expand the current understanding of the roles of lncRNA NONMMUT031883.2 and the QKI-5/p38 MAPK pathway in regulating spermatogenesis. LncRNA NONMMUT031883.2 and QKI-5 may represent potential therapeutic targets for male spermatogenic dysfunction.

Disclosures

The authors declare no financial or nonfinancial conflicts of interest.

Acknowledgements

This work was supported by the National Natural Science Foundation of China (grant no. 82374257), the Fourth Batch of Peak Academic Talent Training Program of Jiangsu Provincial Hospital of Chinese Medicine (grant no. k2026yrc74), and the Scientific Research Projects of Traditional Chinese Medicine and Integrated Traditional Chinese and Western Medicine of Jiangsu Province (grant no. CYTF2026019).

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
Actinomycin DMedChemExpress, Monmouth Junction, NJ, USAHY-17559Transcription inhibitor used for RNA stability assays
AMV reverse transcriptaseTakara, Tokyo, Japan2621Enzyme for complementary DNA synthesis
Annexin V-APC/PI detection kitBioLab Technology, Beijing, ChinaKFS191Kit for flow cytometric analysis of apoptosis
Antifade mounting mediumMedChemExpress, Monmouth Junction, NJ, USAHY-K1042Mounting medium for fluorescence preservation
Bax primary antibodyAffinity Biosciences, OH, USAAF0120Primary antibody for detection of Bax
BCA kitMacklin, Shanghai, ChinaB917925Kit for protein concentration determination
Bcl-2 primary antibodyAffinity Biosciences, OH, USAAF0769Primary antibody for detection of Bcl-2
Bovine serum albuminBioLab Technology, Beijing, ChinaBTN131070Blocking reagent
Calcein/PI detection kitBeyotime, Shanghai, ChinaC2015MKit for live/dead cell staining
Caspase-3 activity assay kitBioLab Technology, Beijing, ChinaQN2866Kit for measuring caspase-3 activity
Caspase-3 primary antibodyAbcam, MA, USAab184787Primary antibody for detection of caspase-3
CCK-8 reagentMedChemExpress, Monmouth Junction, NJ, USAHY-K0301Reagent for cell viability assessment
Cleaved caspase-3 primary antibodyAbcam, MA, USAab32042Primary antibody for detection of cleaved caspase-3
CycloheximideMacklin, Shanghai, ChinaH823111Protein synthesis inhibitor used for protein stability assays
CyclophosphamideMedChemExpress, Monmouth Junction, NJ, USAHY-17420Used to induce spermatogenic dysfunction
DAPI reagentBeyotime, Shanghai, ChinaC1006Nuclear counterstain
DMEM mediumWuhan Sunncell Biotechnology, Hubei, ChinaSNLM-302Cell culture medium for GC-1 cells
ECL working solutionSolarbio, Beijing, ChinaSW2030Chemiluminescent substrate for protein-band detection
EtoposideMedChemExpress, Monmouth Junction, NJ, USAHY-13629Apoptosis-inducing agent
Flow cytometerBD Biosciences, CA, USABD FACSCaliburInstrument for apoptosis analysis
FlowJo softwareBD Biosciences, CA, USAv10.8Software for flow cytometry data analysis
Fluorescence microscopeLeica, Heidelberg, GermanyDM3000Instrument for fluorescence imaging
Fluorescence-labeled secondary antibody IgGServicebio, Wuhan, ChinaGB22303Secondary antibody for immunofluorescence detection
Follicle-stimulating hormone ELISA kitHuamei Biotech, Wuhan, ChinaCSB-E06871mKit for measuring serum follicle-stimulating hormone
GAPDH primary antibodyAffinity Biosciences, OH, USAT0004Loading-control antibody for Western blotting
GC-1 cellsWuhan Sunncell Biotechnology, Hubei, ChinaSNL-302Mouse spermatogonial cell line
Gel imaging systemJinpeng Analysis Instrument, Shanghai, ChinaJP-2880Imaging system for gel and blot visualization
Gel imaging systemInvitrogen, Carlsbad, CA, USAiBright CL1500Chemiluminescence imaging system for Western blots
Goat anti-rabbit IgGServicebio, Wuhan, ChinaGB23303Secondary antibody for Western blotting
Hematoxylin solutionBioLab Technology, Beijing, ChinaYT165Nuclear stain for histological analysis
Hydrochloric acid ethanol differentiation solutionBeyotime, Shanghai, ChinaC0163SDifferentiation reagent for hematoxylin staining
ImageJ softwareNational Institutes of Health, USA1.54hSoftware for image quantification
IP cell lysis bufferBeyotime, Shanghai, ChinaP0013Lysis buffer for immunoprecipitation and protein extraction
Ki67 primary antibodyAffinity Biosciences, OH, USAAF0198Primary antibody for detection of Ki67
LDH Cytotoxicity Assay KitBeyotime, Shanghai, ChinaC0016Kit for measuring lactate dehydrogenase release and cellular damage
Light microscopeOlympus, Tokyo, JapanCKX53Used for sperm counting and morphological observation
Lipofectamine 3000Invitrogen, Carlsbad, CA, USAL3000001Transfection reagent
Microplate readerMolecular Devices, CA, USASpectraMax MiniInstrument for absorbance measurements
Mouse luteinizing hormone ELISA kitHuamei Biotech, Wuhan, ChinaCSB-E12770mKit for measuring serum luteinizing hormone
Mouse testosterone ELISA kitHuamei Biotech, Wuhan, ChinaCSB-E05101mKit for measuring serum testosterone
Neutral gumBioLab Technology, Beijing, ChinaQN1253Mounting medium for histological sections
p38 primary antibodyAffinity Biosciences, OH, USAAF6456Primary antibody for detection of total p38
ParaformaldehydeMedChemExpress, Monmouth Junction, NJ, USAHY-Y0333Fixative for cells and tissues
PARIS kitInvitrogen, Carlsbad, CA, USAAM1921Kit for nuclear and cytoplasmic RNA fractionation
PCR systemABI, CA, USAABI PRISM 7300Real-time PCR instrument
p-p38 primary antibodyAffinity Biosciences, OH, USAAF3455Primary antibody for detection of phosphorylated p38
Proteinase K solutionBeyotime, Shanghai, ChinaST532Reagent for tissue permeabilization before TUNEL staining
PVDF membranesMillipore, MA, USAISEQ00010Membranes for protein transfer in Western blotting
QKI-5 primary antibodyAbcam, MA, USAab126742Primary antibody for detection of QKI-5
RNA binding bufferInvitrogen, Carlsbad, CA, USA65040DBuffer for RNA-protein binding reactions
SDS loading bufferBeyotime, Shanghai, ChinaP0286Sample-loading buffer for SDS-PAGE
Streptavidin magnetic beadsMedChemExpress, Monmouth Junction, NJ, USAHY-K0208Magnetic beads for capture of biotin-labeled RNA probes
TB Green FAST qPCR KitTakara, Tokyo, JapanCN830SReagent kit for quantitative PCR
Triton X-100Macklin, Shanghai, ChinaT824275Permeabilization reagent
TRIzol reagentInvitrogen, Carlsbad, CA, USA15596018CNReagent for total RNA extraction
TUNEL detection solutionBeyotime, Shanghai, ChinaC1086Reagent for detection of DNA fragmentation
XyleneMacklin, Shanghai, ChinaX821391Reagent for paraffin removal and tissue clearing

References

  1. Bhattacharya I, Sharma SS, Majumdar SS. Etiology of male infertility: an update. Reprod Sci. 2024;31(4):942-965.
  2. Dong S, et al. Testicular aging, male fertility and beyond. Front Endocrinol (Lausanne). 2022;13:1012119.
  3. Wang X, et al. Decoding the pathogenesis of spermatogenic failure in cryptorchidism through single-cell transcriptomic profiling. Cell Rep Med. 2024;5(9):101709.
  4. Stallmeyer B, et al. Inherited defects of piRNA biogenesis cause transposon de-repression, impaired spermatogenesis, and human male infertility. Nat Commun. 2024;15(1):6637.
  5. Szlachcikowska D, Koszła O, Sołek P, Tabęcka-Łonczyńska A. Non-canonical apoptosis mediates oxaliplatin-induced disruption of spermatogenic cells: implications for male fertility. Chem Biol Interact. 2026;431:112009.
  6. Chi YN, et al. Geniposide attenuates spermatogenic dysfunction via .inhibition of endoplasmic reticulum stress in male mice. Chem Biol Interact. 2022;366:110144.
  7. Guo XB, et al. Protective effect of bone marrow mesenchymal stem cell-derived exosomes against the reproductive toxicity of cyclophosphamide is associated with the p38 MAPK/ERK and AKT signaling pathways. Asian J Androl. 2021;23(4):386-391.
  8. Lamb DJ. Chromosome defects and male factor infertility. Fertil Steril. 2025;123(6):933-942.
  9. Kathrins M, Niederberger C. Diagnosis and treatment of infertility-related male hormonal dysfunction. Nat Rev Urol. 2016;13(6):309-323.
  10. Piechka A, et al. Molecular mechanisms of cellular dysfunction in testes from men with non-obstructive azoospermia. Nat Rev Urol. 2024;21(2):67-90.
  11. Li Z, et al. The role of Cistanches Herba and its ingredients in improving reproductive outcomes: a comprehensive review. Phytomedicine. 2024;129:155681.
  12. Jiang X, et al. Shenling Baizhu San improves spermatogenic dysfunction in hyperuricemia mice by regulating Sirt3/Nrf2 to inhibit testicular ferroptosis. J Ethnopharmacol. 2025;340:119310.
  13. Deng W, Sun D, Cai B, Jin B. Yangjing capsule improves oligoasthenozoospermia by promoting nitric oxide production through the PLCγ1/AKT/eNOS pathway. Front Pharmacol. 2023;14:1056091.
  14. Zhao H, et al. Yangjing Capsule ameliorates spermatogenesis in male mice exposed to cyclophosphamide. Evid Based Complement Alternat Med. 2015;2015:980583.
  15. Jin B, et al. Yangjing Capsule improves testicular angiogenesis by activating the VEGFA/eNOS signaling pathway. Evid Based Complement Alternat Med. 2020;2020:1957267.
  16. Guo W, et al. Chlorocholine chloride exposure induced spermatogenic dysfunction via .iron overload caused by AhR/PERK axis-dependent ferritinophagy activation. Ecotoxicol Environ Saf. 2024;274:116193.
  17. Wang Z, et al. Yangjing Capsule extract promotes proliferation of GC-1 Spg cells. Evid Based Complement Alternat Med. 2014;2014:640857.
  18. Zhang P, et al. LncRNA-mediated adipogenesis in different adipocytes. Int J Mol Sci. 2022;23(13).
  19. Núñez-Martínez HN, Recillas-Targa F. Emerging functions of lncRNA loci beyond the transcript itself. Int J Mol Sci. 2022;23(11).
  20. Herman AB, Tsitsipatis D, Gorospe M. Integrated lncRNA function upon genomic and epigenomic regulation. Mol Cell. 2022;82(12):2252-2266.
  21. Wang JZ, et al. QKI-5 regulates the alternative splicing of the cytoskeletal gene ADD3 in lung cancer. J Mol Cell Biol. 2021;13(5):347-360.
  22. Zeng Y, et al. Nickel induces blood-testis barrier damage through ROS-mediated p38 MAPK pathways in mice. Redox Biol. 2023;67:102886.
  23. Luo D, He Z, Yu C, Guan Q. Role of p38 MAPK signaling in testis development and male fertility. Oxid Med Cell Longev. 2022;2022:6891897.
  24. Xia C, et al. LncRNA CCAT1 enhances chemoresistance in hepatocellular carcinoma by targeting QKI-5. Sci Rep. 2022;12(1):7826.
  25. Li K, et al. A long noncoding RNA binding to QKI-5 regulates germ cell apoptosis via .the p38 MAPK signaling pathway. Cell Death Dis. 2019;10(10):699.
  26. Zhou X, et al. ANKRD49 inhibits etoposide-induced intrinsic apoptosis of GC-1 cells by modulating NF-κB signaling. Mol Cell Biochem. 2019;457(1-2):21-29.
  27. Fang C, et al. Integrative proteomics and metabolomics approach to identify the key roles of icariin-mediated protective effects against cyclophosphamide-induced spermatogenesis dysfunction in mice. Front Pharmacol. 2022;13:1040544.
  28. Li K, et al. Adeno-associated-virus-mediated delivery of CRISPR-CasRx induces efficient RNA knockdown in the mouse testis. Theranostics. 2024;14(10):3827-3842.
  29. Yi H, et al. Retinoic acid mitigates NSC319726-induced spermatogenesis dysfunction through cuproptosis-independent mechanisms. Cell Biol Toxicol. 2024;40(1):26.
  30. Guo Y, Wang A, Liu X, Li E. Effects of resveratrol on reducing spermatogenic dysfunction caused by high-intensity exercise. Reprod Biol Endocrinol. 2019;17(1):42.
  31. Beeraka NM, et al. Ginsenoside Rh4 suppresses Notch3 and PI3K/Akt signaling to inhibit the growth and metastasis of gastric cancer cells. J Cancer Biomol Ther. 2025;2(1):145-156.
  32. Li P, et al. Proteomic analysis of cisplatin-induced spermatogenesis defects in mice. Ann Med. 2026;58(1):2612816.
  33. Wang Z, et al. Melatonin ameliorates paclitaxel-induced spermatogenesis and fertility defects in mice. J Cell Mol Med. 2022;26(4):1219-1228.
  34. Abdi M, et al. Cyclophosphamide-induced infertility and the impact of antioxidants. Am J Reprod Immunol. 2024;92(6):e70014.
  35. Özbilgin MK, Demirören S, Üçöz M, Oztatlici M. Cyclophosphamide suppresses spermatogenesis in the testes of mice through downregulation of miR-34b and miR-34c. Andrologia. 2021;53(7):e14071.
  36. Poojary KK, et al. Curcumin nanocrystals attenuate cyclophosphamide-induced testicular toxicity in mice. Toxicol Appl Pharmacol. 2021;433:115772.
  37. Cao J, et al. Single-cell map of human azoospermic testes caused by cyclophosphamide chemotherapy. Sci Data. 2024;11(1):163.
  38. Dong Y, et al. New insights into polycyclic aromatic hydrocarbons: Phenanthrene targets ribosomes to induce neuronal apoptosis. Aquat. Toxicol. 2026;298:107884.
  39. Wang Y, et al. Interplay between elemental imbalance-related PI3K/Akt/mTOR-regulated apoptosis and autophagy in arsenic (III)-induced jejunum toxicity of chicken. Environ. Sci. Pollut. Res. Int. 2018;25(19):18662-18672.
  40. Liu H, et al. Integrating network toxicology, transcriptomics and experimental validation to elucidate the potential mechanisms of fluoride-induced neurotoxicity in zebrafish. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 2026;306:110549.
  41. Saleh DO, et al. Cyclophosphamide-induced testicular injury: the role of chrysin in mitigating iron overload and ferroptosis. Naunyn Schmiedebergs Arch Pharmacol. 2025;398(5):5475-5489.
  42. Dong S, et al. Loss of lncRNAs 1700101O22Rik and 1700027A15Rik causes sperm malformation and subfertility. Andrology. 2025;13(5):1223-1235.
  43. Liu W, et al. A novel meiosis-related lncRNA, Rbakdn, contributes to spermatogenesis by stabilizing Ptbp2. Front Genet. 2021;12:752495.
  44. Sun TC, et al. LncRNAs induce oxidative stress and spermatogenesis by regulating endoplasmic reticulum genes and pathways. Aging (Albany NY). 2021;13(10):13764-13787.
  45. Hua R, et al. DNM3OS enhances the apoptosis and senescence of spermatogonia associated with nonobstructive azoospermia by providing miR-214-5p and decreasing E2F2 expression. Anal Cell Pathol (Amst). 2023;2023:1477658.
  46. Wang S, et al. Quaking 5 suppresses TGF-β-induced epithelial-mesenchymal transition and cell invasion in lung adenocarcinoma. EMBO Rep. 2021;22(6):e52079.
  47. Chen X, et al. The emerging roles of the RNA-binding protein QKI in cardiovascular development and function. Front Cell Dev Biol. 2021;9:668659.
  48. Li J, et al. Qiangjing tablets repair blood-testis barrier dysfunction in rats by regulating oxidative stress and the p38 MAPK pathway. BMC Complement Med Ther. 2022;22(1):133.
  49. Tang Z, et al. MRE11 is essential for the long-term viability of undifferentiated spermatogonia. Cell Prolif. 2024;57(9):e13685.
  50. Jiao Y, Feng Z, Zhang T, Chen X. Impact of Vitamin D(3) Supplementation on Androgens and Semen Parameters in Infertile Men: A Systematic Review and Meta-Analysis Based on Prospective Randomised Controlled Trials. Arch. Esp. 2025;78(6):772-781.

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Tags

BiologyYangjing Capsulesspermatogenic dysfunctionlncRNA NONMMUT031883 2Quaking I 5p38 MAPK pathway

Related Articles