Name: Investigating the Effects of Probiotics on Pneumococcal Colonization Using an In Vitro Adherence Assay (Video) | JoVE Journal
Uploaded: 2014-04-28T13:45:00.000+00:00
Duration: 9 min 20 s
Description: Learn in vitro adherence assays to study how probiotic Streptococcus salivarius inhibits Streptococcus pneumoniae colonization on epithelial cells. This method evaluates bacterial interactions for infectious disease research.

ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

This work was supported by funding from the Murdoch Childrens Research Institute and the Victorian Government&rsquo;s Operational Infrastructure Support Program.

1. Preparation of Epithelial and Bacterial Cells
<ol>
	<li>Thawing of CCL-23 epithelial cells
	<ol>
		<li>Prewarm Minimum Essential Media (MEM) containing 10% Fetal Bovine Serum (FBS) in a 37 &#176;C water bath for ~30 min.</li>
		<li>Sterilize the tissue culture-approved biosafety cabinet with UV light for at least 10 min before use, and wipe down the work area with 70% ethanol. Wipe the warmed media bottle with 70% ethanol and place in biosafety cabinet.</li>
		<li>Using a 25 ml pipette, transfer 14 ml of media into a T-75 flask. Place flask in 37 &#176;C incubator whilst cells are thawing (section 1.1.4).</li>
		<li>Remove a vial of CCL-23 cells from liquid nitrogen storage using appropriate safety precautions and warm in a 37 &#176;C water bath until ~80% thawed.</li>
		<li>Return the flask prepared in section 1.1.3 to the biosafety cabinet. Wipe outer surface of vial of CCL-23 cells with 70% ethanol and transfer contents (1 ml) into the T-75 flask using a P1000 pipette.</li>
		<li>Incubate the flask on its side in a 37 &#176;C, 5% CO2, 95% relative humidity tissue culture incubator overnight (16-20 hr).</li>
		<li>Check the cells under a microscope to confirm a healthy morphology, remove media, and replace with 15 ml fresh, prewarmed MEM + 10% FBS.</li>
	</ol>
	</li>
	<li>Maintenance of CCL-23 epithelial cells
	<ol>
		<li>Once cells are ~80% confluent (1-2 days), passage by removing media using a 25 ml pipette and gently wash the cells twice with 8-10 ml prewarmed phosphate buffered saline (PBS) using a 10 ml pipette.</li>
		<li>Remove PBS and add 1 ml of sterile 0.25% trypsin-EDTA (0.25% (w/v) trypsin, 0.1 mM EDTA). Turn flask on its side, rotate to ensure trypsin covers the confluent layer of cells, and incubate the flask for 2-3 min in the 37 &#176;C, 5% CO2 incubator.</li>
		<li>Return flask to the biosafety cabinet, add 9 ml prewarmed MEM + 10% FBS, and pipette up and down 6-8x to resuspend the cells, ejecting liquid down the side of the flask to dislodge cells.</li>
		<li>Split cells 1:15 (1 ml + 14 ml MEM + 10% FBS) or 1:30 (0.5 ml + 14.5 ml MEM + 10% FBS), discard excess cells, and return flask to the 37 &#176;C, 5% CO2 incubator.</li>
		<li>Passage the cells at least twice before use in the adherence assay. Typically cells are split every 3-4 days.</li>
	</ol>
	</li>
	<li>Seeding of CCL-23 epithelial cells (one day prior to adherence assay, Protocol&#160;2)
	<ol>
		<li>Split confluent cells as described in sections&#160;1.2.1-1.2.3, resuspending in prewarmed MEM + 5% FBS (FBS concentration is lowered to reduce the likelihood of serum components interfering in the assay). Remove 20 &#956;l of cells and count using trypan blue staining and a hemocytometer.</li>
		<li>Dilute cells in prewarmed MEM + 5% FBS to a concentration of 1.5 x 105 cells/ml in a sterile 50 ml tube.</li>
		<li>Seed 1 ml of cells/well in a tissue-culture treated 24-well plate.</li>
	</ol>
	</li>
	<li>Preparation of bacteria 
	This procedure can be followed for preparation of pneumococci and S. salivarius. Bacterial growth media is typically kept in a 37 &#176;C incubator overnight to prewarm and test for sterility (generally will appear cloudy if contaminated).
	<ol>
		<li>Two days prior to adherence assay, streak bacteria on horse blood agar (HBA) plates and incubate at 35-37 &#176;C and 5% CO2 for 18-24 hr. Sheep blood agar can be used as an alternative.</li>
		<li>The following day, prepare an overnight culture for each bacterial species by pipetting 10 ml Todd-Hewitt Broth with 0.5% yeast extract (THB+YE) medium into a sterile 30 ml tube. Using a 10 &#956;l loop, inoculate approximately 10-12 well separated colonies. Briefly vortex and incubate at 35-37 &#176;C and 5% CO2 for 14-16 hr. Note that pneumococci will autolyze if left too long in broth culture.</li>
	</ol>
	</li>
</ol>
2. Adherence Assay: Addition of Bacteria to Epithelial Cell Monolayers
<ol>
	<li>Preparation of mid-log bacterial cultures of pneumococci and S. salivarius
	<ol>
		<li>Pipette 10 ml of prewarmed THB+YE into each of two sterile 30 ml tubes, one labeled pneumococci and the other S. salivarius.</li>
		<li>To reach mid-log phase, pneumococci require ~3 hr and S. salivarius require ~2 hr incubation (see Figure 1). Start both cultures at the same time. Vortex (3-5 sec) overnight bacterial cultures and add 100 &#956;l pneumococci and 100 &#956;l S. salivarius into corresponding tubes.</li>
		<li>Briefly vortex and incubate the cultures at 37 &#176;C for approximately 2 hr for S. salivarius and 3 hr for pneumococci.</li>
	</ol>
	</li>
	<li>Preparation of CCL-23 cells for adherence assay
	<ol>
		<li>Using an inverted microscope, check the 24-well plate for confluent monolayers with healthy cell morphology. Monolayers should be &#62;80% confluent, without evidence of cell clumping or cytopathic effects such as cell rounding or loss of adherence (see Figure 2).</li>
		<li>Remove the media in each well using a transfer pipette, tilting the plate slightly to avoid disturbing the cell monolayer.</li>
		<li>To gently wash the cells, add ~500 &#956;l prewarmed PBS into each well using a serological pipette and remove it with a transfer pipette, tilting the plate slightly. Discard the PBS. Repeat wash step once.</li>
		<li>Add 500 &#956;l of prewarmed MEM + 5% FBS into each well. Return the 24-well plate to the CO2 incubator while preparing the bacterial cultures. 
		Note: To determine the exact CCL-23 cell number for multiplicity of infection (MOI), two wells can be trypsinized and counted on the day of infection.</li>
	</ol>
	</li>
</ol>
3. Adherence Assay
<ol>
	<li>Add pneumococci to the CCL-23 cells at a MOI ~10:1. Test the conditions listed in Table 1 in duplicate wells.
	<ol>
		<li>Measure the optical density at A600 (OD) of 1 ml of S. salivarius culture. OD should be between 0.3-0.6.</li>
		<li>Transfer 5 ml of S. salivarius culture into a 10 ml tube and centrifuge at 1,870 x g for 4 min.</li>
		<li>Discard the supernatant and based on the OD reading in section 3.1.1, resuspend S. salivarius in 200-1,000 &#956;l of 0.85% NaCl (final concentration ~1.5 x 109 CFU/ml). As a general guideline, an OD of 0.375 will be resuspended in 260 &#956;l. Prepare 1:10 and 1:100 dilutions of S. salivarius using 0.85% NaCl. 
		Note: In total, three concentrations (representing high, medium and low doses) of S. salivarius will be tested in the assay. The high dose is a ratio of ~10 S. salivarius : 1 pneumococci, the medium is ~1 S. salivarius : 1 pneumococci, and the low is ~1 S. salivarius : 10 pneumococci.</li>
		<li>Take out the 24-well plate from the incubator.</li>
		<li>From the heparin control wells, remove 40 &#956;l of media and add 50 &#956;l of heparin (1,000 U/ml stock concentration) for a final concentration of 100 U/ml.</li>
		<li>Add 10 &#956;l of 0.85% NaCl to wells containing CCL-23 cells only and wells containing CCL-23 cells and pneumococci (no S. salivarius).</li>
		<li>Add 10 ul of undiluted, 1:10 and 1:100 of S. salivarius to respective wells. 
		Note: S. salivarius can also be added at the same time as pneumococci (coaddition) or 1 hr after pneumococci (post-addition) to examine the effect of time of probiotic administration.</li>
		<li>Centrifuge the 24-well plate at 114 x g for 3 min to promote bacterial contact with the cell layer and incubate for 1 hr at 37&#176; C, 5% CO2 .</li>
		<li>Perform serial dilution of the S. salivarius stock in 0.85% NaCl and plate on duplicate HBA plates for viable counts. First, add 50 &#956;l of stock to 450 &#956;l of 0.85% NaCl to make a 10-1 dilution, then pulse vortex (5 sec), change tips, and add 50 &#956;l of the 10-1 dilution to 450 &#956;l of 0.85% NaCl to make a 10-2 dilution and so forth up to 10-7.</li>
		<li>Plate 100 &#956;l of the 10-5, 10-6, and 10-7 dilutions in duplicate on HBA plates and spread with a sterile spreader. Incubate HBA plates inverted overnight at 37 &#176;C, 5% CO2.</li>
		<li>Towards the end of the 1 hr incubation, repeat sections 3.1.1-3.1.3 for pneumococci. ODs should be between 0.2-0.7. Spin down 1 ml of pneumococcal culture and resuspend the pellet in 300-2,000 &#956;l of 0.85% NaCl (based on the OD reading) to a concentration of ~1.5 x 108 CFU/ml. As a general guideline, an OD of 0.3 will be resuspended in 500 &#956;l.</li>
		<li>After 1 hr incubation with S. salivarius, add 10 &#956;l undiluted pneumococci to all wells except negative control wells (containing cells only).</li>
		<li>Centrifuge the 24-well plate at 114 x g for 3 min and incubate at 37 &#176;C, 5% CO2 for 3 hr. Perform serial dilution of the pneumococci stock in 0.85% NaCl as described in section&#160;3.1.9 and plate dilutions 10-4, 10-5, and 10-6 on duplicate HBA plates for viable counts.</li>
	</ol>
	</li>
	<li>After 3 hr, check the cells under a microscope to ensure that monolayers look healthy (see Figure 2). Remove the media from each well and gently wash the cells 3x&#160;as described in section 2.2.3. using a different pipette for each condition. This step is essential to remove nonadherent pneumococci. The monolayers should not come apart during the washing process; this can be confirmed by checking again under a microscope.</li>
</ol>
Note: Media removed during this step can be stored at -20 &#176;C for additional analyses (e.g. measurement of cytokine levels).
<ol>
	<li>Add 200 &#956;l of 0.1% digitonin (a gentle detergent) to each well and incubate for 7 min at 37 &#176;C, 5% CO2.</li>
	<li>Add 800 &#956;l of THB media to each well. Lyse cells by pipetting up and down, and, if necessary, scrape wells 3-4x with the pipette tip to make sure the cell monolayer is completely removed. Change tips between wells.&#160;</li>
	<li>Remove the contents from each well using a P1000 pipette and transfer into labeled microfuge tubes.</li>
</ol>
4. Quantification of Adherent Pneumococci
Adherent pneumococci can be quantified by determining viable counts (serial dilution and plating on blood agar) or by quantitative real-time PCR.
<ol>
	<li>Viable count method 
	This method must be performed immediately after step 3.5 of the adherence assay.
	<ol>
		<li>For each assay well, prepare serial dilutions of samples collected in step 3.5 of the adherence assay by adding 50 &#956;l of samples to 450 &#956;l of 0.85% NaCl, pulse vortexing, and serially diluting as described in section 3.1.9 up to the 10-6 dilution.</li>
		<li>Plate 100 &#956;l of the 10-3, 10-4, 10-5, and 10-6 dilutions in duplicate on blood agar, spread with a sterile spreader, and incubate inverted plates overnight at 37 &#176;C, 5% CO2. Note that the wells containing CCL-23 cells alone should not contain any bacteria and can be plated neat (100 &#956;l undiluted) as a sterility control.</li>
		<li>The following day, determine the pneumococcal inocula by counting the colonies on the appropriate dilution plates (containing 30-300 colonies) prepared in section 3.1.13 of the adherence assay. Calculate the CFU/ml of the inocula using the averaged value from two plates. Similarly, determine the S. salivarius inocula by counting the colonies on the plates prepared in section 3.1.10. 
		Note: Plates should contain pneumococci only; the presence of other species indicates that the assay was contaminated and results are invalid.</li>
		<li>To determine the pneumococcal adherence levels, count the appropriate dilution plate (containing 30-300 pneumococcal colonies) for each sample prepared in section 4.1.1. Note that S. salivarius colonies will be small and white, whereas pneumococci will be flat and greenish due to &#945;-hemolysis, as shown in Figure 3. To calculate pneumococcal adherence, normalize the number of adherent pneumococci from condition b. CCL-23 cells + pneumococci to 100%, and compare adherent pneumococci from other conditions to this condition.</li>
	</ol>
	</li>
	<li>qPCR method 
	Samples collected in Adherence Assay step 3.5 can be stored at -20 &#176;C until DNA extraction. DNA extraction is performed using a commercial kit and described in sections 4.2.1-4.2.9 and the qPCR assay in sections 4.2.10-4.2.20.
	<ol>
		<li>Prepare Enzymatic Lysis Buffer (50 mM phosphate buffer pH 6.7 containing 1 mg/ml lysozyme, 0.075 mg/ml mutanolysin, and 2 mg/ml proteinase K). The following recipe can be used make 10 ml (enough for 50 extractions). Enzymatic lysis buffer should be freshly prepared prior to use. 
		 
		7.25 ml of 50 mM Phosphate Buffer solution (pH 6.7) 
		1.00 ml of 10 mg/ml lysozyme stock for a final [1 mg/ml] 
		0.75 ml of 1 mg/ml mutanolysin stock for a final [0.075 mg/ml] 
		1.00 ml of 20 mg/ml Proteinase K stock for a final [2 mg/ml] 
		&#160;</li>
		<li>Thaw the samples on ice or at 4 &#176;C. Vortex and transfer 100 &#956;l aliquots of each sample into labeled microfuge tubes. Return original samples back into the -20&#176;C freezer.</li>
		<li>Centrifuge the samples at 6,700 x g for 10 min.</li>
		<li>Remove and discard the supernatant. Add 200 &#956;l of enzymatic lysis buffer to the pellet and vortex to resuspend. Incubate the samples at 56 &#176;C for 30 min. Centrifuge briefly (5 sec) at 6,700 x g to collect liquid at the bottom of tube.</li>
		<li>Add 10 &#956;l of 20% SDS to complete the cell lysis and mix gently at room temperature for 2 min.</li>
		<li>Add 4 &#956;l of RNase A (100 mg/ml stock) and mix gently (on a rocker or by inverting the tubes) at room temperature for 2 min.</li>
		<li>Add 200 &#956;l of buffer AL (from kit) and vortex for 15 sec. Incubate samples at 70 &#176;C for 10 min. Centrifuge briefly (5 sec) at 6,700 x g to collect liquid at the bottom of tube.</li>
		<li>Add 200 &#956;l of 100% EtOH and vortex for 15 sec. Spin briefly to collect the liquid at bottom of tube, then transfer the mixture (including any precipitate) to the spin column (in a 2 ml collection tube) without wetting the rim. Follow wash steps according of the manufacturer&#8217;s protocol (not shown here).</li>
		<li>To elute DNA, transfer column into a labeled microfuge tube, add 50 &#956;l of Buffer AE (from kit), and incubate at room temperature for 2 min. Centrifuge at 4,300 x g for 1 min. Repeat once for a final elution volume of 100 &#956;l. DNA can be stored at -20 &#176;C until use.</li>
		<li>To perform qPCR, sterilize the hoods with UV light for 15 min prior to start. Preparing a 96-well plate map worksheet to record well locations for each sample is recommended.</li>
		<li>Prepare standard curve using a 10 ng/&#956;l stock of genomic pneumococcal DNA (extracted from reference strain ATCC 6305).
		<ol>
			<li>Thaw pneumococcal stock DNA and spin down briefly (5 sec) in a tabletop centrifuge.</li>
			<li>Perform 1:10 serial dilutions in 6 prelabeled microfuge tubes by adding 3 &#956;l DNA to 27 &#956;l nuclease-free H2O, changing tips and vortexing between each dilution. The final dilution series consists of 6 tubes: 1, 0.1, 0.01, 0.001, 0.0001, and 0.00001 ng/&#956;l. 
			Note: These can be stored at 4 &#176;C for up to one week.</li>
		</ol>
		</li>
		<li>Prepare lytA mastermix as follows in a sterile 15 ml conical tube in a sterile PCR hood. Thaw components on ice and vortex immediately prior to use.
		<table border="0">
			<tbody>
				<tr>
					<td>component</td>
					<td>per reaction </td>
					<td>x 102 (full plate)</td>
				</tr>
				<tr>
					<td>lytA F</td>
					<td>0.25 &#956;l of 10 &#956;M stock</td>
					<td>25.5 &#956;l</td>
				</tr>
				<tr>
					<td>lytA R</td>
					<td>0.25 &#956;l of 10 &#956;M stock</td>
					<td>25.5 &#956;l</td>
				</tr>
				<tr>
					<td>lytA probe</td>
					<td>0.5 &#956;l of 10 &#956;M stock</td>
					<td>51 &#956;l</td>
				</tr>
				<tr>
					<td>H2O</td>
					<td>9.5 &#956;l</td>
					<td>969 &#956;l</td>
				</tr>
				<tr>
					<td>Master mix</td>
					<td>12.5 &#956;l</td>
					<td>1,275 &#956;l</td>
				</tr>
				<tr>
					<td>Final volume</td>
					<td>23 &#956;l</td>
					<td>2,346 &#956;l</td>
				</tr>
			</tbody>
		</table>
		Note: Some real-time PCR machines require the use of a reference dye, which is contained in some commercial mastermixes or can be added separately. This protocol is designed for running 25 &#956;l reactions in a 96-well plate but can be adjusted to accommodate different real-time PCR machines. The primers and probe sequences were originally published by Carvalho et al.15 and are shown in the list of materials.</li>
		<li>Vortex and load 23 &#956;l/well of the lytA mix into the appropriate wells. Refer to plate map.</li>
		<li>Transport plate to template addition area (preferably a sterile cabinet in a separate room) for sample loading.</li>
		<li>Use a P2 pipette to load samples, changing tips for each well. All samples are run in duplicate. Refer to plate map for location.</li>
		<li>For standard curve wells, add 1 &#956;l/well of the appropriate dilution of standard curve DNA plus 1 &#956;l/well H2O to bring the final volume to 25 &#956;l. For no template control wells, add 2 &#956;l H2O.</li>
		<li>Add 2 &#956;l/well of sample DNA into appropriate wells.</li>
		<li>Cap all wells in use. Make sure caps are closed snugly. Quickly spin the PCR plate (5 sec) before loading the plate into a real-time PCR machine.</li>
		<li>Load plate into PCR machine and run qPCR according to the instructions provided by the machine manufacturer. The following hydrolysis probe cycling conditions are recommended:
		<table>
			<tbody>
				<tr>
					<td>Step 1 (1x):</td>
					<td>3 min at 95 &#176;C</td>
				</tr>
				<tr>
					<td>Step 2 (40x):</td>
					<td>20 sec at 95 &#176;C</td>
				</tr>
				<tr>
					<td></td>
					<td>20 sec at 60 &#176;C</td>
				</tr>
			</tbody>
		</table>
		</li>
		<li>Collect data and quantify pneumococcal DNA using the standard curve. Bacterial loads are calculated as previously described17, estimating that 1 pg of genomic DNA is equivalent to 447.4 cells, and reported as CFU/ml (assuming one genome per CFU, and one copy of lytA per genome; see Figure 4). For a successful assay, the R2 value should be &#8805;0.98 and all positive results within the range of the standard curve (cT values less than that obtained for the 0.00001 ng/&#956;l standard curve point are considered background/lytA negative). 
		Note: Some real-time PCR systems come with analysis software that can be used to construct standard curves and calculate unknowns. Otherwise, these calculations can be performed in Excel or similar programs. An example standard curve is shown in Figure 4.</li>
		<li>To calculate pneumococcal adherence, normalize the number of adherent pneumococci from condition b. CCL-23 cells + pneumococci to 100%, and compare adherent pneumococci from other conditions to this condition.</li>
	</ol>
	</li>
</ol>

<ol><li>O'Brien, K. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Burden+of+disease+caused+by+Streptococcus+pneumoniae+in+children+younger+than+5+years%3A+global+estimates%5BTitle%5D)+AND+%22Lancet%22%5BJournal%5D)">Burden of disease caused by Streptococcus pneumoniae in children younger than 5 years: global estimates.</a> Lancet. 374, 893-902 (2009).</li>
<li>Bogaert, D., de Groot, R., Hermans, P. W. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Streptococcus+pneumoniae+colonisation%3A+the+key+to+pneumococcal+disease%5BTitle%5D)+AND+%22Lancet+Infect.+Dis%22%5BJournal%5D)">Streptococcus pneumoniae colonisation: the key to pneumococcal disease.</a> Lancet Infect. Dis. 4 (04), 144-154 (2004).</li>
<li>Weinberger, D. M., Malley, R., Lipsitch, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Serotype+replacement+in+disease+after+pneumococcal+vaccination%5BTitle%5D)+AND+%22Lancet%22%5BJournal%5D)">Serotype replacement in disease after pneumococcal vaccination.</a> Lancet. 378 (10), 1962-1973 (2011).</li>
<li>Jacoby, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Modelling+the+co-occurrence+of+Streptococcus+pneumoniae+with+other+bacterial+and+viral+pathogens+in+the+upper+respiratory+tract%5BTitle%5D)+AND+%22Vaccine%22%5BJournal%5D)">Modelling the co-occurrence of Streptococcus pneumoniae with other bacterial and viral pathogens in the upper respiratory tract.</a> Vaccine. 25, 2458-2464 (2007).</li>
<li>Kwambana, B., Barer, M., Bottomley, C., Adegbola, R., Antonio, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Early+acquisition+and+high+nasopharyngeal+co-colonisation+by+Streptococcus+pneumoniae+and+three+respiratory+pathogens+amongst+Gambian+new-borns+and+infants%5BTitle%5D)+AND+%22BMC+Infect.+Dis%22%5BJournal%5D)">Early acquisition and high nasopharyngeal co-colonisation by Streptococcus pneumoniae and three respiratory pathogens amongst Gambian new-borns and infants.</a> BMC Infect. Dis. 11, (2011).</li>
<li>Licciardi, P. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Protecting+against+pneumococcal+disease%3A+critical+interactions+between+probiotics+and+the+airway+microbiome%5BTitle%5D)+AND+%22PLoS+Pathog%22%5BJournal%5D)">Protecting against pneumococcal disease: critical interactions between probiotics and the airway microbiome.</a> PLoS Pathog. 8, (2012).</li>
<li>Popova, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Beneficial+effects+of+probiotics+in+upper+respiratory+tract+infections+and+their+mechanical+actions+to+antagonize+pathogens%5BTitle%5D)+AND+%22J.+Appl.+Microbiol%22%5BJournal%5D)">Beneficial effects of probiotics in upper respiratory tract infections and their mechanical actions to antagonize pathogens.</a> J. Appl. Microbiol. 113 (6), 1305-1318 (2012).</li>
<li>Pracht, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((PavA+of+Streptococcus+pneumoniae+modulates+adherence%2C+invasion%2C+and+meningeal+inflammation%5BTitle%5D)+AND+%22Infect.+Immun%22%5BJournal%5D)">PavA of Streptococcus pneumoniae modulates adherence, invasion, and meningeal inflammation.</a> Infect. Immun. 73, 2680-2689 (2005).</li>
<li>Adamou, J. E., Wizemann, T. M., Barren, P., Langermann, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Adherence+of+Streptococcus+pneumoniae+to+human+bronchial+epithelial+cells+%28BEAS-2B%29%5BTitle%5D)+AND+%22Infect.+Immun%22%5BJournal%5D)">Adherence of Streptococcus pneumoniae to human bronchial epithelial cells (BEAS-2B).</a> Infect. Immun. 66, 820-822 (1998).</li>
<li>Wong, S. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Inhibition+of+Streptococcus+pneumoniae+adherence+to+human+epithelial+cells+in+vitro+by+the+probiotic+Lactobacillus+rhamnosus+GG%5BTitle%5D)+AND+%22BMC+Res.+Notes%22%5BJournal%5D)">Inhibition of Streptococcus pneumoniae adherence to human epithelial cells in vitro by the probiotic Lactobacillus rhamnosus GG.</a> BMC Res. Notes. 6 (1), 135(2013).</li>
<li>Wescombe, P. A., Heng, N. C. K., Burton, J. P., Chilcott, C. N., Tagg, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Streptococcal+bacteriocins+and+the+case+for+Streptococcus+salivarius+as+model+oral+probiotics%5BTitle%5D)+AND+%22Future+Microbiol%22%5BJournal%5D)">Streptococcal bacteriocins and the case for Streptococcus salivarius as model oral probiotics.</a> Future Microbiol. 4, 819-835 (2009).</li>
<li>Di Pierro, F., Adami, T., Rapacioli, G., Giardini, N., Streitberger, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Clinical+evaluation+of+the+oral+probiotic+Streptococcus+salivarius+K12+in+the+prevention+of+recurrent+pharyngitis+and%2For+tonsillitis+caused+by+Streptococcus+pyogenes+in+adults%5BTitle%5D)+AND+%22Expert.+Opin.+Biol.+Ther%22%5BJournal%5D)">Clinical evaluation of the oral probiotic Streptococcus salivarius K12 in the prevention of recurrent pharyngitis and/or tonsillitis caused by Streptococcus pyogenes in adults.</a> Expert. Opin. Biol. Ther. 13 (3), 339-343 (2013).</li>
<li>Fiedler, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Protective+mechanisms+of+respiratory+tract+streptococci+against+Streptococcus+pyogenes+biofilm+formation+and+epithelial+cell+infection%5BTitle%5D)+AND+%22Appl.+Environ.+Microbiol%22%5BJournal%5D)">Protective mechanisms of respiratory tract streptococci against Streptococcus pyogenes biofilm formation and epithelial cell infection.</a> Appl. Environ. Microbiol. 79, 1265-1276 (2013).</li>
<li>Slotved, H. C., Satzke, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((In+vitro+growth+of+pneumococcal+isolates+representing+23+different+serotypes%5BTitle%5D)+AND+%22BMC+Res.+Notes%22%5BJournal%5D)">In vitro growth of pneumococcal isolates representing 23 different serotypes.</a> BMC Res. Notes. 6, 10-1186 (2013).</li>
<li>Carvalho, M. dG. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Evaluation+and+improvement+of+real-time+PCR+assays+targeting+lytA%2C+ply%2C+and+psaA+genes+for+detection+of+pneumococcal+DNA%5BTitle%5D)+AND+%22J.+Clin.+Microbiol%22%5BJournal%5D)">Evaluation and improvement of real-time PCR assays targeting lytA, ply, and psaA genes for detection of pneumococcal DNA.</a> J. Clin. Microbiol. 45, 2460-2466 (2007).</li>
<li>Tonnaer, E. L. G. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Involvement+of+glycosaminoglycans+in+the+attachment+of+pneumococci+to+nasopharyngeal+epithelial+cells%5BTitle%5D)+AND+%22Microbes+Infect%22%5BJournal%5D)">Involvement of glycosaminoglycans in the attachment of pneumococci to nasopharyngeal epithelial cells.</a> Microbes Infect. 8, 316-322 (2006).</li>
<li>Smith-Vaughan, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Measuring+nasal+bacterial+load+and+its+association+with+otitis+media%5BTitle%5D)+AND+%22BMC+Ear+Nose+Throat+Disord%22%5BJournal%5D)">Measuring nasal bacterial load and its association with otitis media.</a> BMC Ear Nose Throat Disord. 6, (2006).</li>
<li>Letourneau, J., Levesque, C., Berthiaume, F., Jacques, M., Mourez, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((In+vitro+assay+of+bacterial+adhesion+onto+mammalian+epithelial+cells%5BTitle%5D)+AND+%22J.+Vis.+Exp%22%5BJournal%5D)">In vitro assay of bacterial adhesion onto mammalian epithelial cells.</a> J. Vis. Exp. , (2011).</li>
</ol>

The authors have nothing to disclose.

A critical portion of this assay is adding the appropriate concentrations of S. salivarius and pneumococci in sections 3.1.7 and 3.1.12. Concentrations are estimated using OD readings but the exact inocula are not determined until plates are counted the following day. For this reason, we recommend performing growth curves to measure OD and viable counts (CFU/ml) over time for all bacterial strains used in the assay to identify the mid-log phase and assist in estimating concentration by OD. Additionally, pneumoco...

Streptococcus pneumoniae (the pneumococcus) is a Gram positive bacterium that can cause infections including pneumonia, otitis media, and meningitis. It is a major cause of disease in children in low-income countries and responsible for an estimated 800,000 deaths of children under the age of five annually1. Pneumococci are frequently carried in the nasopharynx of young children. Although this colonization is generally considered asymptomatic, it precedes pneumococcal infection and serves as a reservoir for the bacteria in human populations2. Pneumococcal conjugate vaccination effectively reduces carriage of the serotypes contained within the vaccine. However, there are over 90 pneumococcal serotypes, and vaccination can lead to serotype replacement, whereby the elimination of vaccine serotypes is followed by a rise in carriage and disease caused by nonvaccine serotypes3. Also, in some high-risk populations, pneumococcal colonization often occurs very early in life, prior to administration of the first vaccine dose4,5. Recently, the use of probiotics has been proposed as an additional strategy to inhibit pneumococcal colonization6,7. In vitro adherence assays have been used to examine pneumococcal adherence8,9. These assays have been adapted to investigate the impact of the probiotic Lactobacillus rhamnosus GG (LGG) on pneumococcal adherence10.
In addition to LGG and other lactic acid bacteria, Streptococcus salivarius, a common resident of the oral cavity, has been investigated as a potential probiotic for the respiratory tract due to its colonization potential and ability to inhibit pneumococci and other respiratory pathogens in vitro11-13. The protocol presented here describes an adherence assay used to investigate the effects of S. salivarius K12 on pneumococcal adherence to the human epithelial cell line CCL-23. Prior to use in the assay, pneumococcal isolates were evaluated for adherence capabilities, as growth and adherence properties can vary substantially among isolates10,14. Growth curves of pneumococci and S. salivarius were performed to determine mid-log phase and estimate concentration (colony forming units or CFU/ml) by optical density (OD, Figure 1).&#160;It is recommended to examine growth by viable count and OD for each isolate prior to use in the assay. This assay can be performed in any laboratory with standard tissue culture facilities and equipment. In this protocol, the effects of three doses of S. salivarius administered 1 hr prior to the addition of pneumococci on the adherence of S. pneumoniae PMP843, a serotype 19F carriage isolate derived from a nasopharyngeal swab, are examined. Two different ways to quantify adherent pneumococci are presented: plating on blood agar to determine viable counts, and DNA extraction and detection of the pneumococcal lytA gene by qPCR15. The basic adherence assay protocol can be easily modified to test different doses or time of administration of probiotics and can also be used with other bacterial strains or species.

<table><tbody><tr><td>Minimum Essential Media (MEM)</td><td>Thermo Fisher Scientific</td><td>SH30244.01</td><td>&amp;nbsp;</td></tr><tr><td>Fetal Bovine Serum (FBS)</td><td>Thermo Fisher Scientific</td><td>SH30084.03</td><td>&amp;nbsp;</td></tr><tr><td>T-75 Flask</td><td>Nunc</td><td>156472</td><td>&amp;nbsp;</td></tr><tr><td>CCL-23 cells</td><td>ATCC</td><td>CCL-23</td><td>&amp;nbsp;</td></tr><tr><td>Trypsin</td><td>Life Technologies</td><td>15090046</td><td>&amp;nbsp;</td></tr><tr><td>24-well Cell culture plate</td><td>Nunc</td><td>142475</td><td>&amp;nbsp;</td></tr><tr><td>Horse blood agar (HBA) plates</td><td>Oxoid</td><td>PP2001</td><td>Sheep blood agar plates also acceptable</td></tr><tr><td>Todd-Hewitt Broth</td><td>Oxoid</td><td>CM0189</td><td>&amp;nbsp;</td></tr><tr><td>Yeast Extract</td><td>Beckton Dickinson</td><td>212750</td><td>&amp;nbsp;</td></tr><tr><td>Digitonin</td><td>Sigma-Aldrich</td><td>D141-100MG</td><td>&amp;nbsp;</td></tr><tr><td>Disposable cuvettes</td><td>Kartell</td><td>1938</td><td>&amp;nbsp;</td></tr><tr><td>Heparin</td><td>Pfizer</td><td>2112105</td><td>comes in sterile ampules at 5,000 IU/5m/&amp;nbsp;</td></tr><tr><td>Sterile spreader</td><td>Technoplas</td><td>S10805050</td><td>alternatively, a glass spreader can be dipped in 96% ethanol and flame sterilized before each use</td></tr><tr><td>Lysozyme</td><td>Sigma-Aldrich</td><td>L6876</td><td>&amp;nbsp;</td></tr><tr><td>Mutanolysin</td><td>Sigma-Aldrich</td><td>M9901</td><td>&amp;nbsp;</td></tr><tr><td>Proteinase K</td><td>Qiagen</td><td>19133</td><td>&amp;nbsp;</td></tr><tr><td>SDS 20% solution</td><td>Ambion</td><td>AM9820</td><td>&amp;nbsp;</td></tr><tr><td>RNase A</td><td>Qiagen</td><td>19101</td><td>&amp;nbsp;</td></tr><tr><td>QIAamp DNA mini-kit (250)</td><td>Qiagen</td><td>51306</td><td>&amp;nbsp;</td></tr><tr><td>LytA F primer</td><td>Sigma-Aldrich</td><td>Custom made</td><td>5&#039; -&gt; 3&#039; sequence ACGCAATCTAGCAGATGAAGCA</td></tr><tr><td>LytA R primer</td><td>Sigma-Aldrich</td><td>Custom made</td><td>5&#039; -&gt; 3&#039; sequence&amp;nbsp; TCGTGCGTTTTAATTCCAGCT</td></tr><tr><td>LytA probe</td><td>Eurogentec</td><td>Custom made</td><td>5&#039; -&gt; 3&#039; sequence Cy5-TGCCGAAAACGCTTGATACAGGGAG-BHQ3, alternative fluorophores can be used</td></tr><tr><td>Nuclease free water</td><td>Ambion</td><td>AM9906</td><td>&amp;nbsp;</td></tr><tr><td>Brilliant III Ultra Fast QPCR mastermix</td><td>Agilent Technologies</td><td>600880</td><td>&amp;nbsp;</td></tr><tr><td>Thermo-Fast 96 Detection plate&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td>AB-1100</td><td>&amp;nbsp;</td></tr><tr><td>Ultraclear qPCR cap strips</td><td>Thermo Fisher Scientific</td><td>AB-0866</td><td>&amp;nbsp;</td></tr><tr><td>Mx3005 QPCR System</td><td>Agilent Technologies</td><td>401449</td><td>&amp;nbsp;</td></tr><tr><td>*alternative sources are available for most/all products listed</td><td></td><td></td><td>&amp;nbsp;</td></tr></tbody></table>

investigating the effects of probiotics on pneumococcal colonization using an in vitro adherence assay

Investigating the Effects of Probiotics on Pneumococcal Colonization Using an In Vitro Adherence Assay

Adherence of Streptococcus pneumoniae (the pneumococcus) to the epithelial lining of the nasopharynx can result in colonization and is considered a prerequisite for pneumococcal infections such as pneumonia and otitis media. In vitro adherence assays can be used to study the attachment of pneumococci to epithelial cell monolayers and to investigate potential interventions, such as the use of probiotics, to inhibit pneumococcal&#160;colonization.&#160;The protocol described here is used to investigate the effects of the probiotic Streptococcus salivarius on the adherence of pneumococci to the human epithelial cell line CCL-23 (sometimes referred to as HEp-2 cells). The assay involves three main steps: 1) preparation of epithelial and bacterial cells, 2) addition of bacteria to epithelial cell monolayers, and 3) detection of adherent pneumococci by viable counts (serial dilution and plating) or quantitative real-time PCR (qPCR). This technique is relatively straightforward and does not require specialized equipment other than a tissue culture setup. The assay can be used to test other probiotic species and/or potential inhibitors of pneumococcal colonization and can be easily modified to address other scientific questions regarding pneumococcal adherence and invasion.

Results from a representative experiment in which pneumococci (S. pneumoniae PMP843, a colonizing 19F isolate) were added to CCL-23 cells 1 hr after the addition of S. salivarius, and pneumococcal adherence was quantified by both viable count and lytA qPCR are shown in Table 2. Results were consistent between the two methods for both the absolute number of bacteria (presented as CFU/ml) and the % adherence, normalized to the number of adherent pneumococci in the wells containin...

In vitro adherence assays can be used to study the attachment of Streptococcus pneumoniae to epithelial cell monolayers and to investigate potential interventions such as the use of probiotics for inhibiting pneumococcal colonization.

Adherence of Streptococcus pneumoniae (the pneumococcus) to the epithelial lining of the nasopharynx can result in colonization and is considered a ...

The overall goal of this procedure is to examine the ability of a probiotic streptococcus cell levarius to inhibit pneumococcal adherence to an epithelial cell line. This is accomplished by first preparing CCL 23 epithelial cell monolayers. In a 24 well plate next slovar and pneumococci are added to the monolayer in sequence and the cells are incubated.In the final step, the wells are washed to remove the non-adherent bacteria. The CCL 23 epithelial cells are lysed and the well contents are harvested. Ultimately, the impact of salivarius on pneumococcal adherence can be evaluated by quantifying the number of cell associated pneumococci.This method helps answer key questions in the infectious diseases field, such as whether probiotics can inhibit the adherence of bacterial pathogens such as the pneumococcus. We first had the idea for this method when we began investigating the potential use of lactobacillus hypnosis, GG, and other probiotics in the respiratory tract. Demonstrating this procedure will be Jane Manning and Zen to PhD students from our laboratory On the day before the experiment split to culture of confluence, CCL 23 epithelial cells, and then dilute them in Prewarm media to a 150, 000 cells per milliliter concentration in a sterile 50 milliliter tube.Next seed, one milliliter of the cells per well in a treated 24 well tissue culture plate and incubate the cells overnight. Then using a 10 microliter loop inoculate, 10 to 12 well separated colonies of each bacterial culture into a 10 milliliter aliquot of Todd Hewitt broth plus 0.5%yeast extract. Briefly vortex and incubate the cultures for 14 to 16 hours on the day of the experiment.Vortex each of the bacterial cultures for three to five seconds, then add 100 microliters of pneumococci and 100 microliters of salivarius into labeled prewarm tubes, containing 10 milliliters of broth. Vortex the inoculated tubes for three to five seconds and incubate at 37 degrees Celsius to grow the cultures to mid log phase. After confirming at least 80%co fluency of the CCL 23 cell culture, use the transfer pipette to remove the media from each well of the 24 well plate tilting the plate slightly to avoid disturbing the cell monolayer then wash wells twice by adding approximately 500 microliters of pre prewarm PBS and gently removing the liquid with a transfer pipette.Tilt the plate during the washes to help preserve the monolayer after the second wash. Add 500 microliters of prewarm media to each well and return the plate to the incubator while preparing the bacterial cultures. First, measure the optical density of one milliliter of the levarius culture at absorbent 600.Then transfer five milliliters of the Sal Levarius culture into a 10 milliliter tube and centrifuge to tube for four minutes at 1, 870 Gs at room temperature. After discarding the snat Resus, suspend the pellet in 200 to 1000 microliters of point 85%sodium chloride depending on the OD reading to a final concentration of approximately 1.5 times 10 to the ninth colony forming units per milliliter. Adding the correct number of bacteria is the trickiest part of the experiment as the actual number of bacteria added is not determined until colony counting is performed the following day.Now transfer the resuspended salivary inoculum to a micro fuge tube labeled high. Dilute the high concentration at one to 10 and one to 100 in more point 85%sodium chloride to make medium and low concentrations of alvar for the assay vortex tubes in between dilutions to create the heparin control wells. Remove 40 microliters of media from each control well and add 50 microliters of heparin to a final concentration of 100 units per milliliter per well.Add 10 microliters of point, 85%sodium chloride to the CCL 23 cells only, and the CCL 23 cells plus pneumococci only wells completely vortex all SIV areas concentrations. Then add 10 microliters of undiluted one to 10 and one to 100 siv various concentrations to the appropriate wells to promote bacterial contact with the cell. Monolayer centrifuge the plate for three minutes at 114 Gs at room temperature and then incubate the plate for an hour while the cells are incubating serially dilute the salivary stock in point 85%sodium chloride and use a sterile spreader to disperse 100 microliters of the 10 to the minus five, 10 to the minus six and 10 to the minus seven dilutions in duplicate on horse blood agar plates.Culture the plates in an inverted position overnight towards the end of the monolayer as salvers incubation. Measure the optical density of the pneumococcal culture and then spin down one milliliter of the cells. Resus suspend the pellet in 300 to 2000 microliters of point 85%sodium chloride depending on the OD reading to a final concentration of approximately 150 million colony forming units per milliliter.Then add 10 microliters of undiluted pneumococci to all the wells except the negative control wells centrifuge the 24 well plate again and then incubate the co cultures for three hours during the incubation step. Serially dilute and plate the pneumococcal stock in a similar manner to salivarius. After three hours of incubation, check the cells under the microscope for any cytopathic effect.Now remove the media from each well and gently wash the co cultures three times with one XPBS to remove the non-adherent bacteria, taking care not to disturb the monolayers. Then lys the cells with 200 microliters of 0.1%Dig toin for seven minutes at 37 degrees Celsius and 5%carbon dioxide. Next, add 800 microliters of THB to each.Well pipette up and down a few times and harvest the cell suspensions from each well into labeled micro centrifuge tubes. Finally, serially dilute the adherent pneumococci and then count the colonies the following day on the appropriate dilution plates. To quantify the pneumococci and alvar in this table, the results from a representative experiment in which the pneumococci were added to CCL 23 cells one hour after the addition of slovar are shown.Pneumococcal adherence was quantified by both viable count and lit. A-Q-P-C-R results were consistent between the two methods for both the absolute number of bacteria and the percent adherence. Normalized to the number of adherent pneumococci in the wells containing pneumococci alone.Heparin is used as a control as it is known to inhibit pneumococcal adherence. Therefore, the reduction of the adherence by approximately 40%or more in the pneumococci plus heparin samples compared to pneumococcal alone is indicative of a successful assay. As salivary inhibits pneumococcal adherence in a dose dependent manner where the high concentration of salivarius of approximately 10 salivarius to one pneumococcus resulted in the lowest pneumococcal adherence.These graft demonstrate the adherence of pneumococci to the CCL 23 cells when salivarius is added, one hour before the pneumococci concurrently, or one hour after the pneumococci. Alvar is more effective at inhibiting pneumococcal adherence when added prior to the pneumococci, as both the high and medium doses of Alvar significantly reduced pneumococcal adherence in the pre edition assay. Whereas the Coit edition and post edition assays only the high doses of Slovar inhibited pneumococcal adherence.So after watching this video, you should have a good understanding of how to perform an in vitro assay to measure the inhibition of pneumococcal adherence by the probiotic streptococcus cell areas.

investigating-effects-probiotics-on-pneumococcal-colonization-using

Research

JoVE Journal

Immunology and Infection

This protocol is a simple bacterial adhesion assay consisting in counting the numbers of bacterial colony forming units that are adhered onto cultured cells. The assay is robust, independent of the adhesin studied, and numerous variations are used in most laboratories working on bacterial pathogenesis.

In Vitro Assay of Bacterial Adhesion onto Mammalian Epithelial Cells

Source: Jagau, H. et al. Pneumococcus Infection of Primary Human Endothelial Cells in Constant Flow. J. Vis. Exp. (2019)This video demonstrates the real-time visualization of pneumococcal attachment to Von Willebrand Factor (VWF) strings on endothelial cells under constant media flow conditions. It outlines the steps for stimulating VWF release, labeling the strings, and quantifying bacterial binding.

Evaluating Pneumococcal Attachment to Primary Human Endothelial Cells Under Constant Media Flow

Source: Calatayud Arroyo, M., et al. Assessing the Viability of a Synthetic Bacterial Consortium on the In Vitro Gut Host-microbe Interface. J. Vis. Exp. (2018).This video demonstrates an in vitro gut host–microbe model to study bacterial viability. A co-culture of Caco-2 and HT29-MTX cells is incubated with bacteria pre-treated under simulated digestive conditions. Epithelial barrier integrity is assessed using transepithelial electrical resistance, and fractions from the medium, solubilized...

In Vitro Gut Model to Assess Bacterial Adhesion and Internalization

The video demonstrates a solid-phase adherence assay for assessing biofilm formation. In a multi-well plate, bacteria in bile salt-supplemented media adhere to solid surfaces, forming biofilms, which is confirmed by colorimetry through crystal violet staining and ethanol treatment.

A Solid Phase Adherence Assay to Assess Biofilm Formation

Colonization of the murine nasopharynx with Streptococcus pneumoniae and the subsequent extraction of adherent or recruited cells is described. This technique involves flushing the nasopharynx and collection of the fluid through the nares and is adaptable for various readouts, including differential cell quantification and analysis of mRNA expression in situ.

Characterization of Inflammatory Responses During Intranasal Colonization with Streptococcus pneumoniae

Streptococcus pneumoniae is the leading pathogen causing severe community-acquired pneumonia and responsible for over 2 million deaths worldwide. The impact of bacterial factors implicated in fitness or virulence can be monitored in real-time in an acute mouse pneumonia or bacteremia model using bioluminescent bacteria.

Following in Real Time the Impact of Pneumococcal Virulence Factors in an Acute Mouse Pneumonia Model Using Bioluminescent Bacteria

Competition in Streptococcus pneumoniae is mediated by bacteriocins, small antimicrobial peptides with inhibitory activity towards pneumococcus and other related species.  Here we describe an optimized bacterial overlay assay that allows for the characterization of bacteriocin activity and inhibitory spectrum, bacteriocin-specific immunity, and detection of secreted quorum sensing peptides.

Using the Overlay Assay to Qualitatively Measure Bacterial Production of and Sensitivity to Pneumococcal Bacteriocins

This study details the process of gavaging precise amounts of probiotics to neonatal mice. The experimental set-up was optimized to include but is not limited to probiotic dosing, methods of administration, and quantification of bacteria in the intestines.

Probiotic Studies in Neonatal Mice Using Gavage

Detection of host-bacterial pathogen interactions based on phenotypic adherence using high-throughput fluorescence labeling imaging along with automated statistical analysis methods enables rapid evaluation of potential bacterial interactions with host cells.

Automated, High-Throughput Detection of Bacterial Adherence to Host Cells

This paper describes a novel mouse model for the transition of pneumococcus from an asymptomatic colonizer to a disease-causing pathogen during viral infection. This model can be readily adapted to study polymicrobial and host-pathogen interactions during the different phases of disease progression and across various hosts.

A Mouse Model for the Transition of Streptococcus pneumoniae from Colonizer to Pathogen upon Viral Co-Infection Recapitulates Age-Exacerbated Illness

This protocol describes the necessary steps for colonization of mice with pks+ Escherichia coli under non-inflammatory conditions, as well as non-invasive methods for validation of colonization and assessment of pks+ E. coli expansion in feces.

Colonization with Murine pks+ Escherichia coli under Non-Inflammatory Conditions

Learn in vitro adherence assays to study how probiotic Streptococcus salivarius inhibits Streptococcus pneumoniae colonization on epithelial cells. This method evaluates bacterial interactions for infectious disease research.

Investigating the Effects of Probiotics on Pneumococcal Colonization Using an In Vitro Adherence Assay

Explore More Videos