Name: Cryosectioning Method for Microdissection of Murine Colonic Mucosa (Video) | JoVE Journal
Uploaded: 2015-07-12T13:00:00.000+00:00
Duration: 6 min 16 s
Description: Learn cryosectioning to microdissect murine colonic mucosa into crypt-base and surface epithelial regions. This fast, inexpensive method enables gene and protein expression analysis via real-time PCR and Western blot.

ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

Supported by National Institutes of Health (DK55679, and DK59888 to A.N.). Emory University&#160;Integrated Cellular Imaging Microscopy Core of the Winship Cancer&#160;Institute comprehensive cancer center grant, P30CA138292, and the Crohn's and Colitis Foundation of America Career Development award to C.T.C. and Fellowship Award to A.E.F.

Experiments used C57BL/6 mice between 10 and 12 weeks of age. All procedures using animals were reviewed and approved by the Emory University Institutional Animal Care and Use Committee and were performed according to National Institutes of Health criteria.
1. Experimental Setup
<ol>
	<li>Set Up the Cryostat
	<ol>
		<li>Equilibrate cryostat to -20 &#176;C, including the microtome blade and chucks (exercise extreme caution around the blade!).</li>
		<li>Fill an empty cryomold with OCT (Optimal Cutting Temperature compound) and equilibrate to -20 &#176;C (~30 min). Remove the frozen OCT from the mold and fix it on the chuck with liquid OCT. Place the block/chuck in the microtome arm and allow the OCT to set for 10 min.</li>
		<li>Set the cryostat to 10 &#181;m per section and shave the OCT block until it is flat. Back the microtome arm away from the blade by several centimeters. At this point do not adjust the blade or chuck for the remainder of the experiment.</li>
	</ol>
	</li>
	<li>Prepare the razor blades: Prepare 2 razor blades per sample. Using a metal file, dull the sharped edge of blades. Next, remove the aluminum flange with forceps.</li>
	<li>Pre-chill a Pyrex dish or other flat surface on dry ice.</li>
	<li>Prepare a dissection dish with 10-15 dissection pins. A 10 cm tissue culture dish 50% filled with silicon will suffice. Add 5 ml of Hanks buffer at RT.</li>
</ol>
2. Dissection of Distal Colonic Tissue
<ol>
	<li>Place mice in a sealed chamber and euthanize mice by isoflurane inhalation and cervical dislocation, then spray 70% ethanol onto the abdomen and thorax12.</li>
	<li>Make a small incision in skin of the abdomen with scissors and then make an incision to expose the peritoneal cavity. Similar procedures can be found described here12.</li>
	<li>Cut the large intestine at the anal verge and tease apart the mesentery until the colon is free.</li>
	<li>Excise a distal colon segment between 0 and 6 cm from the anus. Here, the crypt depth is ~150 &#181;m (see Figure 1B). Cut open the colon longitudinally using scissors and remove the fecal contents.</li>
	<li>Pin the tissue to the dissection dish with the mucosal surface facing up. Stretch the tissue using dissection pins on a silicon dish in Hanks buffer and let rest for 10 min at RT (Figure 1C). This removes folds from the tissue and allows the muscle layers to relax.</li>
</ol>
3. Mount Tissue on the Cryostat for Sectioning
<ol>
	<li>Slide a razor blade under the desired section of tissue and then pour off the Hanks buffer. Add another razor blade to the top, making a sandwich. Cut the tissue segment and remove the pins. Transfer the razor blade/tissue sandwich to dry ice. Allow the tissue to freeze (5-10 min, Figure 1D).</li>
	<li>Pick up the razor/tissue sandwich and allow it to warm slightly by placing a finger on the top blade (mucosal side up. This orients the tissue so that the basal muscle layers are sectioned first.). Separate the sandwich and cut around the edges of the tissue segment. Cut a tissue segment approximately, 0.5 cm x 1 cm. Edge areas have a tendency to curl, causing the serial sections to contain many tissue layers. Note that over-cutting is better than under-cutting, so err on the side of caution.</li>
	<li>Allow the tissue to warm until the ice on top of the tissue begins to melt. At this point quickly and carefully press the tissue into the OCT block in the cryostat.</li>
	<li>Remove the blade by placing a finger over the sample. The heat transfer will allow you to remove the blade without disrupting the tissue.</li>
	<li>Coat the tissue with OCT and equilibrate for 5 min. Cut sections at 10 &#181;m (Figure 1E, F). Visually inspect the sections until the crypts are seen. Place sections in a 1.5 ml tubes or on slides.</li>
	<li>For analysis of mRNA or protein, place the samples in tubes with 5 crypt-base, 5 transitional, and 5 surface sections per tube. For RNA collection add 1 ml commercial isolation reagent and incubate at RT for 10 min. Perform RNA purification according to manufacturer&#8217;s instructions. Use 5-10 &#181;g of total RNA for cDNA generation.</li>
	<li>For protein purification, add 0.5 ml of cold RIPA lysis buffer (plus protease inhibitors) per 5 sections. Sonicate 3 times at a 70% cycle, on ice.
	<ol>
		<li>Add samples to SDS PAGE loading buffer (Laemmli buffer) and incubate at 100 &#176;C for 10 min. Subject samples to SDS PAGE and transfer, then block in 5% milk/PBS for 2 hr. Perform western blot analysis followed by incubation with KLF4 antibodies (1:500) O/N at 4 &#176;C.</li>
	</ol>
	</li>
</ol>

<ol><li>Noah, T. K., Donahue, B., Shroyer, N. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Intestinal+development+and+differentiation%5BTitle%5D)+AND+%22Exp+Cell+Res%22%5BJournal%5D)">Intestinal development and differentiation.</a> Exp Cell Res. 317, 2702-2710 (2011).</li>
<li>Humphries, A., Wright, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Colonic+crypt+organization+and+tumorigenesis%5BTitle%5D)+AND+%22Nat+Rev+Cancer%22%5BJournal%5D)">Colonic crypt organization and tumorigenesis.</a> Nat Rev Cancer. 8, 415-424 (2008).</li>
<li>Weber, C. R., Turner, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Inflammatory+bowel+disease%3A+is+it+really+just+another+break+in+the+wall%5BTitle%5D)+AND+%22Gut%22%5BJournal%5D)">Inflammatory bowel disease: is it really just another break in the wall.</a> Gut. 56, 6-8 (2007).</li>
<li>Bjerknes, M., Cheng, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Methods+for+the+isolation+of+intact+epithelium+from+the+mouse+intestine%5BTitle%5D)+AND+%22Anat+Rec%22%5BJournal%5D)">Methods for the isolation of intact epithelium from the mouse intestine.</a> Anat Rec. 199, 565-574 (1981).</li>
<li>Sato, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Single+Lgr5+stem+cells+build+crypt-villus+structures+in+vitro+without+a+mesenchymal+niche%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche.</a> Nature. 459, 262-265 (2009).</li>
<li>Rand, M. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Calcium+depletion+dissociates+and+activates+heterodimeric+notch+receptors%5BTitle%5D)+AND+%22Mol+Cell+Biol%22%5BJournal%5D)">Calcium depletion dissociates and activates heterodimeric notch receptors.</a> Mol Cell Biol. 20, 1825-1835 (2000).</li>
<li>Gjorevski, N., Boghaert, E., Nelson, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Regulation+of+Epithelial-Mesenchymal+Transition+by+Transmission+of+Mechanical+Stress+through+Epithelial+Tissues%5BTitle%5D)+AND+%22Cancer+Microenviron%22%5BJournal%5D)">Regulation of Epithelial-Mesenchymal Transition by Transmission of Mechanical Stress through Epithelial Tissues.</a> Cancer Microenviron. 5, 29-38 (2012).</li>
<li>Lechner, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Gene+expression+pattern+of+laser+microdissected+colonic+crypts+of+adenomas+with+low+grade+dysplasia%5BTitle%5D)+AND+%22Gut%22%5BJournal%5D)">Gene expression pattern of laser microdissected colonic crypts of adenomas with low grade dysplasia.</a> Gut. 52, 1148-1153 (2003).</li>
<li>Reizel, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Colon+stem+cell+and+crypt+dynamics+exposed+by+cell+lineage+reconstruction%5BTitle%5D)+AND+%22PLoS+Genet%22%5BJournal%5D)">Colon stem cell and crypt dynamics exposed by cell lineage reconstruction.</a> PLoS Genet. 7, e1002192(2011).</li>
<li>Kosinski, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Gene+expression+patterns+of+human+colon+tops+and+basal+crypts+and+BMP+antagonists+as+intestinal+stem+cell+niche+factors%5BTitle%5D)+AND+%22Proc+Natl+Acad+Sci+U+S+A%22%5BJournal%5D)">Gene expression patterns of human colon tops and basal crypts and BMP antagonists as intestinal stem cell niche factors.</a> Proc Natl Acad Sci U S A. 104, 15418-15423 (2007).</li>
<li>Tamura, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Pit+pattern+and+three-dimensional+configuration+of+isolated+crypts+from+the+patients+with+colorectal+neoplasm%5BTitle%5D)+AND+%22J+Gastroenterol%22%5BJournal%5D)">Pit pattern and three-dimensional configuration of isolated crypts from the patients with colorectal neoplasm.</a> J Gastroenterol. 37, 798-806 (2002).</li>
<li>Geem, D., Medina-Contreras, O., Kim, W., Huang, C. S., Denning, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Isolation+and+characterization+of+dendritic+cells+and+macrophages+from+the+mouse+intestine%5BTitle%5D)+AND+%22Journal+of+visualized+experiments+%3A+JoVE%22%5BJournal%5D)">Isolation and characterization of dendritic cells and macrophages from the mouse intestine.</a> Journal of visualized experiments : JoVE. , e4040(2012).</li>
<li>Laukoetter, M. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((JAM-A+regulates+permeability+and+inflammation+in+the+intestine+in+vivo%5BTitle%5D)+AND+%22J+Exp+Med%22%5BJournal%5D)">JAM-A regulates permeability and inflammation in the intestine in vivo.</a> J Exp Med. 204, 3067-3076 (2007).</li>
<li>Neumann, P. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Gut+commensal+bacteria+and+regional+Wnt+gene+expression+in+the+proximal+versus+distal+colon%5BTitle%5D)+AND+%22Am+J+Pathol%22%5BJournal%5D)">Gut commensal bacteria and regional Wnt gene expression in the proximal versus distal colon.</a> Am J Pathol. 184, 592-599 (2014).</li>
<li>Capaldo, C. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Proinflammatory+cytokine-induced+tight+junction+remodeling+through+dynamic+self-assembly+of+claudins%5BTitle%5D)+AND+%22Mol+Biol+Cell%22%5BJournal%5D)">Proinflammatory cytokine-induced tight junction remodeling through dynamic self-assembly of claudins.</a> Mol Biol Cell. 25, 2710-2719 (2014).</li>
<li>Wells, J. M., Spence, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((How+to+make+an+intestine%5BTitle%5D)+AND+%22Development%22%5BJournal%5D)">How to make an intestine.</a> Development. 141, 752-760 (2014).</li>
</ol>

The authors have nothing to disclose

The molecular mechanisms involved in colonic epithelial cell proliferation and differentiation are poorly understood. This includes gaps in our understanding of the cellular signaling environment of the stem cell compartment at the base of the colonic epithelial crypts. There is also an increasing interest in the processes that underlie enterocyte differentiation. For example, increased understanding of in vivo differentiation is required as a benchmark for studies aimed at producing in vitro primary intestinal systems16.
The above procedure contains several steps that require extra attention. Firstly, removing the edges around the frozen tissue segment (as discussed in section 3.2) is required as the tissue edges curl during dissection and freezing. Failure to move these edges results is a mixed population of surface and crypt base cells. Mounting the tissue on a pre-chilled, leveled OCT block is also essential. This protocol can be adapted to other areas of the distal colon by altering the number of sections in each pool. For example, as shown in Figure 1B, mucosal crypt length varies between 150-300 &#956;m. Therefore, when studying the region between 4 cm-6 cm from the anus, the number of sections should be increased from 15 to 30. Importantly, this protocol is not suggested for the proximal colon (7 cm-9 cm) due to folds (plicae obliquae) which extend into the lumen making it impossible to separate surface and crypt-base cells by serial sectioning.
Serial sectioning techniques have been used to study crypt-base and surface epithelial cell populations in humans. However, our protocol adds additional steps that are required due to the small size of murine tissue. We propose that the above protocol will allow for the investigation of crypt-base and surface epithelial cell population in genetically tractable mouse systems. Indeed, pooled sections yield high quality protein and RNA suitable downstream analysis. Future applications could include the study of cell signaling pathways or chromatin immunoprecipitation. However, it should be noted that, like several of the alternative methods described above, the resulting sections contain a mixture of epithelial and interstitial lamina propria cells. In conclusion, the protocol described here provides a rapid, high yield method for the analysis of molecular processes in spatially distinct regions of the murine colonic mucosa.

The colonic epithelial lining is a highly regenerative tissue, with resident stem cells replenishing the tissue every few days1. This process of regeneration requires the maintenance of a proliferative stem cell compartment. Over time, the newly produced daughter cells lose their proliferative potential and migrate toward the luminal surface of the intestine. Coincident with migration, progenitor cells differentiate into mature barrier-forming enterocytes or mucous producing goblet cells. Failure of this differentiation program is thought to contribute to compromised epithelial barrier such as is observed in inflammatory bowel disease and colon cancer2,3.
Detailed study of the above processes will require methodologies for isolating crypt-base and surface cell populations. Multiple methods exist, each with unique advantages and drawbacks. Current methods for the isolation of intestinal epithelial cells include chelating agents and mechanical disassociation, resulting in the isolation of entire crypts, epithelial sheets, or single cells, dependent on experimental conditions4,5. These are high yield methods, yet changes in intercellular signaling have been reported under these conditions that may not represent the native environment6,7. Laser capture microdissection allows for the collection of spatial distinct material, but achieves low molecular yield8,9. In human colonic tissue, serial horizontal cryosectioning methods have been developed10. However, murine mucosal tissues are prohibitively small for direct appropriation of this technique. In humans, intestinal crypt lengths (the distant between the crypt-base and surface cells) in the colon varies between ~100&#8211;1,000 &#956;m 11. In mice, crypt lengths are between ~50&#8211;300 &#956;m (see Figure 1A). The small size of murine crypts presents a challenge to the isolation of these two cell populations using existing protocols.
We now describe a low cost, high yield method for the isolation of crypt-base and surface epithelial cell population in murine colonic tissue. Tissue harvested in this manner may then be analyzed by a number of standard downstream applications, including immunofluorescence staining, RT&#8211;PCR (Real Time&#8211;Polymerase Chain Reaction) or western blotting.

<table><tbody><tr><td>Microtome</td><td>Leica Biosystems, Nussloch Germany</td><td>CM 1510-3</td><td></td></tr><tr><td>MyiQ real time PCR detector</td><td>BioRad</td><td></td><td></td></tr><tr><td>LSM 510&amp;nbsp;</td><td>Carl Zeiss</td><td></td><td>Confocal microscope</td></tr><tr><td>OCT</td><td>Tissue-Tek, Sakura Finetek, Torrance CA</td><td>4583</td><td></td></tr><tr><td>cryo-mold</td><td>Tissue-Tek, Sakura Finetek, Torrance CA</td><td>4557</td><td>25mmx20mmx5mm</td></tr><tr><td>High profile microtome blade</td><td>Leica Biosystems, Nussloch germany</td><td>818</td><td></td></tr><tr><td>GEM industrial blades</td><td>American Safety Razor Blades</td><td>62-0314</td><td></td></tr><tr><td>Sylgard silicon elastomere base</td><td>Dow Corning, Midland MI</td><td>3097358</td><td></td></tr><tr><td>27 1/2 g needle</td><td>Becton-Dickinson, Franklin Lakes, NJ</td><td>305109</td><td>pins for dissection</td></tr><tr><td>TRizol</td><td>Life Technologies</td><td>15596018</td><td></td></tr><tr><td>Rneasy</td><td>Qiagen</td><td>74104</td><td></td></tr><tr><td>DNAse</td><td>Qiagen</td><td>79254</td><td></td></tr><tr><td>Antibody ZO-1</td><td>Invitrogen&amp;nbsp;</td><td>187430</td><td></td></tr><tr><td>Antibody KLF4</td><td>Cell Signaling</td><td>4038S</td><td></td></tr><tr><td>Antibody mGAPDH</td><td>Sigma</td><td>G8795</td><td></td></tr><tr><td>Antibody Secondary Alexa conjugate</td><td>Invitrogen</td><td>A11034</td><td>488 anti-rabbit</td></tr><tr><td>Antibody Secondary HRP conjugate</td><td>Jackson</td><td>111/115-001-003</td><td>rabbit/mouse&amp;nbsp;</td></tr><tr><td>Topro-3</td><td>Invitrogen</td><td>T3605</td><td></td></tr><tr><td>HANKs balanced salt buffer</td><td>Life Technologies</td><td>14025092</td><td></td></tr><tr><td>RIPA lysis buffer</td><td></td><td></td><td>50mM Tris-HCl pH 7.4 150mM NaCl 1% NP40 0.25% Na-deoxycholate</td></tr><tr><td>primer TBP 3&#039;</td><td></td><td></td><td>GGAATTGTACCGCAGCTTCAAA</td></tr><tr><td>primer TBP 5&#039;</td><td></td><td></td><td>GATGACTGCAGCAAATCGCTT</td></tr><tr><td>primer KLF4 3&#039;</td><td></td><td></td><td>TGTGACTATGCAGGCTGTGGCAAA</td></tr><tr><td>primer KLF4 5&#039;</td><td></td><td></td><td>ACAGTGGTAAGGTTTCTCGCCTGT</td></tr></tbody></table>

cryosectioning method for microdissection of murine colonic mucosa

Cryosectioning Method for Microdissection of Murine Colonic Mucosa

The colonic mucosal tissue provides a vital barrier to luminal antigens. This barrier is composed of a monolayer of simple columnar epithelial cells. The colonic epithelium is dynamically turned over and epithelial cells are generated in the stem cell containing crypts of Lieberk&#252;hn. Progenitor cells produced in the crypt-bases migrate toward the luminal surface, undergoing a process of cellular differentiation before being shed into the gut lumen. In order to study these processes at the molecular level, we have developed a simple method for the microdissection of two spatially distinct regions of the colonic mucosa; the proliferative crypt zone, and the differentiated surface epithelial cells. Our objective is to isolate specific crypt and surface epithelial cell populations from mouse colonic mucosa for the isolation of RNA and protein.

Colonic tissue sections were processed for histological assessment and H&amp;E staining13. A traditional cross-section view of the mucosa is seen in Figure 2A. Basal areas contain the muscularis externa, composed mainly of the circular muscularis. Proceeding toward the lumen, the muscularis mucosa is evident adjacent to the crypt-base epithelial cells, transitional cells are in the middle of the tissue, and finally, surface cell populations face the gut lumen. The serial sectioning method described here maintains an orientation such that the longitudinal and circular muscularis are encountered first (Figure 2B), followed by the muscularis mucosa (Figure 2C). Note the appearance of non-muscle interstitial cells in the top left of the image. For the downstream analysis described below, muscle sections are discarded. The subsequent sections contain epithelial cells and interstitial tissue (lamina propria), starting with the crypt-base cells (Figure 2D). Note the absence of a central lumen in most of the crypts, which appear darker due to the closely packed nuclei. These layers contain the proliferative compartment. The transitional cells appear as tightly packed glands with prominent central lumens (Figure 2E). Lastly, surface cell populations have an irregular structure, with areas of the epithelial monolayer viewed en face (Figure 2F).
Serial sections as described above may also be processed for immunofluorescence labeling and confocal microscopy (as described here14). Figure 2G shows isolated crypts fixed and permeabilized in 100% methanol and subsequently stained for nuclei (blue) and the cell-cell junction protein Zonula Occludens 1 (ZO-1, green). In the traditional sectioning orientation, crypt and surface cell can be viewed simultaneously (Figure 2G). Note that the ZO-1 junctional stain lines the lumen of the colonic crypt. This Z0-1 lining of the lumen can also be seen in serial sectioned samples of transitional cell populations, in the center of the circular glands (Figure 2G). Enhanced ZO-1 stain is seen in surface cell populations (Figure 2I and J).
Several differentiation factors are known to be expressed in a spatiotemporal fashion along the crypt-to–surface axis. This includes the transcription factor Kruppel-like factor 4 (KLF4), which is known to be enriched in surface cell populations. Using traditional sectioning methods, KLF4 is found in the nuclei of lumen facing surface cell populations (Figure 2K). We therefore speculated that KLF4 mRNA would be predominantly expressed in surface cell populations. To test this, serial sections were collected and grouped into surface, transitional, and crypt-base samples. Subsequently, RNA was harvested using standard Trizol extraction, with an additional purification by RNeasy column and DNAse treatment. RNA was collected from 5 pooled consecutive sections, which yielded between 5-10 µg of total RNA per sample. These samples were then subjected to semi-quantitative real time PCR for both KLF4 and a reference gene, TATA box binding protein 1 (TBP-1) (Figure 2L)14. As shown in Figure 2L, after normalization to TBP-1, surface cells were found to express up to 8 times the KLF4 mRNA that is expressed in crypt cells. Similarly, KLF4 protein levels were found to exhibit spatial regulation along the crypt-surface axis. Serial sections were pooled as described above and then incubated in lysis buffer for 20 min at 4 °C. This yielded between 200-250 µg of protein per sample. Samples were then subjected analysis by SDS-PAGE (Figure 2M)15. As shown in Figure 2M, KLF4 protein levels are dramatically higher in surface cell populations. The above findings demonstrate the ability of this protocol to isolate large amounts of surface and crypt epithelial cells from the murine colonic mucosa.
<img alt="Colonic mucosa diagram and graph; histology sections and crypt height measurements." src="/files/ftp_upload/53112/53112fig1.jpg" data-altupdatedat="1787630408000" data-alt="Figure 1"> 
Figure 1: (A) Schematic showing murine colonic mucosa and external muscle layers. Our method aims to collect discrete surface cell and crypt-base cell populations by serial cryosectioning (10 μm each). The external muscle layers are discarded. (B) Crypt height varies along the length of the colon (distance between crypt-base and surface layers). Data points indicate individual crypt measurements and symbols indicate biological replicates (n = 4). (C) Colon segments collected, bisected, and pinned onto a silicon dissecting dish. (D) A tissue segment approximately 3 cm from the anus is pressed between to razor blades and the frozen on dry ice. (E) Tissue is then mounted on a pre-leveled OCT block. (F) Cryosections are removed and visually inspected.
<img alt="Histology and immunofluorescence of intestinal sections; crypt to surface; KLF4 RNA, protein analysis." src="/files/ftp_upload/53112/53112fig2.jpg" data-altupdatedat="1787630408000" data-alt="Figure 2"> 
Figure 2: Representative data. (A) Colonic tissue stained with Hematoxylin-Eosin in cross-section showing the circular muscularis (c.m.), the muscularis mucosa (m.m.), crypt-base cells, transitional cells, and surface cells. (B-C) colonic muscle layers. (D) Crypt-base cells. Note the absence of a central lumen. (E) Transitional cells. (F) Surface cells. (G) Immunofluorescence staining of isolated colonic crypts. ZO-1 (green) and nuclei (blue) are observed in cross-section. (H-I) ZO-1 and nuclear staining in transitional and surface cells. (J) magnified view of ZO-1 staining. (K) KLF4 (green) is enriched in surface cell populations. (L) Real-time PCR assessment of KLF4 mRNA levels between the three compartments. (M) Western blot analysis of KLF4 protein levels in these cell populations.

Here we describe a simple method for the isolation of spatially distinct murine colonic epithelial surface cells from the underlying crypt-base cells.

The colonic mucosal tissue provides a vital barrier to luminal antigens. This barrier is composed of a monolayer of simple columnar epithelial cells. The ...

The overall goal of this procedure is to micro dissect two spatially distinct regions of the colon, the proliferative K crypt zone, and the differentiated surface epithelial cells. This is accomplished by first removing the mouse colon. The second step is to freeze the tissue between two metal plates.Next, the tissue is mounted on a pre leveled OCT block. The final step is to section the tissue on a cryostat at 10 micron intervals. Ultimately, real-time PCR or Western blot is used to show changes in gene and protein expression.The advantage of our technique is that it's fast, inexpensive, and high yield demonstrating. Our procedure is Christian Garner Schmidt, a technician in our group. All procedures using animals were reviewed and approved by the Emory University Institutional Animal Care and Use Committee, and were performed according to National Institutes of Health criteria.After setting up the cryostat, as usual, equilibrate the cryostat blades and chucks to minus 20 degrees Celsius. Then fill an empty cryo mold with optimal cutting temperature compound and equilibrate to minus 20 degrees Celsius. This will take approximately 30 minutes.Remove the frozen OCT from the mold and fix it to the chuck with liquid OCT. Place the chuck in the microtome arm and allow the OCT to set for 10 minutes. Set the cryostat to 10 microns per section and shave the OCT block until it is flat back the microtome arm away from the blade by several centimeters.Next, prepare two razor blades per sample using a metal file, dull the sharp edge of the blades. Then remove the aluminum flange with forceps. Prepare a 10 centimeter tissue culture dish, 50%filled with silicon, and with 10 to 15 dissection pins.Add five milliliters of room temperature, hanks buffer to the dish after euthanizing the mouse according to approved methods and excising a distal colon segment between zero and six centimeters from the anus. Use scissors to cut. Open the colon longitudinally and remove the fecal contents.Pin the tissue to the silicone dissection dish containing Hank's buffer with the mucosal surface facing up. Stretch the tissue using the dissection pins. Then let it rest for 10 minutes at room temperature to remove folds from the tissue and to allow the muscle layers to relax.Acts after the tissue has rested, remove all but the end pins. Slide a razor blade under the desired section of tissue, and then pour off the hanks buffer. Add another razor blade to the top making a sandwich.Cut the tissue segment and remove the end pins. Transfer the razor blade tissue sandwich to dry ice. Allow the tissue to freeze for five to 10 minutes.Pick up the razor tissue sandwich and allow it to warm slightly by placing a finger on the top blade. Separate the sandwich and cut around the edges of the tissue segment. Cutting a tissue segment approximately 0.5 centimeters by one centimeter.Allow the tissue to warm until the ice on top of the tissue begins to melt. At this point, quickly and carefully press the tissue into the OCT block. In the cryostat place a finger over the sample.The heat transfer will allow you to remove the blade without disrupting the tissue. Coat the tissue with OCT and allow it to equilibrate for five minutes. Then cut sections at 10 microns.Put the sections on a slide and visually inspect the sections until the crypts are seen. Place sections in 1.5 milliliter tubes or on slides. This image shows colonic tissue stained with hematin eoin in traditional cross-section with the circular muscularis labeled cm.The muscularis mucosa labeled MM the crypt base cells, transitional cells and surface cells are clearly seen. This image shows the circular muscularis after serial sectioning. As we proceed towards the surface cells, the muscularis mucosa is seen.This image shows h and D stained crypt base cells at higher magnification. Note the absence of a central lumen. Here, transitional cells are seen and this image shows the surface cells.The following images show immunofluorescent staining of isolated colonic crypts staining for the cell to cell junction protein. Soula occludin one or ZO one appears green and nuclei, which appear blue are observed in cross-section. The transitional and surface cells are shown here after serial sectioning.Several differentiation factors are expressed in a spatiotemporal fashion along the cryp surface axis. This includes the transcription factor cripple like factor four shown in green, which is enriched in surface cell populations when viewed in cross-section serial sectioning allows real-time PCR assessment of KLF four mRNA levels between the three compartments. Finally, this western blot demonstrates levels of KLA four protein in these cell populations.Don't forget that working with microtone blades can be extremely hazardous, so be extra careful whenever you're performing this procedure.

cryosectioning-method-for-microdissection-of-murine-colonic-mucosa

Research

JoVE Journal

Biology

In this video, we demonstrate a technique to isolate whole crypts from a mouse’s small intestine. The isolated whole crypts can be used to propagate long-lived and self-renewing 3D organoids in vitro.

Intestinal Crypts Isolation: A Method to Isolate Whole Crypts from Small Intestine of Murine Model

There is an increasing interest in understanding the immunological functions of specific subpopulations of cells in Peyer's patches (PPs), the primary inductive sites of gut-associated lymphoid tissues.  Here we outline parallel protocols for preparing PP single cell preparations for flow cytometric analysis and PP cryosections for immunostaining.

Isolating And Immunostaining Lymphocytes and Dendritic Cells from Murine Peyer's Patches

The myofibroblast is an influential stromal cell of the gastrointestinal tract that regulates important physiologic processes in both normal and disease states. We describe a technique that allows for the isolation of primary myofibroblasts from both mouse and human colon tissue, which can be utilized for in vitro experimentation.

Isolation of Primary Myofibroblasts from Mouse and Human Colon Tissue

The use of a simple device to cut and ‘roll’ mouse intestines to rapidly prepare whole mount preparations is described.

A Simple Device to Rapidly Prepare Whole Mounts of the Mouse Intestine

Consecutive cryo-sections are collected to enable histological applications and enrichment of RNA for gene expression measurements using adjacent regions from a single mouse skeletal muscle. High-quality RNA is obtained from 20 - 30 mg of pooled cryosections and measurements are directly compared across applications.

Cryosectioning of Contiguous Regions of a Single Mouse Skeletal Muscle for Gene Expression and Histological Analyses

The goal of this protocol is to obtain high-integrity RNA samples from enteric ganglia isolated from unfixed, freshly-resected human intestinal tissue using laser capture microdissection (LCM). This protocol involves preparing flash-frozen samples of human intestinal tissue, cryosectioning, ethanolic staining and dehydration, LCM, and RNA extraction.

Optimization of Laser-Capture Microdissection for the Isolation of Enteric Ganglia from Fresh-Frozen Human Tissue

Enterochromaffin (EC) cells comprise a small subset of gastrointestinal epithelial cells. EC cells are electrically excitable and release serotonin, yet difficulties in culturing and identifying EC cells have limited physiological studies. The method presented here establishes a primary culture model amenable to examination of single EC cells by electrophysiology.

Whole Cell Electrophysiology of Primary Cultured Murine Enterochromaffin Cells

Lack of standardization for murine tissue processing reduces the quality of murine histopathological analysis as compared to human specimens. Here, we present a protocol to perform histopathological examination of murine inflamed and uninflamed colonic tissues to show the feasibility of robotic systems routinely used for processing and embedding human samples.

Using Robotic Systems to Process and Embed Colonic Murine Samples for Histological Analyses

The goal of this protocol is to isolate mononuclear cells that reside in the lamina propria of the colon by enzymatic digestion of the tissue using collagenase. This protocol allows for the efficient isolation of mononuclear cells resulting in a single cell suspension which in turn can be used for robust immunophenotyping.

Isolation of Lamina Propria Mononuclear Cells from Murine Colon Using Collagenase E

Here, we provide a detailed description of the procedure to induce colonoscopic-guided pinch biopsies in mice and track wound closure in real time. Additionally, methods for the preparation of tissues for histological, immunohistochemical and molecular analyses of the wound bed are provided.

Performing Colonoscopic-Guided Pinch Biopsies in Mice and Evaluating Subsequent Tissue Changes

The present protocol describes establishing a murine colonic organoid system to study the activity and functioning of colonic stem cells in a claudin-7 knockout model.

Three-Dimensional Culture of Murine Colonic Crypts to Study Intestinal Stem Cell Function Ex Vivo

Learn cryosectioning to microdissect murine colonic mucosa into crypt-base and surface epithelial regions. This fast, inexpensive method enables gene and protein expression analysis via real-time PCR and Western blot.

Cryosectioning Method for Microdissection of Murine Colonic Mucosa

Explore More Videos